Use of CtGSTU32 gene in promoting accumulation of crocin
By exploring and verifying the function of the CtGSTU32 gene, the accumulation of flavonoids in safflower was regulated using genetic transformation, which solved the problem of insufficient application of GSTs in existing technologies and achieved a significant increase in the content of flavonoids in safflower.
Patent Information
- Application Number
- CN202510198401.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-22
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-02-22
AI Technical Summary
In the existing technology, there are no reports on the application of glutathione S-transferases (GSTs) in promoting the accumulation of safflower flavonoids, which limits the efficient development and utilization of safflower flavonoids.
The role of the CtGSTU32 gene in the accumulation of flavonoids in safflower was explored and verified. The CtGSTU32 gene was introduced into safflower through genetic transformation, and the expression of the gene was regulated by methyl jasmonate (MeJA) to promote the accumulation of flavonoids.
Genetic transformation confirmed that the CtGSTU32 gene is involved in the accumulation of flavonoids in safflower, significantly increasing the content of flavonoids in safflower and providing a basis for more efficient development and utilization of safflower flavonoids.
Smart Images

Figure CN119932092B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of CtGSTU32 gene in promoting accumulation of crocin. BACKGROUND
[0002] Carthamus tinctorius L., also known as red and blue flower and thorny safflower, belongs to the family of Compositae and the genus of Carthamus. As a medicinal plant, safflower has the effects of activating blood circulation, removing blood stasis, relieving pain, and treating amenorrhea, dysmenorrhea, lochia, chest pain, abdominal pain, chest and back pain, sprains, and abscesses.
[0003] Research on bioactive components in safflower has been carried out for a long time. At present, more than 200 compounds such as flavonoids, phenylethanoid glycosides, coumarins, fatty acids, sterols and safflower polysaccharides have been isolated and identified from different parts of safflower. Flavonoids, which are secondary metabolites of safflower and mainly exist in flowers, are representative pharmacologically active substances of safflower and have great economic value. Flavonoids in safflower can relieve cardiovascular and cerebrovascular diseases, protect myocardial cells and brain cells, and play the roles of anti-inflammatory and anticancer. In addition, some flavonoids are also natural dyes and are widely used in food, cosmetics and industrial products. Flavonoids in safflower can be divided into universal and unique types. Universal flavonoids exist in most species and have various activities, and flavones, flavonols and dihydroflavones are representatives, including kaempferol, hyperoside, naringenin, quercetin and luteolin. Unique flavonoids are only found in safflower, have unique structures and important activities of treating cardiovascular and cerebrovascular diseases, and are almost quinone chalcone compounds, such as crocin, safflower yellow A and Hydroxysafflower yellow A (HSYA).
[0004] Mining key genes of flavonoid biosynthetic pathway in safflower helps to analyze the molecular regulation network, deeply understand the synthesis of flavonoids in safflower, realize the regulation of flavonoids in safflower from the gene level, and more efficiently develop and utilize flavonoids in safflower. Glutathione-S-transferases (GSTs) are a class of soluble proteins widely existing in organisms, and Tau class GSTs (GSTU) are specific to plants and play an important role in resisting stress, but the application of GSTU in promoting accumulation of flavonoids in safflower has not been reported. SUMMARY
[0005] In view of the above technical problems, the application provides application of CtGSTU32 gene in promoting accumulation of crocin.
[0006] The application adopts the following technical scheme:
[0007] In a first aspect, the application provides an application of a CtGSTU32 gene in promoting accumulation of crocin in safflower, wherein a nucleotide sequence of the CtGSTU32 gene is shown as SEQ ID NO. 1, and an amino acid sequence of a protein encoded by the CtGSTU32 gene is shown as SEQ ID NO. 2.
[0008] In the application, a multifunctional economic crop safflower is used as a plant material, bioinformatics and molecular biology methods are combined to mine a key gene GST involved in accumulation of crocin in safflower, and a function of the key gene is verified through genetic transformation, and research finds that the CtGSTU32 gene may be regulated by methyl jasmonate (MeJA) and involved in accumulation of crocin in safflower.
