Application of Maize ZmRLR2 Gene in Maize Lodging Resistance
By overexpressing the ZmRLR2 gene in corn, the root lignin content and tensile strength were enhanced, the problem of the lack of corn lodging resistance genes was solved, the lodging resistance of corn was improved, and the breeding process was promoted.
Patent Information
- Application Number
- CN202510082680.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-20
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-01-20
AI Technical Summary
The existing technology has few lodging resistance genes for corn, which makes it difficult to meet breeding needs, resulting in a decrease in corn yield and quality and limited mechanized harvesting.
The maize ZmRLR2 gene was overexpressed, and genome-wide association analysis showed that the gene was significantly associated with lodging. Overexpression significantly enhanced the root system and improved lodging resistance.
Through overexpression of the ZmRLR2 gene, the corn root system is significantly enlarged, the lignin content is increased, the root tensile strength is enhanced, the lodging resistance is significantly improved, and the development of new breeding varieties is promoted.
Smart Images

Figure CN119932041B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular genetics and breeding of corn lodging resistance, and more particularly to the application of corn ZmRLR2 gene in corn lodging resistance. Background Art
[0002] As one of the three major grain crops, corn plays a vital role in ensuring food security and promoting national economic development. With the frequent occurrence of extreme weather events such as typhoons and heavy rains, and the increase in planting density, lodging has become a common problem in corn production. Lodging reduces corn yield, increases the risk of kernel mold, and deteriorates quality, significantly limiting mechanized corn harvesting. Consequently, corn lodging severely restricts yield, quality, and mechanized harvesting. With the shift in labor and the development of mechanization, higher demands are being placed on corn lodging resistance. However, the number of lodging resistance genes identified in maize is currently limited, far from meeting the needs of maize lodging resistance breeding. Cloning and mechanism analysis of lodging resistance genes in maize has important theoretical and practical value.
[0003] Therefore, providing an application of the maize ZmRLR2 gene in maize lodging resistance is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0004] In view of this, the present invention addresses the problem that the current lack of corn lodging resistance genes and germplasm resources has seriously hindered the progress of corn lodging resistance breeding; provides the application of corn ZmRLR2 gene in corn lodging resistance. Overexpression of ZmRLR2 gene can improve lodging resistance and can be directly applied to corn lodging resistance breeding.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions:
[0006] Genome-wide association analysis of 385 maize inbred lines at the V11 stage for field lodging (root lodging) identified a gene, ZmRLR2, that controls lignin synthesis. Candidate gene association analysis revealed a significant association between this gene and lodging. Plants overexpressing this gene exhibited significantly larger root systems and enhanced resistance to root lodging.
[0007] Application of the maize ZmRLR2 gene in maize lodging resistance, the nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.
[0008] Furthermore, the use of a biomaterial overexpressing the maize ZmRLR2 gene in maize lodging resistance, wherein the biomaterial is any one of the following:
[0009] A: an expression cassette capable of overexpressing the maize ZmRLR2 gene having a nucleotide sequence as shown in SEQ ID NO.5;
[0010] B: recombinant vector containing the expression cassette described in A;
[0011] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
[0012] Furthermore, the maize ZmRLR2 gene is used in breeding lodging-resistant maize germplasm, and the nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.
[0013] Furthermore, the application of the maize ZmRLR2 gene in maize breeding is disclosed. The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.
[0014] The present invention provides a new gene resource for corn lodging resistance breeding. In the future, by exploring the excellent alleles of this gene, designing molecular markers, and introducing excellent haploid materials into commercial inbred lines, corn plants with enhanced lodging resistance can be obtained and promoted and applied in production.
