Faal6 gene related to fruit firmness of strawberry and application thereof

Abstract

The application belongs to the technical field of plant molecular genetic engineering, and particularly relates to a FaAL6 gene related to strawberry fruit hardness and application thereof. The nucleotide sequence of the FaAL6 gene is shown as SEQ ID NO. 1. The application discloses a nucleotide sequence of a FaAL6 gene for regulating strawberry fruit hardness and an amino acid sequence coded by the nucleotide sequence. Experiments show that the FaAL6 gene or a construct or host cell containing the FaAL6 gene can be applied to regulate the hardness of strawberry fruit. The application provides a new gene resource for delaying the softening of strawberry fruit and improving the storage and transportation performance of strawberry fruit.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular genetic engineering, and particularly relates to a FaAL6 gene related to the firmness of strawberry fruits and application thereof. BACKGROUND

[0002] Strawberry is a fruit tree of Rosaceae, and the postharvest softening rate and deterioration rate of the fruit are extremely high, which seriously limits the transportation, shelf life and economic value in strawberry production. The fruit softening of strawberry is mainly due to the degradation of cell wall components, which leads to the destruction of the cell wall structure and the decrease of the firmness. The pectin of the middle lamella and primary cell wall of higher plants is an important component of cell wall integrity and rigidity, which can be depolymerized and dissolved by pectate lyase (PL, EC 4.2.2.2) during fruit ripening, and the adhesion between pectin and cellulose, hemicellulose is destroyed, and the support of the cell wall cannot be maintained. Studies have shown that transcription factors can directly regulate the transcription of PL genes and mediate the fruit softening process. For example, NAC transcription factor FvRIF positively regulates fruit softening by binding to the FvPL2 promoter (Li et al., 2023). FvWRKY48 can bind to the W-box element of the FvPLA promoter to promote the expression of FvPLA, resulting in fruit softening (Zhang et al., 2022). MaWRKY49 in banana accelerates fruit ripening by binding to PL genes (Liu et al., 2023). However, transcription factors that inhibit the transcription of PL genes have not been reported so far.

[0003] Alfin-like is a class of transcription factors containing zinc finger structure, which belongs to the subfamily of PHD protein family of zinc finger protein, and is mainly involved in some physiological and developmental processes of plants, and the response of plants to biotic and abiotic stress. Yan et al. (2022) confirmed that Alfin-like transcription factor VqAL4 recognizes and binds to the CACCTC cis-acting element on the VqNSTS4 promoter, positively regulates the transcription of stilbene synthase synthesis gene, and makes the grapevine of the transgenic strain more resistant to powdery mildew. Wei et al. (2017) only proved that banana MaPHD1 directly binds to the MaXTH6 promoter of cell wall degradation gene MaXTH6 and suppresses the transcription of MaXTH6, but the effect on fruit softening has not been reported and proved. SUMMARY

[0004] In order to solve the problems in the prior art, one of the purposes of the present application is to provide a FaAL6 gene related to the firmness of strawberry fruits, the nucleotide sequence of the FaAL6 gene is shown as SEQ ID NO. 1, and the amino acid sequence encoded by the FaAL6 gene is shown as SEQ ID NO. 2.

[0005] The second object of the present application is to provide an application of the FaAL6 gene in regulating the firmness of strawberry fruits.

[0006] Preferably, the firmness of strawberry fruits is increased by increasing the expression or activity of the FaAL6 gene, or the firmness of strawberry fruits is decreased by inhibiting the expression or activity of the FaAL6 gene.

[0007] Preferably, the expression of the FaAL6 gene is increased by a FaAL6 overexpression vector, which is pCAMBIA1302-FaAL6, and the PCR product of the FaAL6 gene is obtained using strawberry fruit cDNA as a template and is connected to a pCAMBIA1302-GFP vector.