[0009] In a second aspect, the application provides a biological material containing the CtGSTU32 gene.
[0010] In some embodiments of the application, the biological material is an expression cassette, a recombinant vector or a recombinant bacterium.
[0011] In some embodiments of the application, the expression vector of the recombinant vector is pCAMBIA1302.
[0012] In some embodiments of the application, the recombinant vector is obtained by inserting the CtGSTU32 gene into a Nco I site and a Spe I site of pCAMBIA1302.
[0013] In some embodiments of the application, the host bacterium of the recombinant bacterium is Agrobacterium tumefaciens GV3101.
[0014] In a third aspect, the application provides an application of the biological material in promoting accumulation of crocin in safflower.
[0015] In a fourth aspect, the application provides a method for promoting accumulation of crocin in safflower, comprising a step of transferring the CtGSTU32 gene into safflower.
[0016] Further, the transferring method comprises pollen tube pathway, Agrobacterium-mediated method, plant virus vector method or direct DNA transformation method.
[0017] Compared with the prior art, the application has the following beneficial effects:
[0018] The application discloses a biological process involved in safflower tubular flower development, a core gene CtGSTU32 is mined through WGCNA, a whole genome analysis on a GST gene family finds that MeJA has a regulation effect on CtGSTU32, and it is proved that CtGSTU32 is involved in safflower flavonoid accumulation through genetic transformation. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 It is a phenotype diagram of different stages of safflower tubular flower development.
[0020] Figure 2 It is a co-expression network diagram of four module core genes, each color network diagram represents a corresponding module, the small ring in the middle represents a core gene, the yellow color represents a transcription factor, and the others represent candidate genes.
[0021] Figure 3 It is a total flavonoid content and CtGSTU32 gene expression amount result diagram of safflower suspension cells treated by MeJA; wherein, Figure 3 A in the figure represents a phenotype diagram of suspension cells treated by CK (without MeJA) and 50 μmol / L MeJA; Figure 3 B in the figure represents a total flavonoid content determination result diagram of suspension cells after safflower cells are treated by CK and MeJA; Figure 3 C in the figure represents a CtGSTU32 gene expression amount detection result diagram of suspension cells after safflower suspension cells are treated by CK and MeJA.
[0022] Figure 4 It is a CtGSTU32 transgenic function verification result diagram; wherein, Figure 4 A in the figure represents a RT-qPCR verification result diagram of wild type (WT) and transgenic (CtGSTU32) plants; Figure 4 B in the figure represents a total flavonoid content determination result diagram of wild type (WT) and transgenic (CtGSTU32) plants. DETAILED DESCRIPTION
[0023] The application will be described in detail below in combination with specific embodiments, but should not be understood as limitation of the application. If not specially stated, the technical means used in the following embodiments are conventional means familiar to those skilled in the art, and the materials, reagents and the like used in the following embodiments can be obtained from commercial channels if not specially stated.
[0024] Experimental materials:
[0025] The safflower variety used in the application is Anhui safflower.
[0026] Example 1: Screening of candidate genes in transcriptome
[0027] The tubular flower samples at five flower bud development stages of safflower, including bud stage I (BS1), bud stage II (BS2), initial bloom stage (IBS), full bloom stage (FBS) and fade stage (FS), were selected for transcriptome sequencing (as shown in Figure 1 The key genes involved in the regulation of flavonoid biosynthesis in safflower were mined by WGCNA method, and the core gene GST screened from the MEblue module was named as CtGSTU32 in the gene family. CtGSTU32 may be regulated by MeJA and involved in the accumulation of flavonoids in safflower, and therefore was used as a candidate gene (as shown in Figure 2
[0028] CtGSTU32 gene sequence (SEQ ID NO. 1):
[0029] ATGAAGGATAAAGTAATCTTATTGGATTGTTGGGCAAGCTCGTATGGAATGAGGGTCAAGATTGCGCTTGCAGAAAAAGGAGTCGAGTACGACTGTCGAGAAGAGAACTTTCAAGAAAAAAGCCCTTTGTTGCTCCAATCAAACCCAATTCATAAAACAATCCCGGTTCTTGTTCACAACGGTAAGCCTATTTGTGAATCCCTCATCATCGTCAGCTATATCGACGAGGTTTGGAACGACAAGTCTCCATTGCTTCCTTCTGATCCTCACCAGAAATCACAAGCCTTGTTTTGGGCTGACTACATCGATAAAAAGGATCAAGAGATAGCAAAGAAAGAACTGATAGAAGTCTTGAAAAACTTGGAGAGGGAGTTAGGCAATAAGCCATATTTTGGGGGTGAAAATATTGGTTTTGTGGATGTAGCACTTGTGCCATTTACTAGTTGGTTCTATACTTATGAAACTCGTGGTCGTTTTAGCATCGAGGCCGAGTGCCCCAATCTTGTGGCATGGACCAAGAGGTGCATCCGTGAGAGAGAAAGTGTAGCGAAAACTCTCCCTCACCCTCATAAAATCTATGACTATGCCTTGAATCTTTTACACAAATAA.
