An Mn5 gene that regulates maize kernel size, its molecular markers and applications

By regulating the Mn5 gene and its molecular markers that control maize kernel size, the problem of time-consuming and labor-intensive processes in traditional maize breeding has been solved, achieving efficient detection and improved breeding efficiency.

CN119932045BActive Publication Date: 2026-01-06HENAN AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510109386.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-23
Publication Date
2026-01-06
Estimated Expiration
2045-01-23

AI Technical Summary

Technical Problem

Traditional maize germplasm selection methods are time-consuming, complex, and inefficient, making it difficult to effectively address the challenges in the maize breeding process. Furthermore, existing technologies struggle to efficiently identify superior maize varieties, and are time-consuming, labor-intensive, and prone to gene linkage redundancy.

Method used

This invention provides an Mn5 gene and its molecular marker that regulate maize kernel size. A highly efficient detection method is developed through PCR primer amplification and restriction endonuclease digestion. The Mn5 gene specifically affects maize kernel size, participates in kernel development, and influences the development rate of the embryo, endosperm, and basal transfer layer.

Benefits of technology

It enables efficient detection of maize kernel size, provides efficient detection markers, increases maize yield, simplifies germplasm resource analysis and molecular-assisted genetic breeding, and improves breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932045B_ABST
    Figure CN119932045B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant molecular biology, and discloses a kind of regulation corn kernel size Mn5 Gene, molecular marker and application thereof.The regulation corn kernel size Mn5 Gene of the application, a G to C single base mutation exists at 325bp downstream of ATG of gene shown in nucleotide sequence such as SEQ ID No.1, causes that 109th amino acid coded by it is mutated from leucine to valine.The regulation corn kernel size Mn5 Gene obtained by the application by using map-based cloning method, specifically affects corn kernel size, is involved in corn kernel development, and affects the development speed of corn embryo, endosperm and basal transfer layer.The application provides technical support for improving corn yield, corn germplasm resource analysis, molecular assisted genetic breeding and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, specifically to a method for regulating the size of maize kernels. Mn5 Genes, their molecular markers, and their applications. Background Technology

[0002] Corn is the world's largest food crop, possessing the unique advantages of serving as a food, feed, industrial raw material, and energy crop. With social development and the improvement of people's living standards, the demand for corn continues to grow.

[0003] However, maize germplasm is the material carrier for breeding superior maize hybrids and developing maize production. The improvement and innovation of maize germplasm has become one of the development directions of maize breeding worldwide. Germplasm resources are the premise and foundation of maize breeding. A deep understanding and rational selection of germplasm resources can significantly improve breeding efficiency and accelerate the breeding process. Traditional hybrid maize variety breeding is a long and complex process, requiring the hybridization of maize varieties with different advantages to identify good combinations suitable for production needs, and then to cultivate new varieties that are high-yielding, stable-yielding, multi-resistant, widely adaptable, and of excellent quality. This breeding method is not only time-consuming, labor-intensive, and inefficient, but also prone to gene linkage redundancy.

[0004] Therefore, there is an urgent need to establish scientific, practical, rapid, and accurate methods for discovering and selecting maize germplasm resources, which has significant application value for maize breeding. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for regulating the size of corn kernels. Mn5 Genes, their molecular markers, and their applications.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a method for regulating the size of corn kernels. Mn5 The gene has a single G-to-C mutation located 325 bp downstream of the ATG in the nucleotide sequence shown in SEQ ID No. 1.

[0008] Secondly, this invention provides a method for regulating the size of corn kernels. Mn5 The protein encoded by the gene has an amino acid sequence as shown in SEQ ID NO.2, in which the 109th amino acid of the protein is mutated from leucine to valine.

[0009] Thirdly, the present invention provides a method for amplifying the regulation of corn kernel size. Mn5 The PCR primers for the gene have nucleotide sequences shown in SEQ ID No. 3 and 4.

