Application of circular RNA CIRC07475 in diagnosis and targeted therapy of MLL fusion gene leukemia

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of circular RNA CIRC07475 in diagnosis and targeted therapy of MLL fusion gene leukemia. A large number of leukemia patient samples are detected through the qRT-PCR technology, it is found that the circular RNA CIRC07475 is remarkably and highly expressed in MLL-R leukemia patients, and the circular RNA CIRC07475 can be used for indicating diagnosis and prognosis of the MLL-R leukemia patients. Meanwhile, in-vivo and in-vitro experiments prove that by knocking down the expression of the CIRC07475, the survival of MLL-R leukemia cells can be remarkably inhibited, and the life cycle of model mice can be remarkably prolonged. Further research finds that knock-down of CIRC07475 can significantly inhibit the efficiency of non-homologous terminal joint NHEJ and cause accumulation of cancer cell DNA damage, so that occurrence and development of MLL-R leukemia are inhibited, and the CIRC07475 has important potential application prospects in treatment of MLL-R leukemia.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of circular RNA CIRC07475 in the diagnosis and targeted treatment of MLL fusion gene leukemia. Background Art

[0002] MLL fusion gene leukemia, also known as MLL (mixed-lineage leukemia) gene rearranged leukemia (MLL-rearranged leukemia, MLL-R leukemia), has a five-year survival rate of less than 30% under existing treatment methods. The treatment of this type of leukemia still faces severe challenges due to its low cure rate, poor prognosis, and easy relapse in the early stage of treatment. Therefore, it has received widespread attention in recent years. Since the five-year survival rate of MLL-R leukemia patients is significantly lower than that of other leukemia patients, many patients have given up the opportunity for treatment. Therefore, it is necessary to adopt new methods to explore the biological characteristics of this type of leukemia and to conduct in-depth research on the pathogenesis of MLL-R leukemia in children, so as to find new early diagnosis and treatment methods to effectively improve the survival rate of MLL-R leukemia patients.

[0003] In recent years, a class of single-stranded non-coding RNA (circular RNA, circRNA) with a closed ring structure has been found to be involved in biological development and the pathogenesis of various cancers. Although the mechanism of action of most circRNAs is still unclear, it has been found that circRNAs can participate in the occurrence and development of cancer through various mechanisms, including interaction with RNA binding proteins, regulation of m6A modification, and translation into proteins. Due to the low conservation of circRNAs in evolution, many molecular targets regulated by circRNAs are highly specific, suggesting that circRNAs have the potential to be good cancer-specific therapeutic targets. At present, research on circRNAs has become a frontier and important field of current life science and molecular medicine research, and has made important progress in tumors such as breast cancer, liver cancer, colon cancer, and lung cancer. At the same time, the important regulatory role of circRNA in leukemia has gradually been discovered. In acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML), circRNA has a specific expression pattern, suggesting that circRNA may have an important regulatory role in different types of leukemia. Therefore, mining therapeutic targets for MLL-R leukemia from circRNA has important theoretical and application significance, and can also provide a positive reference for the application of circRNA in other leukemia cancers. Summary of the invention

[0004] In order to overcome the deficiencies of the above-mentioned prior art, the present invention provides a new circRNA gene that is specifically and highly expressed in MLL-R leukemia, which is named CIRC07475. Further studies have found that knocking down the expression of CIRC07475 can significantly affect the efficiency of non-homologous end joining repair of MLL-R leukemia cells and improve the survival cycle of the disease, suggesting that CIRC07475 is expected to be used to indicate the occurrence and prognosis of MLL-R leukemia, as well as targeted treatment of MLL-R leukemia, which has important application value for the diagnosis and gene targeted treatment of MLL-R leukemia.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] In a first aspect, the present invention provides the use of a reagent for detecting the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO: 1 in the preparation of a product for diagnosing MLL fusion gene leukemia.

[0007] The present invention discovered a lncRNA that is specifically highly expressed in MLL-R leukemia and lowly expressed in other types of leukemia under normal physiological conditions, and named it CIRC07475. The lncRNA can be used to indicate the diagnosis and prognosis of the disease. The gene locus of CIRC07475 is located on the positive DNA strand of human chromosome 17, and its gene covers a range from 30,788,269bp to 30,788,663bp. Through identification, it was found that CIRC07475 belongs to an intronic circular RNA with a length of 394nt, and its nucleotide sequence is shown in SEQ ID:1, and its back-splicing junction site (BSJ) is shown in SEQ ID:2.