[0015] As can be seen from the above technical solutions, compared with the existing technology, the present invention provides the application of the maize ZmRLR2 gene in maize lodging resistance. It is the first to find that overexpressing the ZmRLR2 gene significantly increases the root system of maize, the root lignin content, and the root tensile strength. This invention has important application value for the breeding of new lodging-resistant maize varieties and new germplasm. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0017] Figure 1 The accompanying figure shows the expression pattern analysis of ZmRLR2 in the present invention; different letters represent significant differences at the P < 0.05 level;
[0018] Figure 2 The accompanying figure shows the RT-qPCR identification of the ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material without the overexpression vector); OE represents the ZmRLR2 overexpression strain; *** represents a significant difference from KN5585 at the P < 0.001 level, and ns represents no significant difference from KN5585;
[0019] Figure 3The accompanying figure shows the root phenotype analysis of the maize ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material not transformed with the overexpression vector); OE represents the ZmRLR2 overexpression strain;
[0020] Figure 4 The accompanying figure shows lignin staining of the roots of the maize ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material not transfected with the overexpression vector); OE represents the ZmRLR2 overexpression strain;
[0021] Figure 5 The accompanying figure shows the root tensile strength analysis of the maize ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material without the overexpression vector); OE represents the ZmRLR2 overexpression strain; *P<0.05; **P<0.01; ***P<0.001. DETAILED DESCRIPTION
[0022] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.
[0023] Example 1 Analysis of ZmRLR2 expression pattern
[0024] To understand the expression pattern of ZmRLR2, samples were collected from the roots, leaves, tassels, first, second, third, and fourth stems of the maize inbred line B73 during the silking stage. RNA was extracted, reverse transcribed into cDNA, and quantitative analysis of ZmRLR2 was performed using primers ZmRLR2-qPCR-F / R. It was found that ZmRLR2 was most highly expressed in the roots ( Figure 1 GAPC1 was used as the internal reference gene, and the primers for detecting the internal reference gene were GAPC1-qPCR-F / R.
[0025] The specific primer sequences are as follows:
[0026] ZmRLR2-qPCR-F:ATTCGCTCGTCGTCTCT; SEQ ID NO.1;
[0027] ZmRLR2-qPCR-R: CGCATGATGTTGCATTGC; SEQ ID NO.2;
[0028] GAPC1-qPCR-F:CCCTTCATCACCACGGACTAC; SEQ ID NO.3;
[0029] GAPC1-qPCR-R: AACCTTCTTGGCACCACCCT; SEQ ID NO.4.
[0030] Example 2 Overexpression of ZmRLR2 significantly enhances the lodging resistance of maize
[0031] The CDS sequence of ZmRLR2 is shown in SEQ ID NO.5.
[0032] ATGGCTGCCGGCGGCGACGACA CCACCATCGCGCAGGTCCACAGCGGCATCGACAGCAGCAACAAGACGCTGCTCAAGAGCGAGGCCCTCTACAAGTACGTGCTGGACACGTCGGTGCTGCCGCACGAGCCGGAGAGCATGCGTGAGCTGCGGCTGGTGACCGACAAGCACGAGTGGGGGTTCATGCAGTCGTCCCCGGACGAGGCGTCGCTGCTGCGGATGCTGATCAAGCTGAGCGGCGCGCGGCGGACGCTGGAGGTGGGCGTGTTCACGGGCTACTCGCTGCTGGCGACGGCTCTGGCGCTGCCCGCCGACGGCAAGGTCATCGCATTCGACGTGAGCCGCGAGTACTACGACATCGGCCGCCCCTTCATCGAGCGCGCCGGGGTGGCGGGCAAGGTGGACTTCCGGGAGGGCCCGGCGCTGGAGCAGCTGGACGAGCTCCTCGCCGACCCGGCCAACCACGGCGCCTTCGACTTCGCCTTCGTCGACGCCGACAAGCCTAACTACGTCCGGTACCACGAGCAGCTGCTCCGCCTGGTGCGCGTCGGGGGTACCGTCGTGTACGACAACACGCTGTGGGCCGGTACTGTGGCGCTTCCCCCCGACGCGCCGCTCAGCGACCTCGACCGCAGGTTCTCCGCCGCCATCAGGGAACTCAACGTCCGGCTTTCTCAGGATCCCCGCGTCGAGGTCTGCCAGCTCGCCATCGCCGACGGCGTCAC CATCTGCCGCCGCGTCGTCTGA ; SEQID NO.5.
[0033] In order to study the function of the ZmRLR2 gene, the CDS sequence of ZmRLR2 (as shown in SEQ ID NO. 5) was constructed into the plant binary expression vector pCAMBIA3301 and driven by the Ubi promoter.