[0010] Fourthly, the present invention provides a method for regulating the size of corn kernels. Mn5 Molecular markers for genes, said molecular markers comprising at least one of the following primer sets:

[0011] i. The nucleotide sequences of the primer set are shown in SEQ ID No. 35, 36, 37, and 38;

[0012] ii. The nucleotide sequences of the primer set are shown in SEQ ID No. 35, 36, 43, and 44.

[0013] Fifthly, the present invention provides a method for identifying and regulating the size of corn kernels. Mn5 A gene kit, including the aforementioned molecular markers.

[0014] As a preferred embodiment of the kit described in this invention, it further includes a restriction endonuclease. Xho I and / or Nco I.

[0015] Sixthly, the present invention provides a method for identifying mutants of maize kernel size. Mn5 The genetic approach includes the following steps:

[0016] (1) Extract genomic DNA from the maize material to be tested as a template and perform PCR amplification using the molecular marker or the kit described above;

[0017] (2) The PCR amplification product is analyzed by electrophoresis. If the obtained amplification product is a 752bp DNA fragment, then the maize material to be tested is a DNA fragment with... Mn5 Genotype of corn.

[0018] Preferably, the DNA fragment is subjected to restriction endonuclease... Xho After enzyme digestion, it is 143 bp, or after restriction endonuclease digestion. Nco After enzyme digestion, it is 135 bp.

[0019] Seventhly, the present invention relates to the method for regulating the size of corn kernels. Mn5 Genes, the aforementioned regulators of corn kernel size Mn5 The application of molecular markers for genes in increasing maize yield.

[0020] Eighthly, the present invention relates to the method for regulating the size of corn kernels. Mn5 Genes, the aforementioned regulators of corn kernel size Mn5 The application of molecular markers in the analysis and identification of maize germplasm resources.

[0021] Ninthly, the present invention relates to the method for regulating the size of corn kernels. Mn5 Genes, the aforementioned regulators of corn kernel size Mn5 The application of molecular markers in gene molecular marker-assisted breeding of maize.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] This invention has found that Mn5 The mutant kernels are smaller, with slightly wrinkled tips, lighter seed coat color, and significantly reduced 100-kernel weight. The development of the embryo, endosperm, and basal transfer layer is delayed. The mutant can grow, develop, and bear fruit normally, but the plant height is reduced. Map-based cloning was used to obtain the mutant that regulates maize kernel size. Mn5 Genes specifically influence the size of corn kernels. The corn of this invention... Mn5 Genes regulate kernel size, participate in maize kernel development, and influence the development rate of maize embryo, endosperm, and basal transfer layer, playing a crucial role in increasing maize yield. This invention... Mn5 Molecular markers of mutation sites provide efficient detection markers for the utilization of this gene. The detection methods are highly accurate and simple to operate, providing technical support for improving maize yield, maize germplasm resource analysis, and molecular-assisted genetic breeding. Attached Figure Description

[0024] Figure 1 for Mn5 Phenotypic and biochemical analysis of mutant seeds;

[0025] Figure 1 In the middle, A: kernel phenotype on mature, segregating ears; B: wild type and... Mn5 C: Comparison of grain length and width between mutant grains; D: Difference in 100-grain weight between wild type and mutant grains; E: Difference in non-prolyzable protein, prolyzable protein, and total protein content between wild type and mutant grains; F: SDS-PAGE electrophoresis analysis of non-prolyzable protein, prolyzable protein, and total protein content between wild type and mutant grains; G, H: Difference in seedling emergence between wild type and mutant grains; I, J, K: Difference in plant height and ear leaf position at maturity between wild type and mutant grains; L, M: Difference in mature ear and 100-grain weight between wild type and mutant grains.

[0026] Figure 2 for Mn5 Gene map-based cloning, gene structure and allelic testing verification;

[0027] Figure 2 In the middle, A: Mn5 Map-based cloning of genes; B: Mn5 Gene structure diagram; C: Mn5 and Mn5 Premature termination mutant mn5-1 Verification by isotropic testing; D: Mn5Allelic testing for genotyping.