[0008] Preferably, the reagent for detecting the expression level of the circular RNA gene CIRC07475 is a primer for detecting the expression amount of CIRC07475, and its sequence is shown in SEQ ID NO:3-4.

[0009] Preferably, the diagnostic product comprises a diagnostic chip or a kit.

[0010] The second aspect of the present invention provides the use of an agent for inhibiting or reducing the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO: 1 in any of the following aspects 1) to 4):

[0011] 1) Preparation of products for the treatment of MLL fusion gene leukemia;

[0012] 2) Preparation of products that inhibit the occurrence and development of MLL fusion gene leukemia

[0013] 3) Preparation of products that inhibit the proliferation of MLL fusion gene leukemia cells;

[0014] 4) Prepare products that promote apoptosis and differentiation of MLL fusion gene leukemia cells.

[0015] Preferably, the inhibition of the occurrence and development of MLL fusion gene leukemia is to inhibit the DNA damage repair ability of MLL fusion gene leukemia cells.

[0016] More preferably, the inhibition of the DNA damage repair ability of MLL fusion gene leukemia cells is to inhibit the efficiency of non-homologous end joining (NHEJ).

[0017] The present invention has been found through research that CIRC07475 is highly expressed in MLL-R leukemia patients, and it has been confirmed that after knocking down CIRC07475 using siRNA technology, the proliferation of MLL-R leukemia cell lines is weakened and apoptosis is increased. Moreover, the NOD-SCID mouse model experiment shows that after knocking down CIRC07475 using shRNA, the corresponding MLL-R leukemia cells have the effect of inhibiting tumor growth. The above results show that in the MLL-R leukemia cell line, after knocking down CIRC07475, the DNA damage of the cells will change significantly, confirming that CIRC07475 has a promoting effect on DNA damage repair. At the same time, the present invention has been found through research that CIRC07475 directly affects the cell's (Non-homologous end joining, NHEJ) process. Further through relevant molecular biology experiments, it has been confirmed that CIRC07475 affects the DNA damage repair of cells by affecting the DNA-PK complex. It can be seen that the present invention regulates circular RNA by genetic engineering means and directly induces the generation of DNA damage by utilizing the expression level of CIRC07475, which has important value for the precise treatment of targeted MLL-R leukemia. At the same time, the present invention also confirms that CIRC07475 has potential clinical practical value in indicating the classification and prognosis of MLL-R leukemia.

[0018] Preferably, the MLL fusion gene leukemia cells include MOLM-13.

[0019] Preferably, the agent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 is siRNA or shRNA that inhibits or reduces the expression of CIRC07475.

[0020] More preferably, the siRNA is selected from one or more of siRNA-1 or siRNA-2, the sequence of the siRNA-1 is shown in SEQ ID NOs: 5-6, and the sequence of the siRNA-2 is shown in SEQ ID NOs: 7-8.

[0021] More preferably, the sequence of the shRNA is as shown in SEQ ID NO:9-10.

[0022] Preferably, the product for treating MLL fusion gene leukemia is a drug for treating MLL fusion gene leukemia.

[0023] A third aspect of the present invention provides a therapeutic drug for MLL fusion gene leukemia, the drug comprising an agent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO:1.

[0024] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0025] More preferably, the excipients are functional pharmaceutical excipients available in the pharmaceutical field, including (but not limited to) surfactants, suspending agents, emulsifiers and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0026] Preferably, the dosage form of the drug includes injection, powder, granule, capsule, tablet.