[0030] Amino acid sequence of CtGSTU32 protein (SEQ ID NO. 2):
[0031] MKDKVILLDCWASSYGMRVKIALAEKGVEYDCREENFQEKSPLLLQSNPIHKTIPVLVHNGKPICESLIIVSYIDEVWNDKSPLLPSDPHQKSQALFWADYIDKKDQEIAKKELIEVLKNLERELGNKPYFGGENIGFVDVALVPFTSWFYTYETRGRFSIEAECPNLVAWTKRCIRERESVAKTLPHPHKIYDYALNLLHK.
[0032] Example 2: Effect of methyl jasmonate on flavonoid composition and expression of CtGSTU32 in safflower suspension cells
[0033] 1. Construction of safflower suspension cell line:
[0034] (1) Sterile seed culture
[0035] Select 20 particles full, no damage to the surface of the safflower seeds with tap water to clean dust, room temperature for 6 hours or more (to not show the hypocotyl is appropriate), according to the needs of the water. Seed water sufficient to absorb the surface with a water-absorbing paper dry, placed in a sterile clean bench.
[0036] First with sterile water safflower seeds washed 2-3 times, then with filter paper dry, put into sterilized centrifuge tube. With 75% ethanol sterilization 30 s, sterile water rinse 3-5 times, put on the filter paper to dry the seed surface moisture; again with 0.1% mercuric chloride (HgCl2) disinfection treatment 20 min, sterile water rinse 3-5 times. The seed surface treated with filter paper dry, with a large head down, sharp head up, inoculated into Murashige and Skoog (MS) basic medium (L & M, PhytoTech Laboratories, HGW0519367A). In the dark at 25°C for 3 days, seed hypocotyl elongation into the medium, and then grow cotyledon. Dark culture seedlings removed, in the clean bench to remove the shell, let the seedlings according to the biological form up to the culture medium, into the constant temperature light incubator for light culture (25°C, light intensity 5000lx, light time 16h / d).
[0037] (2) Callus culture
[0038] Select the growth of about a week, well safflower seedlings, with forceps to cut into sterile inoculation tray, cutting stems and cotyledon as callus induction material, stems and cotyledon with a knife wound a little. Stems cut into 0.5 cm long, cotyledon cut into 0.5 cm x 0.5 cm size inoculated on the surface of the induction medium. The above materials were placed in light and dark culture conditions, every 15 days for a subculture.
[0039] (3) Cell suspension culture
[0040] Select the growth state of good, loose structure of callus after three subcultures, with forceps to fully scattered after inoculation into 40 mL liquid medium, inoculation amount of about 0.04 g / mL (wet weight). In 25°C, 100 r·min -1 dark conditions, 7 days after the cell suspension through 100 mesh screen, filter out the larger cell mass, so that the cell suspension size uniform. Then continue to shake culture, with good growth state of suspension cells as the original liquid, every 18 d for a subculture. Each time the subculture to the original liquid added 40 mL of fresh medium, shake well and evenly divided into two parts, continue to shake culture.