[0028] Figure 3 for Mn5 Mutation site specificity analysis;

[0029] Figure 3 In the middle, A: Using specific dCAPs markers in 355 maize inbred lines to... Mn5 Specific analysis was performed on the mutation sites; the red arrows indicate sites containing mutations related to... Mn5 Inbred lines with the same mutation site; B: Based on Mn5 Statistical analysis of grain length and width of 355 maize inbred lines identified by mutation sites; C: containing [mutation sites]. Mn5 Sequencing verification of inbred lines with the same mutation site.

[0030] Figure 4 for Mn5 Correlation analysis between natural gene variation and maize kernel size;

[0031] Figure 4 In the middle, A: Mn5 Linkage disequilibrium (LD) analysis of SNP sites within the gene segment that were significantly associated with 100-grain weight and grain length. The schematic diagram shows a 3.7-kb fragment, including an approximately 2-kb promoter region and a 300bp 3'-downstream region. The start codon (ATG) is marked as "+1". Each point represents a single nucleotide polymorphism (SNP) site. P Values ​​are displayed as -log10, with orange blocks indicating the degree of LD; B: Significant SNP sites in Mn5 A schematic diagram of the CDS region location; chr5.s_201335080 is a non-synonymous mutation site associated with both 100-grain weight and grain length, and n represents the number of genotypes corresponding to each haplotype; C: A two-tailed t-test was used to compare the 100-grain weight and grain length of the two haplotypes at the chr5.s_201335080 site, and the statistical results are shown in a box plot. Detailed Implementation

[0032] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0033] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0034] Example 1: Corn Mn5 Genes influence seed size

[0035] Maize kernel mutants purchased from the US Maize Genetic Cooperation Germplasm Center mn5 Phenotypic observation of mature mutant seeds revealed that the length and width of the mutant seeds were significantly smaller than those of the wild type (see...). Figure 1 (A, B), and statistical analysis was performed on the 100-kernel weight of wild-type and mutant grains from the same ear. The results showed that the 100-kernel weight of the mutant grains was significantly reduced (see A, B). Figure 1 C), Seedling Experiment Maize Kernel Mutant mn5 Seedlings can germinate normally (see) Figure 1 (G, H) The mutants can grow to the mature stage and develop and bear fruit normally, but the plant height, ear leaf length and width, and 100-kernel weight of the mature ears are significantly reduced (see G, H). Figure 1 I - M).

[0036] Analysis of starch and protein content in mature wild-type and mutant grains using a starch and prolamin content assay kit revealed no significant difference in starch content between the mutant and wild-type grains (see [link to kit]). Figure 1 D); The content of prolysin, non-prolysin, and total protein in the mutant was not significantly different from that in the wild type (see D); Figure 1 E, F).

[0037] Example 2: Mn5 Gene cloning and functional verification

[0038] Using maize kernel mutants from the US Maize Genetic Cooperative Germplasm Center mn5 , the original materials mn5 The F1 generation was obtained by crossing the heterozygote with the inbred line Zheng 58. The F1 generation was then self-crossed to obtain the F2 population. Through genetic analysis and map-based cloning, the target gene was located in a physical region of approximately 210 kb on chromosome 5 of maize (see...). Figure 2 A).

[0039] The linkage markers and their sequences used in map-based cloning are shown in Table 1. Gene annotation within candidate regions, natural population restriction enzyme digestion verification, and sequencing analysis indicate that... Zm00001d017603 The gene (CDS sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) is a potential candidate gene. mn5 In mutants Zm00001d017603 A single-base mutation from G to C exists 325 bp downstream of the ATG gene, causing the encoded amino acid at position 109 to change from leucine to valine (see...). Figure 2 B).

[0040] Zm00001d017603 The gene preparation method is as follows:

[0041] 1) The endosperm of wild-type and mutant seeds 10 days after pollination was rapidly ground in a mortar using liquid nitrogen. RNA was extracted using a plant polysaccharide and polyphenol RNA extraction kit according to the instructions. Total RNA was thoroughly dissolved in RNase-free ddH2O. Any residual DNA was removed using DNase I.