[0027] Preferably, the administration method of the drug includes injection and oral administration.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] At present, the early diagnosis and treatment of MLL-R leukemia at home and abroad still face severe challenges, and there are no reports on the research of circRNA and NHEJ. The present invention first discovered and confirmed that circRNA CIRC07475 is highly expressed in MLL-R leukemia, which can indicate the diagnosis and prognosis of the disease, and is expected to be used for targeted treatment of MLL fusion gene leukemia. The present invention first detected a large number of leukemia patient samples by qRT-PCR technology, and found that circular RNA CIRC07475 was significantly highly expressed in MLL-R leukemia patients, and lowly expressed in normal physiological conditions and other types of leukemia, which can be used to indicate the diagnosis and prognosis of the disease. At the same time, in vivo and in vitro experiments confirmed that knocking down the expression of CIRC07475 can significantly inhibit the survival of MLL-R leukemia cells and significantly prolong the survival period of model mice. Further research on the biological molecular mechanism of CIRC07475 found that knocking down CIRC07475 can significantly inhibit the efficiency of non-homologous end joining NHEJ, causing the accumulation of DNA damage in cancer cells, thereby inhibiting the occurrence and development of MLL-R leukemia, and has important potential application prospects in the treatment of MLL-R leukemia. Therefore, the present invention can provide a new precision treatment strategy and genetic resources for the diagnosis and prognosis of MLL-R leukemia, as well as targeted treatment of MLL-R leukemia, which has important theoretical significance and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Identification of circular RNA CIRC07475; (A) discrete primers were designed, and qRT-PCR and first-generation sequencing were used to accurately identify the BSJ site of CIRC07475; (B) Rase R experiment was used to identify the stability of CIRC07475; (C) qRT-PCR technology was used to detect the specific high expression of CIRC07475 in MLL-R leukemia samples (**P<0.01; ***P<0.001); (D) Receiver Operating Characteristic Curve (ROC curve) was used to analyze the high and low expression levels of CIRC07475 to distinguish MLL-R leukemia; (E) Log-rank (Mantel-Cox) test was used to analyze that high expression of LAMP5-AS1 had a lower leukemia-free survival rate.

[0031] Figure 2CIRC07475 regulates the cytological function of MLL-R leukemia; (A) qRT-PCR technology was used to detect the knockdown effect of CIRC07475 in the MLL-R leukemia cell line MOLM-13; (B) CCK-8 technology was used to detect that the proliferation level of the MLL-R leukemia cell line was significantly reduced when CIRC07475 was knocked down; (C) Flow cytometry technology was used to detect that the apoptosis level of the MLL-R leukemia cell line was significantly enhanced when CIRC07475 was knocked down; (D) Flow cytometry technology was used to detect that the differentiation level of the MLL-R leukemia cell line was also significantly enhanced when CIRC07475 was knocked down; The figures all use the mean ± standard deviation of three repetitions, and the asterisk indicates that the difference between the two groups compared by t-test is statistically significant (**P<0.01; ***P<0.001).

[0032] Figure 3 This is an animal model of MLL-R leukemia regulated by CIRC07475; (A) Flow cytometry was used to detect the infiltration of leukemia cells. When CIRC07475 was knocked down, the infiltration was significantly reduced; (B) The survival curve was used to calculate the survival period of mice after inoculation with MOLM-13 knockdown of CIRC07475; the mean ± standard deviation of three replicates was used in this figure, and the asterisk indicates that the difference between the two groups was statistically significant by t-test (*, p<0.05, **, p<0.01; ***, p<0.001).

[0033] Figure 4 CIRC07475 regulates DNA damage; (A) Western blot detected that the expression of γH2AX, which indicates DNA damage, increased after CIRC07475 was knocked down in MOLM13 cells by siRNA; (B) Immunofluorescence experiments showed that the γH2AX aggregation points in the three knockdown groups increased significantly without ionizing radiation or after ionizing radiation for 4h and 24h; (C) Immunofluorescence showed that the γH2AX aggregation points in the overexpression group were significantly reduced; The figures show the mean ± standard deviation of three replicates, and the asterisk indicates that the difference between the two groups was statistically significant when compared by t-test (NS, no significant difference).

[0034] Figure 5CIRC07475 regulates non-homologous end joining; (A) tRSA pull down experiment, silver staining and mass spectrometry identification technology were combined to identify proteins bound to CIRC07475; (B) Western blot verified the interaction between CIRC07475 and NHEJ-related proteins; (C) RIP experiment reversely verified the interaction between CIRC07475 and NHEJ-related proteins; (D) Western blot detection showed that the interaction of NHEJ complex was weakened after knocking down CIRC07475; (E) Western blot detection showed that the interaction of NHEJ complex was enhanced after overexpression of CIRC07475. DETAILED DESCRIPTION

[0035] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0036] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified. The primer sequences used are synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.