[0008] Preferably, the expression of the FaAL6 gene is inhibited by an RNAi interference vector, which is FaAL6-TRV2, and the PCR product of the FaAL6 gene is obtained using strawberry fruit cDNA as a template and is connected to a TRV2 vector in a VIGS system, and the sequence of the RNAi interference vector is shown as SEQ ID NO. 3.

[0009] The third object of the present application is to provide a construct for increasing the expression amount of the FaAL6 gene in strawberry, which contains the FaAL6 gene as described above.

[0010] The fourth object of the present application is to provide a construct for reducing or eliminating the expression of the FaAL6 gene in strawberry, which contains siRNA that is complementary to the target mRNA of the FaAL6 gene.

[0011] The fourth object of the present application is to provide a host cell containing the construct as described above.

[0012] Preferably, the host cell is Agrobacterium tumefaciens GV3101.

[0013] The present application finally provides an application of the construct or host cell as described above in regulating the firmness of strawberry fruits.

[0014] The present application has the following beneficial effects:

[0015] 1) The present application clones the strawberry transcription factor FaAL6 gene, and by transiently expressing it in strawberry fruits, the cell wall material of the fruits can be increased, and the firmness of strawberry fruits can be improved.

[0016] 2) The application utilizes biochemical and molecular biology and transgenic technology to explore the molecular regulation mechanism of FaAL6 gene in regulating the firmness of strawberry fruits, so as to provide new gene resources for molecular breeding of delaying fruit softening and improving the storage and transportation performance of strawberry fruits. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 It is a PCR gel electrophoresis diagram of FaAL6 gene cloning in embodiment 1 of the application, M: DL2000 marker; 1: PCR amplified fragment of FaAL6.

[0018] Figure 2 It is a plant overexpression plasmid pCAMBIA1302-GFP plasmid map used in embodiment 2 of the application.

[0019] Figure 3 It is a plasmid map of TRV2 of VIGS system used in embodiment 2 of the application.

[0020] Figure 4 It is a fruit phenotype comparison diagram after transient expression of FaAL6 gene in embodiment 3 of the application.

[0021] Figure 5 It is a comparison diagram of expression levels of FaAL6 and FaPL1 in strawberry fruits after transient expression in embodiment 3 of the application.

[0022] Figure 6 It is a comparison diagram of fruit firmness after transient expression in embodiment 3 of the application.

[0023] Figure 7 It is a comparison diagram of pectin lyase enzyme activity in embodiment 3 of the application.

[0024] Figure 8 It is a comparison diagram of pectin content in embodiment 3 of the application. DETAILED DESCRIPTION

[0025] In order to facilitate understanding, the technical solutions of the application will be described in more detail in combination with embodiments:

[0026] Embodiment 1

[0027] Cloning of strawberry transcription factor FaAL6 gene

[0028] The bait vector pFaPL1-pAbAi of the yeast one-hybrid system is constructed by using FaPL1 promoter, and the FaAL6 gene is identified by screening the cDNA library of strawberry fruits at different development stages and comparing the strawberry genome database.

[0029] The full-length primer pair of the gene is designed according to the full-length sequence of FaAL6 gene:

[0030] FaAL6-F: GA AGATCT GATGGAGGGTTTACCGCAGCA

[0031] FaAL6-R: GG ACTAGT AACTCTAGCCCTCTTGCTAC

[0032] wherein the underlined are Bgl II and Spe I restriction sites, respectively.