[0042] 2) RNA quality was assessed using 1.5% agarose gel electrophoresis, and RNA concentration and RNAA were detected using a NanoDrop instrument. 260 / 280 light absorption value, A 260 / 280 The values ​​are between 1.8 and 2.2, indicating good RNA integrity (28S:18S>1.0) and no contamination from protein, guanidine salts, or DNA.

[0043] 3) Using the obtained RNA as a template and oligo(dT) as a reverse transcription primer, the Novozymes HiScript III 1st Strand cDNA Synthesis Kit was used for reverse transcription according to the instructions. The obtained cDNA was aliquoted and stored at -20℃ for later use.

[0044] 4) According to corn B73 Zm00001d017603 Transcript reference sequence, design amplification primers:

[0045] F: 5' ATGCCGCCGCCGCCGCCACCA 3' (SEQ ID No. 3);

[0046] R: 5' CAATCTTATTTCTCGTCGCA 3' (SEQ ID No. 4);

[0047] To validate this candidate gene, it was purchased from the maize EMS mutant library (http: / / elabcaas.cn / memd / ). Zm00001d017603 Premature termination of mutant materials ( mn5-1 ),and mn5 / + Allelic tests were conducted through reciprocal crosses. Phenotypic observation and segregation ratio statistics were performed on the F1 ears obtained from the hybridization. The results showed that the wild-type and mutant kernels in the mature F1 ears conformed to a segregation ratio of 3:1. This indicates... Zm00001d017603 To cause mn5 The functional genes of the mutant phenotype are named Mn5 .

[0048] Mn5 The primers and sequences used for map-based cloning are shown in Table 1:

[0049]

[0050] Example 3: Corn Mn5Molecular markers

[0051] For corn mn5 mutation sites and maize mn5-1 Easily detectable molecular markers dCAPs 1 and dCAPs 2 were developed for the mutation sites, as detailed below:

[0052] mn5 The mutation site is located at position 201,336,012 in the maize B73 reference genome V4 version. The following dCAPs 1 primers were designed:

[0053] dCAPs 1-F1: 5' GATCCCGGCATCCCCAAAA 3'; (SEQ ID No. 35)

[0054] dCAPs 1-R1: 5' CCCATGCGTGCTGCAACTGT 3'; (SEQ ID No. 36)

[0055] dCAPs 1-F2: 5'AACGCCGTCATCAAACTCCT 3'; (SEQ ID No. 37)

[0056] dCAPs 1-R2: 5' GTGGGTGGCGCAGGCGCGCGGCGAGCTCGA 3'; (SEQ ID No. 38)

[0057] Among them, dCAPs 1-F1R1 is the outer primer pair, which can specifically amplify... Mn5 Gene sequence; dCAPs 1-F2R2 was used as the inner primer pair, and the PCR product of dCAPs 1-F1R1 was used as a template for the second round of amplification.

[0058] mn5-1 The mutation site is located at position 201,336,772 in the maize B73 reference genome V4 version. The following dCAPs 2 primers were designed:

[0059] dCAPs 2-F1: 5' AGATGAAGAGGAGAGGCAGC 3'; (SEQ ID No. 39)

[0060] dCAPs 2-R1: 5' ATGTCCTCTGCCCTCTTACG 3'; (SEQ ID No. 40)

[0061] dCAPs 2-F2: 5' CCAAATGTGGTTACCTATACTGTCTGGATC 3'; (SEQ ID No. 41)

[0062] dCAPs 2-R2: 5' TCCCTTGCTCATTGTCTCGA 3'; (SEQ ID No. 42)

[0063] Among them, dCAPs 2-F1R1 is the outer primer pair, which can specifically amplify... mn5-1 Gene sequence; dCAPs 2-F2R2 was used as the inner primer pair, and the PCR product of dCAPs 2-F1R1 was used as a template for the second round of amplification.