[0037] Example 1: Identification, expression analysis and clinical value assessment of CIRC07475

[0038] The present invention discovered a lncRNA that is specifically highly expressed in MLL-R leukemia and lowly expressed in other types of leukemia under normal physiological conditions, and named it CIRC07475 ( Figure 1 ). The gene locus of CIRC07475 is located on the positive DNA strand of human chromosome 17, and its gene covers the range from 30,788,269bp to 30,788,663bp. Through identification, it was found that CIRC07475 belongs to an intronic circular RNA with a length of 394nt, and its nucleotide sequence and back-splicing junction site (BSJ) are as follows:

[0039] CIRC07475 gene sequence (394 bp, SEQ ID NO: 1):

[0040] >CIRC07475 17:30788264-30788663

[0041] GTGAGCCGATTGTGCCATTGCATTCCAGCCTGGGCAACAGAATGAGACTTTGTCTCAAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAGAAGGAAACCTTAAAAAAAAATCAGAAAATCTTAGAAGCAAGGAAAGAGCAGGAATGTTCACATAGGAAGTGAGGGAGACCTGGAAGGAGGGGGTTGCTAGCAGACCTGG GCATCTAATGAGAGTGGGTCTAGAGACTGTTAAAATCCAGCCAGTATCACAGGTTTCTCTGGCTTCAGCAGCTCCAAGCCTTCCAGAAGCTTCAGCAGGGACTGACTGGGATAAATAACAAAGTAGTGCCTTCTTTTTTTTTTTTTTTTTTTTTTTTGAGACAGCATCTCACTCTGTTGCCCCGGCTAGAGTACA.

[0042] Trans-splicing site of CIRC07475 (SEQ ID NO: 2):

[0043] TAGAGTACA GTGAGC (The underlined part is the trans-linking of circular RNA).

[0044] In order to further determine the expression specificity of CIRC07475 in MLL-R leukemia, this example recollected a batch of patient bone marrow samples from the First Affiliated Hospital of Sun Yat-sen University for detection and analysis, including 97 MLL wild-type (MLL-wt) leukemia samples and 45 MLL-R leukemia samples. All sample collections were approved by the Ethics Committee of Sun Yat-sen University and informed consent was obtained from the patients. CIRC07475 was specifically detected by extracting RNA and using qRT-PCR technology. The qRT-PCR primers used in this process are as follows:

[0045] qRT-PCR forward primer sequence: 5′CCCCGGCTAGAGTACAGTGAG 3′ (SEQ ID NO: 3);

[0046] qRT-PCR reverse primer sequence: 5'CAGGTCTCCCTCACTTCCTATG 3' (SEQ ID NO: 4).

[0047] First, the accuracy of circular RNA CIRC07475 was determined. Discrete primers (SEQ ID NO: 3-4) were designed and combined with qRT-PCR and first-generation sequencing to accurately identify the BSJ site of CIRC07475 (see Figure 1 A); In addition, the stability of CIRC07475 was identified by Rase R experiment; qRT-PCR technology was used to detect the stability of CIRC07475 under Rase R treatment ( Figure 1 B). ROC curve analysis revealed that CIRC07475 was significantly overexpressed in MLL-R leukemia samples compared with MLL wild-type leukemia samples (p<0.001) ( Figure 1 C). This indicates that CIRC07475 has the potential to distinguish between MLL-R leukemia and MLL-wt leukemia ( Figure 1 D); Log-rank (Mantel-Cox) test analysis showed that high expression of CIRC07475 is a risk factor in leukemia and a potential target for the treatment of leukemia ( Figure 1 E).