[0041] 2. Effect of MeJA on CtGSTU32
[0042] In the analysis of cis-acting elements of Safflower GST gene family, it was found that the upstream cis-acting element region of most GST genes was identified to be rich in methyl jasmonate (MeJA) regulatory elements (TGACG-motif and CGTCA-motif), indicating that MeJA may be involved in the transcriptional regulation of some GST genes. To explore whether MeJA regulates CtGSTU32, 4 μL of MeJA solution with a concentration of 0.5 mol / L was added to 40 mL of safflower cell suspension under sterile conditions, and the cells were co-cultured on a shaker for 7 days. The phenotype changes were observed, the total flavonoid content was determined, and the CtGSTU32 gene expression was verified by RT-qPCR. The EF-1α gene was used as an internal reference, and the primers are as follows:
[0043] Primers for verifying the expression of CtGSTU32 gene by RT-qPCR:
[0044] qRT-CtGSTU32-F (SEQ ID NO. 3): 5'-AAGCCTTGTTTTGGGCTGAC-3'.
[0045] qRT-CtGSTU32-R (SEQ ID NO. 4): 5'-GCCTAACTCCCTCTCCAAGT-3'.
[0046] Primers for verifying the expression of EF-1α gene by RT-qPCR:
[0047] qRT-EF-1α-F (SEQ ID NO. 5): 5'-TCAGCATTGTCGTCATCGGA-3'.
[0048] qRT-EF-1α-R (SEQ ID NO. 6): 5'-ACGTTCGATCACACGCTTGTC-3'.
[0049] RT-qPCR reaction system: 1 μL of cDNA solution (final concentration of 50 ng / μL), 5 μL of 2×Universal Blue SYBR Green qPCR Master Mix, 0.4 μL of upstream and downstream primers (10 μM) each, and 10 μL of nuclease-free water. (Note: all operations were performed on ice water bath)
[0050] RT-qPCR reaction conditions: 95℃ for 30 sec; 95℃ for 15 sec, 58℃ for 10 sec, 72℃ for 30 sec, and the number of cycles was 40.
[0051] The results showed that compared with the control suspension cells (CK) without MeJA, the color of the suspension cells after MeJA treatment deepened, and the total flavonoid content increased significantly, which was presumably due to the increase in total flavonoids induced by MeJA, thereby causing color changes (such as Figure 3 The RT-qPCR results showed that the expression of CtGSTU32 gene in cells treated with MeJA increased significantly, presumably indicating that MeJA had a positive regulatory effect on CtGSTU32 (such as Figure 3 B in FIG. 2).
[0052] Example 3: Effect of overexpression of CtGSTU32 on total flavonoid synthesis in Carthamus tinctorius L.
[0053] (1) Amplification of target gene CtGSTU32
[0054] The CDS sequence of CtGSTU32 was extracted from the genome of Carthamus tinctorius L., and the nucleotide sequence is shown as SEQ ID NO. 1. Specific amplification primers CtGSTU32-F / CtGSTU32-R with enzyme cutting sites and homologous arms were designed. The cDNA of the tubular flower of Carthamus tinctorius L. in the full-bloom stage in Anhui was used as a template, and 2xPhanta Max Master Mix was used for PCR amplification.
[0055] CtGSTU32-F (SEQ ID NO. 7): 5'-acgggggactcttgaccatggATGAAGGATAAAGTAATCTTATTGGATTG-3'.
[0056] CtGSTU32-R (SEQ ID NO. 8): 5'-aagttcttctcctttactagtTTTGTGTAAAAGATTCAAGGCATAG-3'.
[0057] Reaction system: 2xPhanta Max Master Mix, 5 μL; upstream primer, 0.4 μL; downstream primer, 0.4 μL; Carthamus tinctorius L. tubular flower cDNA, 1 μL; nuclease-free water, 3.2 μL.
[0058] PCR amplification system: pre-denaturation, 95°C, 3 min; denaturation, 95°C, 15 s; annealing, 59°C, 15 s; extension, 72°C, 50 s; complete extension, 72°C, 5 min.