[0034] 1) Construction of expression vector pCAMBIA3301-UBI
[0035] (1) Vector digestion
[0036] The expression vector pCAMBIA3301 was digested with the restriction endonucleases HindIII and BamHI (NEWENGLAND BioLabs). The digestion system consisted of 11 μg of pCAMBIA330, 5 μL of CutSmart buffer, 1 μL each of HindIII and BamHI, and 50 μL of ddH2O. Digestion was performed at 37°C for 1 hour. After electrophoresis, the fragments were recovered from the gel.
[0037] (2) Gene synthesis of the full-length UBI promoter
[0038] The linker sequence after enzyme digestion of pCAMBIA3301 and the full length of the UBI promoter were synthesized using gene synthesis technology, and the sequence is shown in SEQ ID NO.6.
[0039] Restriction linker sequence and full-length synthetic sequence of UBI promoter:
[0040]
[0041]
[0042] In SEQ ID NO. 6, the underlined portion is the enzyme cleavage linker sequence, and the ununderlined portion is the UBI promoter sequence; the enzyme cleavage site is marked in italics.
[0043] (3) Homologous recombination
[0044] Ligation of gene synthesis product with vector: The gene synthesis product was ligated with the digested vector pCAMBIA3301 by homologous recombination. The ligation system was: a vector to insert ratio of approximately 1:2; 1 μL of 5X In-Fusion Snap Assembly Master Mix (Takara) recombinase; and ddH2O was added to make up to 5 μL. Ligation was performed at 50°C for 15 min.
[0045] (4) Recombinant plasmid transformation:
[0046] Heat shock transform 2 μl of the ligation product into competent E. coli DH5ɑ, plate onto LB solid culture plates containing 50 mg / L kanamycin, and incubate overnight at 37°C. Colonies were detected for positive results using primers pCAMBIA3301-F / R. After sequencing, the recombinant plasmid pCAMBIA3301-UBI was extracted and used in subsequent experiments.
[0047] The specific primer sequences are as follows:
[0048] pCAMBIA3301-F: CTCGTATGTTGTGTGGAATTGTGAG; SEQ ID NO.7;
[0049] pCAMBIA3301-R: TGAACTTCAGGGTCAGCTTGCCGTAG; SEQ ID NO.8.
[0050] 2) Construction of overexpression vector pCAMBIA3301-UBI-ZmRLR2
[0051] (1) PCR amplification of the ZmRLR2 CDS sequence:
[0052] Total RNA was extracted from the roots of maize inbred line B73 and reverse transcribed into cDNA. Using cDNA as template, pCAMBIA3301-UBI-ZmRLR2-F and pCAMBIA3301-UBI-ZmRLR2-R as primers, and high-fidelity enzyme KOD One TM PCR Master Mix (TOYOBO) was used for PCR amplification. The amplification system was KOD One TM PCR Master Mix 25 μL, template 2 μL, upstream and downstream primers 1.5 μL each, ddH2O 20 μL. PCR program: 98°C for 10 s, 58°C for 5 s, 68°C for 1 s, 34 cycles.
[0053] The specific primer sequences are as follows:
[0054] pCAMBIA3301-UBI-ZmRLR2-F:
[0055] CAGGTCGACTCTAGAGGATCC ATGGCTGCCGGCGGCGACGACA ;
[0056] SEQ ID NO.9;
[0057] pCAMBIA3301-UBI-ZmRLR2-R:
[0058] TTCGAGCTGGTCACCGAGCTC TCAGACGACGCGGCGGCAGATG; SEQ ID NO.10.
[0059] (2) Vector digestion:
[0060] The expression vector pCAMBIA3301-UBI was digested with restriction endonucleases SacI and BamHI (NEWENGLAND BioLabs). The digestion system consisted of 1 μg of pCAMBIA3301-UBI, 5 μL of CutSmart buffer, 1 μL each of SacI and BamHI, and 50 μL of ddH2O. Digestion was performed at 37°C for 1 hour. After electrophoresis, the cells were recovered from the gel.