[0048] Example 2: Functional identification of CIRC07475 in MLL-R leukemia

[0049] In order to solve the core problem of CIRC07475's involvement in the regulation of MLL-R leukemia, this example intends to further study the function of CIRC07475 on MLL-R leukemia. Therefore, the MLL-R leukemia cell line MOLM13 was selected as the research object. Two different siRNA sequences were designed for CIRC07475 by siRNA interference technology, as shown below:

[0050] Forward sequence of siRNA-1: 5'AGAGUACAGUGAGCCGAU dTdT 3' (SEQ ID NO: 5);

[0051] Reverse sequence of siRNA-1: 3'dTdT AUCGGCUCACUGUACUCU 5' (SEQ ID NO: 6);

[0052] Forward sequence of siRNA-2: 5'AGUACAGUGAGCCGAUGU dTdT 3' (SEQ ID NO: 7);

[0053] Reverse sequence of siRNA-2: 3'dTdT ACAUCGGCUCACUGUACU 5' (SEQ ID NO: 8).

[0054] In MLL-R leukemia cell lines, knockout of CIRC07475 ( Figure 2 A), CCK-8 assay was used to detect cell proliferation. Figure 2 As shown in B, when CIRC07475 was knocked down, cell proliferation decreased significantly. This indicates that CIRC07475 also plays an important role in maintaining the proliferation of MLL-R leukemia. At the same time, CIRC07475 was knocked down by siRNA interference technology, and then flow cytometry was used to detect cell apoptosis and differentiation. The experimental results are shown in Figure 2 As shown in C and 2D, when CIRC07475 was knocked down, the apoptosis rate was significantly increased, and differentiation was also significantly enhanced. Therefore, through cell proliferation, apoptosis and differentiation experiments, we speculated that CIRC07475 has a potential regulatory effect on the occurrence and development of MLL-R leukemia.

[0055] Next, the regulatory effect of CIRC07475 on MLL-R leukemia was further verified at the adult level. Using the above siRNA sequence, the shRNA sequence of CIRC07475 was designed as follows:

[0056] Forward sequence of shRNA: 5′GATCCAGAGTACAGTGAGCCGATTCTTCCTGTCAGAAATCGGCTCACTGTACTCTTTTTTG 3′ (SEQ ID NO: 9);

[0057] Reverse sequence of shRNA: 5'AATTCAAAAAAGAGTACAGTGAGCCGATTTCTGACAGGAAGAATCGGCTCACTGTACTCTG 3' (SEQ ID NO: 10).

[0058] Using the expression vector pGreenPuro from System Biosciences TM shRNA Cloning and Expression Vector Lentivirus expression system was used to construct a stable expression strain of CIRC07475 knockout, and the MOLM13 CIRC07475 knockout cell line was obtained by puromycin screening. Subsequently, the validated stable MOLM13 CIRC07475 cell line was expanded and cultured, and then inoculated into 5-week-old NOD-SCID mice by tail vein injection: 20 mice were respectively divided into 2 groups (sh-NC, sh-CIRC07475), with 10 mice in each group (each mouse was inoculated with 1×10 6Cells were resuspended in 150 μL PBS) and then inoculated for 3 weeks to explore the infiltration ability of CIRC07475 on mouse organs. At the same time, the survival rate of the mice group with knockdown of CIRC07475 was found to be higher than that of the control group ( Figure 3 B). Flow cytometry revealed that knockdown of CIRC07475 significantly reduced the infiltration of cells in peripheral blood, spleen, liver, and bone marrow ( Figure 3 A); In addition, knockdown of CIRC07475 in mice also enhanced the differentiation of MOLM13 cells. This suggests that specifically targeting highly expressed CIRC07475 may be a potential strategy for the treatment of MLL-R leukemia.

[0059] Example 3: CIRC07475 regulates DNA damage

[0060] Both at the cellular level and in vitro mouse experiments have confirmed that CIRC07475 can significantly affect the function of MLL fusion gene leukemia cells. So, how does this circRNA regulate MLL-R leukemia? In order to study this issue, this example used CIRC07475 to pull-down MOLM13 cells, silver-stained them after the western blot experiment, and performed protein spectrum on the specific bands. A number of proteins related to DNA damage repair were found in the mass spectrometry results, suggesting that CIRC07475 has the function of regulating DNA damage. At the same time, it was found that when CIRC07475 was knocked down with siRNA (siRNA-1 and siRNA-2) sequences, confocal microscopy and Western blot revealed that the level of DNA damage in the cells accumulated significantly ( Figure 4 A and B); After overexpression of CIRC07475 sequence with pCDH-CMV-MCS-EF1-Puro (CD510B-1) vector, confocal microscopy revealed that the level of DNA damage in cells was significantly reduced ( Figure 4 C). The above results indicate that CIRC07475 plays an important role in the DNA damage repair process of MLL-R leukemia.