[0059] (2) Plasmid digestion and purification
[0060] The overexpression vector pCAMBIA1302 is digested by Nco I / Spe I. The specific enzyme reaction system (50 μL) is as follows: Nco I 1 μL; Spe I 1 μL; pCAMBIA1302 1 μg; 10×K Buffer 5 μL; 0.1% BSA 5 μL; nuclease-free water 29 μL. After mixing, the reaction is carried out at 37°C for 4 h on a PCR instrument.
[0061] After amplification, the target fragment and the linearized vector are subjected to DNA agarose gel electrophoresis, and then the product is purified by using a FastPure Gel DNA Extraction Mini Kit from Novizen Biotech Co., Ltd. The specific steps are described in the kit instruction.
[0062] (3) Transformation of the gene
[0063] The linearized plasmid after digestion and the target fragment are connected by seamless cloning. The reaction system (20 μL) is as follows: 1 μL linearized vector, 2 μL target fragment, 4 μL 5×CE II Buffer, 2 μL Exnase II, 11 μL sterile water. After mixing, the reaction is carried out at 37°C for 30 min on a PCR instrument, and then the reaction product is immediately cooled on ice. The reconnected vector is transformed into E. coli competent cells, and after sequencing verification, the plasmid with correct sequencing is transformed into Agrobacterium GV3101 competent cells for standby.
[0064] (3) Function verification of CtGSTU32 gene
[0065] The overexpression plant is obtained by the pollen tube method. After the T0 generation of safflower seeds is obtained, the T1 generation of transgenic seeds is collected, and the T1 generation of plants is planted. The T1 generation of positive plants is identified by PCR.
[0066] The results show that the expression amount of the CtGSTU32 gene in the transgenic plant is significantly higher than that in the wild type plant (as shown in A of FIG. 1). Finally, the total flavonoid content in the plant leaves is determined, and whether the increase of the expression of the CtGSTU32 gene will affect the accumulation of flavonoids is explored. The results show that the total flavonoid content in the leaves of the transgenic plant is significantly higher than that in the wild type, and it is speculated that the CtGSTU32 gene may participate in the regulation of the accumulation of flavonoids in safflower, thereby leading to the increase of the total flavonoid content (as shown in B of FIG. 1). Figure 4 Figure 4 Although the preferred embodiments of the present application have been described, those skilled in the art can make additional changes and modifications to the embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.
[0067] Although the preferred embodiments of the present application have been described, those skilled in the art can make additional changes and modifications to the embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.
[0068] It will be apparent to those skilled in the art that various modifications and variations can be made to the present application without departing from the spirit or scope of the application. Thus, it is intended that the present application cover modifications and variations of this application provided they come within the scope of the appended claims and their equivalents.
Claims
1. CtGSTU32 The application of genes in promoting the accumulation of safflower flavonoids is characterized by, The CtGSTU32 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. Containing the contents of claim 1 CtGSTU32 A gene recombination vector, characterized in that, The expression vector for the recombinant vector is pCAMBIA1302.
3. The recombinant vector according to claim 2, characterized in that, The recombinant vector is the [material / vector]. CtGSTU32 Gene insertion into pCAMBIA1302 Nco I site and Spe Obtained between I sites.
4. Containing the contents of claim 1 CtGSTU32 Recombinant bacteria of genes, characterized in that, The host bacterium of the recombinant bacteria is Agrobacterium tumefaciens GV3101.
5. The use of the recombinant vector according to any one of claims 2 to 3 or the recombinant bacteria according to claim 4 in promoting the accumulation of safflower flavonoids.
6. A method for promoting the accumulation of safflower flavonoids in safflower, characterized in that, Includes the method described in claim 1 CtGSTU32 The steps involved in transferring genes into safflower.
7. The method for promoting the accumulation of safflower flavonoids in safflower according to claim 6, characterized in that, The method of transfer is pollen tube pathway method, Agrobacterium-mediated method, plant virus vector method or direct DNA transformation method.
Citation Information
Patent Citations
Carthami flos CtACO3 gene as well as coding protein and application thereof
CN109593737A
Carthami flos CtACO1 gene as well as encoding protein thereof and application of encoding protein
CN110042107A