[0061] Ligation of PCR product with vector: Homologous recombination ligation was performed between the PCR amplification product and the digested vector pCAMBIA3301-UBI. The ligation system used was: a vector to insert ratio of approximately 1:2; 1 μL of 5X In-Fusion SnapAssembly MasterMix (Takara) recombinase; and ddH2O to a volume of 5 μL. Ligation was performed at 50°C for 15 min.
[0062] (3) Recombinant plasmid transformation:
[0063] A 2 μl portion of the ligation product was heat-shock transformed into competent Escherichia coli DH5ɑ, plated onto LB solid culture plates containing 50 mg / L kanamycin, and cultured overnight at 37°C. Colonies were positively identified using primers BamH1-F and SacI-R. Following sequencing, the recombinant plasmid pCAMBIA3301-UBI-ZmRLR2 was extracted and transformed into competent Agrobacterium tumefaciens EHA105 cells. After PCR verification, it was used for maize genetic transformation.
[0064] The specific primer sequences are as follows:
[0065] BamHI-F: TTAGCCCTGCCTCATACG; SEQ ID NO.11;
[0066] SacI-R: GATAATCATCGCAAGACCGGCAAC; SEQ ID NO. 12.
[0067] The steps for Agrobacterium transformation are as follows:
[0068] Add 1 μl of recombinant plasmid to 50 μl of Agrobacterium tumefaciens EHA105 competent cells. Gently stir the bottom of the tube to mix thoroughly. Incubate on ice for 10 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and finally in an ice bath for 5 minutes. Add 400 μl of antibiotic-free LB medium to each tube for recovery. Transfer the tube to a shaker at 200 rpm and incubate at 28°C for 2-3 hours. Collect the cells by brief centrifugation at 4000 rpm, resuspend them in 50 μl of LB liquid medium, pipette evenly, and spread onto solid LB medium containing the antibiotic (50 mg / L kanamycin). Incubate the cells upside down at 28°C for 2-3 days.
[0069] 3) Obtaining overexpression lines
[0070] Suspension medium: 1 / 2MS + sucrose 68.5 g / L + glucose 36 g / L + L-proline 0.115 g / L.
[0071] Infection medium: 1 / 2MS + sucrose 68.5 g / L + glucose 36 g / L + L-proline 0.115 g / L + acetosyringone 200 mM + cysteine 200 mg / L.
[0072] Co-culture medium: 1 / 2MS + sucrose 20 g / L + glucose 10 g / L + proline 0.115 g / L + thiamine hydrochloride 0.5 mg / L + AgNO3 20 mM + L-cysteine 200 mg / L + 2,4-D 0.5 mg / L + picloram 2.2 mg / L + acetosyringone 200 mM.
[0073] Resting medium: MS + sucrose 30 g / L + proline 1.38 g / L + thiamine hydrochloride 0.5 mg / L + AgNO3 20 mM + hydrolyzed casein 0.5 g / L + 2,4-D 0.5 mg / L + picloram 2.2 mg / L + timentin 200 mg / L.
[0074] Selection medium: MS + sucrose 30 g / L + proline 1.38 g / L + thiamine hydrochloride 0.5 mg / L + AgNO3 20 mM + hydrolyzed casein 0.5 g / L + 2,4-D 0.5 mg / L + picloram 2.2 mg / L + timentin 200 mg / L + phosphinothricin 40 mg / L.
[0075] Differentiation medium: MS + sucrose 20 g / L + 6-BA 0.1 mg / L + KT 1 mg / L + Timentin 200 mg / L.
[0076] Rooting medium: MS + sucrose 20 g / L + MES 0.5 g / L + IBA 0.2 mg / L.