[0061] Example 4: CIRC07475 regulates non-homologous end joining

[0062] To further study the mechanism of CIRC07475 regulating MLL-R leukemia, this example used RNA pull down combined with protein spectrum technology to identify that CIRC07475 can closely bind to NHEJ complex members ( Figure 5A, B and C). Knockdown of CIRC07475 using siRNA (siRNA-1 and siRNA-2) or overexpression of CIRC07475 using pCDH-CMV-MCS-EF1-Puro (CD510B-1) vector significantly affected the binding ability between NHEJ complex members ( Figure 5 D and E). The above results show that CIRC07475 regulates the formation of NHEJ complexes and affects the DNA damage repair process in MLL-R leukemia, thereby maintaining the stability of the disease. These results also show that circular RNA CIRC07475 is an important target in MLL-R leukemia. By targeting CIRC07475, the DNA damage repair ability of MLL-R leukemia cells can be significantly inhibited, thereby inhibiting its occurrence and development, and has important application value in the treatment of MLL-R leukemia.

[0063] In summary, the present invention has discovered and confirmed for the first time that circRNA CIRC07475 is highly expressed in MLL-R leukemia, and can be used to indicate the diagnosis and prognosis of the disease. At the same time, it is confirmed that knocking down the expression of CIRC07475 can significantly affect the efficiency of non-homologous end joining repair of MLL-R leukemia cells and increase the survival cycle of the disease. In addition, the present invention also illustrates that CIRC07475 can regulate the non-homologous end joining repair process of cells, and knocking down CIRC07475 can significantly inhibit the efficiency of non-homologous end joining NHEJ, causing the accumulation of DNA damage in cancer cells, thereby inhibiting the occurrence and development of MLL-R leukemia. The above findings can provide a new theoretical basis for the development of drug targets for MLL-R leukemia.

[0064] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO: 1 in the preparation of a product for diagnosing MLL fusion gene leukemia.

2. The use according to claim 1, characterized in that: The reagent for detecting the expression level of the circular RNA gene CIRC07475 is a primer for detecting the expression amount of CIRC07475, and its sequence is shown in SEQ ID NO:3-4.

3. Use of an agent for inhibiting or reducing the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO: 1 in any of the following aspects 1) to 4): 1) Preparation of products for the treatment of MLL fusion gene leukemia; 2) Preparation of products that inhibit the occurrence and development of MLL fusion gene leukemia 3) Preparation of products that inhibit the proliferation of MLL fusion gene leukemia cells; 4) Prepare products that promote apoptosis and differentiation of MLL fusion gene leukemia cells.

4. The use according to claim 3, characterized in that: The method of inhibiting the occurrence and development of MLL fusion gene leukemia is to inhibit the DNA damage repair ability of MLL fusion gene leukemia cells.

5. The use according to claim 4, characterized in that: The method of inhibiting the DNA damage repair ability of MLL fusion gene leukemia cells is to inhibit the efficiency of non-homologous end joining (NHEJ).

6. The use according to claim 3, characterized in that: The MLL fusion gene leukemia cells include MOLM-13.

7. The use according to claim 3, characterized in that: The agent for inhibiting or reducing the expression level of the circular RNA gene CIRC07475 is siRNA or shRNA that inhibits or reduces the expression of CIRC07475.

8. The use according to claim 7, characterized in that: The siRNA is selected from one or more of siRNA-1 and siRNA-2, the sequence of siRNA-1 is shown in SEQ ID NOs: 5-6, and the sequence of siRNA-2 is shown in SEQ ID NOs: 7-8.

9. The use according to claim 7, characterized in that: The sequence of the shRNA is shown in SEQ ID NO:9-10.

10. A therapeutic drug for MLL fusion gene leukemia, characterized in that: The drug includes an agent that inhibits or reduces the expression level of the circular RNA gene CIRC07475 as shown in SEQ ID NO:1.

Images