[0064] against mn5 and mn5-1 Molecular marker detection of mutants includes the following steps:

[0065] (1) The reaction system is shown in Table 2:

[0066]

[0067] (2) The PCR amplification program for dCAPs 1-F1R1 and dCAPs 2-F1R1 is as follows:

[0068] 1 cycle, 95℃, pre-denaturation for 3 min;

[0069] 35 cycles: 95℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 70 s;

[0070] Delay 72℃ for 5 minutes;

[0071] Soak at 25℃;

[0072] (3) The PCR amplification program for dCAPs 1-F2R2 and dCAPs 2-F2R2 is as follows:

[0073] 1 cycle, 95℃, pre-denaturation for 3 min;

[0074] 35 cycles: 95℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 25 s;

[0075] Delay 72℃ for 5 minutes;

[0076] Soak at 25℃;

[0077] The PCR product of dCAPs 1-F2R2 was obtained using Thermo Fisher's restriction endonuclease. Xho Ⅰ. Enzyme digestion: The PCR product of dCAPs2-F2R2 was digested using Thermo Fisher's restriction endonuclease. BamH I digestion, followed by 70 min electrophoresis on a 10% polyacrylamide gel. The resulting band sizes were 143 bp and 201 bp, respectively (see H I digestion). Figure 2 D).

[0078] Example 4: Mn5 Specificity analysis of mutation sites in natural populations

[0079] To further clarify Zm00001d017603 These are candidate genes related to corn kernel size, based on gene... Zm00001d017603 Point mutations in the coding region G-C (Leu-Val), designing dCAPs 3 markers, and using... Nco I. Restriction endonucleases were used to detect 349 existing accessions from tropical, subtropical, and temperate natural populations (CML423, CML169, GY237, P138, GEMS16, JING24, SHEN137, YE8001, B73 (Su), J4112, CIMBL53, CML454, Zheng58, CIMBL147, CML497, CML114, QI319, 812, CML290, YE107, TY2, CIMBL77, CML192, CIMBL157, SY1039, CML20, CML50, CIMBL142, GEMMS60, GEMS64, CML...). The following lines were identified by enzyme digestion: 287, RY732, ZZ01, LIAO5114, 975-12, ZHENG28, CML360, BY4960, CML171, CIMBL144, CIMBL135, 04K5686, TY10, 238, GY1032, CIMMBL129, D863F, CIMBL6, ZHENG32, W22, etc. Inbred lines containing GC mutations can be identified. Nco I. Restriction endonuclease digestion produces a 135 bp band (see...) Figure 3 A). Statistical analysis was performed based on the inbred lines obtained by enzyme digestion and using phenotypic data from the associated population published by Professor Yan Jianbing's laboratory at Huazhong Agricultural University as a reference (Yang et al. 2014). The results showed that BY4960 and GY1032 were related to... mn5 The mutants exhibited consistent mutational phenotypes, all being small-grain mutants, indicating that the GC mutation is a key SNP site affecting maize kernel size (see [link to article]). Figure 3 B). Sequencing verification confirmed the presence of GC mutations in both BY4960 and GY1032 (see [link]). Figure 3 C). The above results indicate that... Mn5 Mutation sites are potential sites related to corn kernel size.

[0080] Example 5: Corn Mn5 Mutation site enzyme digestion of natural population molecular markers

[0081] against Mn5 Easily detectable molecular markers, dCAPs 3-F2 and dCAPs 3-R2, were developed for the mutation sites. The outer primer pairs are the same as those for dCAPs 1-F1 (SEQ ID No. 35) and dCAPs 1-R1 (SEQ ID No. 36). The specific inner primer pairs are as follows:

[0082] dCAPs 3-F2: 5' CCGTGCACGGTCGACCCCATG 3'; (SEQ ID No. 43)

[0083] dCAPs 3-R2: 5' CTCGAACAGGATGGGGAACG 3'; (SEQ ID No. 44)

[0084] against Mn5 The molecular marker detection procedure for mutation sites in natural populations is as described in Example 3. mn5 and mn5-1 "Molecular marker detection steps for mutants"; PCR products of dCAPs 3-F2R2 were analyzed using Thermo Fisher restriction endonuclease. Nco I. Enzyme digestion: Electrophoresis with 10% polyacrylamide gel for 70 min. If the resulting band is 135 bp, it indicates the inbred line containing the GC mutation (see...). Figure 3 A).