[0077] The ZmRLR2 gene-containing EHA105 was transformed into the maize inbred line KN5585 to obtain transgenic seeds of seven independent transgenic events. The specific process is as follows:
[0078] Place freshly peeled maize embryos, approximately 1 mm in size, into a 2 ml plastic centrifuge tube containing 1.8 ml of suspension medium. Let them suspend and soak for 20 minutes. After the embryos are collected, remove the liquid, heat shock them for 5 minutes, and then infect them with Agrobacterium infection medium (containing the EHA105 Agrobacterium transformed with the recombinant plasmid) for 5 minutes, while air is blown into the infection medium. Pour the infected maize embryos onto the co-culture medium, remove any excess Agrobacterium from the surface with a pipette, and co-cultivate them at 23°C in the dark for 3 days. After co-cultivation, transfer the embryos to a resting medium and incubate them at 28°C in the dark for 6 days. Then, transfer them to a selective medium and begin a two-week selection culture. After that, switch to a fresh selection medium and continue the selection culture for another two weeks. The resistant callus tissue is transferred to a differentiation medium and cultured at 25°C and 5000lx light for 3 weeks; the differentiated seedlings are transferred to a rooting medium and cultured at 25°C and 5000lx light until they take root; the seedlings are transferred to small pots for growth, transplanted to a greenhouse after a certain growth stage, and the offspring seeds are harvested after 3-4 months.
[0079] Ten T1 seeds were planted in the field with normal water and fertilizer management. At the budding stage, the corn leaves were smeared with glufosinate to identify transgenic lines. After 3-4 days, the corn phenotypes were observed. Those with wilted leaves indicated that the lines lacked the Bar gene and had not been transfected with the transgenic line. Those with normal leaves indicated that the lines contained the Bar gene and had been successfully transfected with the transgenic line. Seven successful transgenic events were identified.
[0080] ZmRLR2 expression was assessed in seven overexpressing strains (ZmRLR2-OE / KN5585) using RT-qPCR using primers ZmRLR2-qPCR-F / R. GAPC1 was used as a reference gene, and the primers used for detection were GAPC1-qPCR-F / R.
[0081] The expression level of ZmRLR2 in OE-1, OE-2, OE-3, OE-4, and OE-5 strains was more than 5 times that of the transgenic negative control material (Nontransgenic, abbreviated as NT) ( Figure 2 Therefore, the two strains with the highest expression levels, OE-1 and OE-2, were selected for subsequent studies.
[0082] Root size and lignin content directly affect the occurrence of lodging. Since ZmRLR2 was detected by root lodging, the focus was on root phenotype. The roots of the overexpression strains were dug out from the field and after washing, it was found that the roots of the two overexpression strains (OE-1 and OE-2) were significantly larger than those of the negative control (Nontransgenic, abbreviated as NT) ( Figure 3 ). The roots in the same layer and the same part were stained with phloroglucinol (WIESNER) and potassium permanganate. Phloroglucinol staining was for total lignin, and potassium permanganate staining was for S-lignin. It was found that the total lignin and S-lignin contents of the overexpression strain were significantly higher than those of the negative control ( Figure 4 ).
[0083] To simulate the natural lodging environment, the corn field was fully irrigated and the root tensile strength was measured by using a tensile tester to pull the corn 40 degrees from 10 cm above the ground. The average root tensile strength of the NT material was 98.61N, the average root tensile strength of the OE-1 material was 146.74N, and the average root tensile strength of the OE-2 material was 223.74N. Statistical analysis found that the root tensile strength of the two overexpression lines was significantly higher than that of the negative control ( Figure 5 These results indicate that ZmRLR2 positively regulates the root lodging resistance of maize roots and has important potential for improving maize lodging resistance.
[0084] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Application of maize ZmRLR2 gene in maize lodging resistance, characterized in that: The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.
5.
2. Application of biomaterials overexpressing the maize ZmRLR2 gene in maize lodging resistance, characterized in that: The biological material is any one of the following: A: an expression cassette capable of overexpressing the maize ZmRLR2 gene having a nucleotide sequence as shown in SEQ ID NO.5; B: recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
3. Application of the maize ZmRLR2 gene in breeding lodging-resistant maize germplasm, characterized in that: The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.
5.
4. Application of the maize ZmRLR2 gene in maize breeding, characterized in that: The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.
Citation Information
Patent Citations
Full-length cDNA (complementary Deoxyribose Nucleic Acid) of switchgrass lignin biosynthetic enzyme gene PvCCoAOMT and cloning method of full-length cDNA
CN103343133A
Corn lodging-resistant gene and application of related protein and biological material thereof
CN117024538A