[0033] The cDNA of "Sweet Charlie" strawberry fruit at the turning stage was used as the template, and TaKaRa LA Taq heat-resistant DNA polymerase was used to perform PCR under the following conditions: 94℃ for 4 min, 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 40 sec for 35 cycles, and 72℃ for 10 min. The PCR product of the full-length FaAL6 gene was obtained. The product was ligated with pMD19-T vector, and the ligation product was introduced into E. coli by heat shock method and spread on LB solid medium containing 50 mg·L-1 ampicillin, and incubated at 37℃ in the dark for 16 h. The monoclonal was placed in the PCR mix, and the positive clone was identified by PCR reaction and sequencing to determine the nucleotide sequence of the FaAL6 gene. -1 The cDNA of "Sweet Charlie" strawberry fruit at the turning stage was used as the template, and TaKaRa LA Taq heat-resistant DNA polymerase was used to perform PCR under the following conditions: 94℃ for 4 min, 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 40 sec for 35 cycles, and 72℃ for 10 min. The PCR product of the full-length FaAL6 gene was obtained. The product was ligated with pMD19-T vector, and the ligation product was introduced into E. coli by heat shock method and spread on LB solid medium containing 50 mg·L-1 ampicillin, and incubated at 37℃ in the dark for 16 h. The monoclonal was placed in the PCR mix, and the positive clone was identified by PCR reaction and sequencing to determine the nucleotide sequence of the FaAL6 gene.

[0034] Figure 1 The PCR gel electrophoresis diagram of the cloned FaAL6 gene is shown in Figure 2. The open reading frame length of the FaAL6 gene sequence is 768 bp, the nucleotide sequence of the FaAL6 gene is shown in SEQ ID NO. 1, and the FaAL6 gene encodes 304 amino acids (including the stop codon), and the encoded amino acid sequence is shown in SEQ ID NO. 2.

[0035] Example 2

[0036] Construction of FaAL6 binary expression vector and RNAi interference vector

[0037] 1) Construction of FaAL6 binary expression vector: the positive monoclonal plasmid DNA of Example 1 and the plasmid DNA carrying pCMABIA1302 vector were subjected to Bgl II and Spe I double digestion, respectively, and after 37℃ reaction for 12 h, agarose gel electrophoresis was performed, and the digested FaAL6 gene full-length and pCMABIA1302 vector fragments were recovered by using a gel recovery kit. The FaAL6 gene was ligated with the digested pCMABIA1302 vector fragments by using T4 ligase. The ligation product was transformed into E. coli by heat shock method and spread on LB solid medium containing 50 mg·L -1LB medium with kanamycin, 37℃ dark culture for 16h. The positive clones were identified by PCR method, and sequencing, obtained the same nucleotide sequence of example 1 monoclonal. The plasmid DNA of the monoclonal was introduced into Agrobacterium GV3101, and the positive monoclonal 1302-FaAL6 was obtained.

[0038] 2) RNAi interference vector construction: FaAL6 gene near the 5' end to avoid the selection of about 240bp fragments, and the primer pair of the fragment is designed:

[0039] FaAL6-TRVF: CG GAATTC TCATGGTTGCTTGCTGTTGC

[0040] FaAL6-TRVR: CG GGATCC TGGTGGCGACATCTTTACCC

[0041] In which the underlined are EcoR I restriction sites and BamH I restriction sites respectively.

[0042] The plasmid DNA of the monoclonal of example 1 was used as a template to amplify the FaAL6 gene fragment by PCR. After purification and recovery of the PCR product, it was connected to pMD19-T vector, and then the ligation product was transformed into E. coli by heat shock method, and the LB medium containing 50mg·L -1 LB medium with ampicillin, 37℃ dark culture for 16h. After detecting the positive clones by PCR method, sequencing analysis was carried out to determine the same sequence of example 1 monoclonal. The plasmid DNA of the monoclonal and the plasmid DNA carrying TRV2 vector were respectively digested by EcoR I and BamH I, and agarose gel electrophoresis was carried out. The 200-300bp fragments and TRV2 vector fragments were recovered by gel recovery kit after enzyme digestion, and the fragments were connected to the double enzyme digested TRV2 vector by T4 ligase. After sequencing, the positive monoclonal with the same sequence as example 1 was obtained, and its plasmid DNA was transformed into Agrobacterium GV3101 to obtain the positive monoclonal FaAL6-TRV2, and the sequence is shown as SEQ ID NO. 3.

[0043] Figure 2 Plasmid map of plant overexpression vector pCAMBIA1302-GFP carrying GFP tag;

[0044] Figure 3 Plasmid map of TRV2 of VIGS system.