[0085] Example 6: Corn Mn5 Natural variation is significantly correlated with grain size trait.

[0086] Phenotypic data were collected from 507 maize inbred lines, including tropical, subtropical, and temperate materials. Germplasm sources included GME (Germplasm Enhancement of Maize), CIMMYT, and Chinese inbred lines. Phenotypic data on various agronomic traits, lysine content, and SNP information were obtained from the MaizeGo website (http: / / www.maizego.org / Resources.html).

[0087] Using phenotypic data from 360 representative maize inbred lines representing tropical, subtropical, and temperate zones, and performing association analysis on 99 SNP sites within the approximately 3.7-kb region (2-kb upstream to 3'-downstream of the Mn5 gene), association was found to reveal... Mn5 The gene was significantly correlated with 100-grain weight and grain length. The results showed... Mn5 Four SNPs in the gene coding region were significantly correlated with both 100-grain weight (HKW) and grain length (KL) (see [link to gene coding region]). Figure 4 A). Of the four SNPs, only SNP1257 (chr5.s_201335080) causes... Mn5 The change of amino acid at position 419 (see) Figure 4 B). Based on the SNP1257 (chr5.s_201335080) locus, 360 maize inbred lines were divided into two main haplotypes, Mn5. Glu419 and Mn5 Asp419 It contains 321 and 39 inbred lines respectively (see Figure 4 C). Mn5 Glu419 Mn5 Asp419 Significant differences were found in the 100-grain weight (HKW) and grain length (KL) between the two haploid inbred lines, Mn5 Asp419 The 100-grain weight (HKW) and grain length (KL) of haploid inbred lines were significantly increased (see [link]). Figure 4 C). This indicates that Hap2 is the optimal haplotype for grain-related traits, and also demonstrates that SNP1257 is a key locus associated with maize grain size. Meanwhile, Mn5... Asp419 The selection and use of haplotypes in maize breeding appears to be limited, thus this haplotype provides an important genetic target for breeding high-yield maize.

[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

[0089] References:

[0090] Yang, N., Lu, Y., Yang, X., Huang, J., Zhou, Y., Ali, F., ...&Yan, J.(2014). Genome wide association studies using a new nonparametric model reveal the genetic architecture of 17 agronomic traits in an enlargedmaizeassociation panel. PLoS Genetics, 10(9), e1004573.

Claims

1. A gene that regulates maize kernel size, characterized in that, Mn5 It has a single base mutation of G to C at 325bp downstream of ATG of the gene with nucleotide sequence as shown in SEQ ID No.

1. ​ 2. A protein encoded by a gene that modulates maize kernel size Mn5 characterized in that, It has a mutation of leucine to valine at 109th amino acid encoded by the protein with amino acid sequence as shown in SEQ ID No.

2.

3. A kit of molecular markers for detecting genes associated with maize kernel size Mn5 characterized in that, The kit comprises primer sets with nucleotide sequences as shown in SEQ ID No. 35, 36, 37, 38.

4. The kit of claim 3, wherein Also included are restriction enzymes Xho I and / or Nco I.

5. A method of identifying a maize kernel size mutant Mn5 The method of identifying a mutation in a gene, characterized in that, The method comprises the following steps: (1) extracting genomic DNA of the corn material to be tested as a template, and performing PCR amplification by using the kit of claim 3 or 4; (2) performing electrophoresis analysis on the PCR amplification product, and if the obtained amplification product is a DNA fragment of 752bp, then the corn material to be tested is corn with grain length and grain width both significantly smaller than the wild type.

Citation Information

Patent Citations

  • Gene ZmAPC4 for regulating starch content in corn kernels, expression product, SNP (Single Nucleotide Polymorphism) marker, excellent haplotype and application

    CN116621961A

  • Application of ZmA3A1 gene and InDel molecular marker in regulation and control of corn leaf length

    CN118703524A