[0045] Example 3

[0046] Transient expression of FaAL6 gene in strawberry fruit and the effect of the gene on the hardness of strawberry fruit

[0047] The Agrobacterium tumefaciens carrying 1302-FaAL6, 1302 (control), FaAL6-TRV2 and TRV2 (control) in Example 2 were used to express the vectors in strawberry fruits by injecting the needle into the strawberry green-white stage fruits with a disposable 1 mL syringe.

[0048] In order to reduce the influence of fruits and growth factors on the phenotypic changes of fruits, the left and right sides of the fruits were injected with expression vectors / silencing vectors and empty vectors, respectively.

[0049] When detecting fruit hardness, the hardness of 2-3 different positions of one fruit needs to be determined. In order to facilitate the detection of hardness, the whole fruit injection method is used, that is, the needle is inserted into the fruit through the fruit stalk, and the injection solution is injected. After the fruit is fully matured, the fruit hardness is compared.

[0050] The specific steps are as follows:

[0051] 1) After the single colony of Agrobacterium tumefaciens GV3101 carrying pCMABIA1302-FaAL6, pCMABIA1302 (control), FaAL6-TRV2 and TRV2 (control) was obtained by streaking on LB solid medium (containing 50 mg·L -1 kanamycin and 50 mg·L -1 rifampicin), the single colony was inoculated into 20 mL LB liquid medium containing 50 mg·L -1 kanamycin and 50 mg·L -1 rifampicin, and shaken at 200 rpm at 28°C for 12 h. The OD 600 was about 0.6-0.8;

[0052] 2) The bacterial solution in 1) was transferred to a 50 mL centrifuge tube and centrifuged at 5000 rpm at room temperature for 5 min. The supernatant was discarded and the bacterial colony was collected;

[0053] 3) The bacterial colony was resuspended with the immersion solution (containing MES with a final concentration of 1.0 mol·L -1 , MgCl2 with a final concentration of 1.0 mol·L -1 , and acetyl vanillin with a final concentration of 1.0 mol·L -1 ) to obtain the injection solution;

[0054] 4) Selecting the green-white stage of strawberry fruits without deformity and uniform size, using 1 mL sterile syringe to inject the liquid, for observing the fruit phenotype changes, inserting the needle into the fruit surface 0.5 cm deep, and squeezing 100 μL injection liquid. For measuring the fruit hardness and other indicators, inserting the needle into the fruit 1 cm from the fruit stem, and squeezing 500 μL injection liquid into the fruit. The injected strawberry fruits are set in triplicate, and each replicate has three fruits.

[0055] 5) After 3 days of injection, the fruit samples are taken for real-time quantitative analysis; about 10 days after injection, the strawberry fruit phenotype changes are observed and photographed; after the fruit is completely mature, the fruit hardness is measured by using a texture analyzer. The method for measuring the fruit hardness by using a texture analyzer: the TA39 probe is selected to insert into the fruit 6 mm at a speed of 0.5 mm / s. The insertion position is a certain point on the equator of the fruit and its opposite surface, and the average of the two measured values is the fruit hardness.

[0056] Experimental results:

[0057] Reference Figure 4-8 . Figure 4 The fruit phenotype comparison chart after the transient expression of the FaAL6 gene, in which 1302 indicates that the pCAMBIA1302 empty vector is injected into the strawberry fruit, FaAL6-1302 indicates that the FaAL6-1302 fusion expression vector is injected into the strawberry fruit; TRV2 indicates that the TRV2 and TRV1 empty vectors are injected into the strawberry fruit; and FaAL6-TRV2 indicates that the FaAL6-TRV2 recombinant vector and the TRV1 empty vector are injected into the strawberry fruit. It can be seen that the overexpression of the FaAL6 gene in the fruit inhibits fruit ripening, and the interference of the FaAL6 gene expression promotes fruit ripening.

[0058] Figure 5 The expression level comparison chart of FaAL6 and FaPL1 in the strawberry fruit after the transient expression; in the chart, A is the expression level of the FaAL6 gene in the fruit after injecting the FaAL6-1302 fusion expression vector, B is the expression level of the FaPL1 gene in the fruit after injecting the FaAL6-1302 fusion expression vector, C is the expression level of the FaAL6 gene in the fruit after injecting the FaAL6-TRV2 vector, and D is the expression level of the FaPL1 gene in the fruit after injecting the FaAL6-TRV2 vector. It can be seen that the expression of the FaAL6 gene in the strawberry fruit injected with the FaAL6-1302 fusion expression vector increases, and the expression level of the FaPL1 decreases; the expression of the FaAL6 gene in the strawberry fruit injected with the FaAL6-TRV2 vector decreases, and the expression level of the FaPL1 increases. Increasing the expression of the FaAL6 gene inhibits the transcriptional activity of the FaPL1 gene, and further slows down the fruit softening process. Figure 6Figure 4 is a comparison chart of the hardness of the fruits after transient expression. Compared with the control, the hardness of the strawberry fruits injected with the FaAL6-1302 fusion expression vector was significantly increased, while the hardness of the strawberry fruits injected with the FaAL6-TRV2 vector was significantly decreased, indicating that the expression of the FaAL6 gene is related to the hardness of the strawberry, and increasing the expression of the FaAL6 gene is beneficial to increasing the hardness of the strawberry fruits.

[0059] Figure 7 Figure 5 is a comparison chart of the pectin lyase enzyme activity in the fruits after transient expression. Pectin lyase hydrolyzes pectin in the cell wall components, leading to the destruction of the cell wall structure and accelerating the softening of the fruits. Compared with the control, the pectin lyase enzyme activity of the strawberry fruits injected with the FaAL6-1302 fusion expression vector was significantly decreased, while the pectin lyase enzyme activity of the strawberry fruits injected with the FaAL6-TRV2 vector was increased.

[0060] Figure 8 Figure 6 is a comparison chart of the pectin content in the fruits after transient expression, WSP is water-soluble pectin, CBP is covalent pectin, and ISP is ionic pectin. As can be seen, the WSP was significantly decreased when the FaAL6 was overexpressed, while the ISP content had no obvious change, and the WSP of the strawberry fruits with transiently inhibited FaAL6 gene expression was significantly increased compared with the control, and the CBP content was decreased. Pectin is an important component of the cell wall, and increasing the expression of the FaAL6 gene can increase the pectin content in the strawberry fruits, and thus increase the hardness of the fruits.

[0061] The above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modification, equivalent replacement and improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. Use of FaAL6 increasing the expression of a gene in a strawberry fruit, said FaAL6 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, wherein The expression of the gene was improved by a FaAL6 overexpression vector, the FaAL6 overexpression vector was pCAMBIA1302-FaAL6, the PCR product of the gene was obtained by taking strawberry fruit cDNA as a template, and was connected with a pCAMBIA1302-GFP vector. FaAL6 The expression of the gene was improved by a FaAL6 overexpression vector, the FaAL6 overexpression vector was pCAMBIA1302-FaAL6, the PCR product of the gene was obtained by taking strawberry fruit cDNA as a template, and was connected with a pCAMBIA1302-GFP vector. FaAL6 The expression of the gene was improved by a FaAL6 overexpression vector, the FaAL6 overexpression vector was pCAMBIA 3. Inhibition FaAL6 The application of gene expression in reducing strawberry fruit firmness, by inhibiting the expression of the gene using an RNAi interference vector. FaAL6 Gene expression was achieved using the RNAi interference vector FaAL6-TRV2, with strawberry fruit cDNA as a template. FaAL6 The PCR product of the gene was obtained by ligating it into the TRV2 vector in the VIGS system; FaAL6 FaAL6 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the sequence of the RNAi interference vector is shown in SEQ ID NO.3.

Images