SNP molecular marker for identifying cucumber yellow flesh trait and application thereof
By designing SNP molecular markers closely linked to the yellow flesh trait of cucumber, and using PCR amplification and sequencing technology to identify the yellow flesh trait of cucumber, the problem of low breeding efficiency in existing cucumber technologies has been solved, and a highly efficient breeding process has been achieved.
Patent Information
- Application Number
- CN202510237197.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-01
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2045-03-01
AI Technical Summary
The lack of effective molecular markers in existing technologies for identifying the yellow flesh trait in cucumbers leads to low breeding efficiency and long breeding cycles.
A SNP molecular marker closely linked to the yellow flesh trait of cucumber is provided. Specific primers are designed to amplify and sequence SNP-yf-F and SNP-yf-R by PCR, and the cucumber genomic DNA is detected to determine the yellow flesh trait.
It improved the identification efficiency and breeding accuracy of yellow-fleshed cucumber materials, shortened the breeding cycle, and increased the efficiency of cucumber breeding.
Smart Images

Figure BDA0005293045730000081
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology-assisted breeding technology, and in particular to SNP molecular markers for identifying the yellow flesh trait of cucumbers and their applications. Background Technology
[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop worldwide, widely used in fresh food, food processing, and cooking. With the improvement of people's living standards, there are higher requirements for food quality, especially functional foods, which are increasingly favored by consumers. Therefore, quality breeding has become one of the important goals of cucumber breeding. Most cucumbers have white endocarps and mesocarps (Che and Zhang, 2019); however, the carotene content in the white flesh is often negligible. Studies have shown that the accumulation of carotene (Bo et al., 2012) can cause cucumber flesh to turn yellow (Kooistra, 1971; Lu et al., 2015) or orange (Simon and Navazio, 1997). Carotene has important nutritional value for the human body; it cannot be synthesized by the body and must be obtained through diet. β-carotene is an important precursor to vitamin A (Nisar et al., 2015). Vitamin A deficiency can lead to dry eye syndrome, increase infant morbidity and mortality, and reduce immune response (Underwood, 2004). Therefore, studying the genetic patterns and molecular markers of yellow cucumber flesh and increasing the carotene content in cucumber flesh through breeding is of great significance.
[0003] Regarding the genetic patterns of yellow flesh in cucumbers, Kooistra et al. (1971) first conducted a genetic analysis of the genes responsible for cucumber flesh color (orange, yellow, grayish-white, bright white), concluding that flesh color is controlled by two pairs of genes. Qi et al. (1983) first described the Xishuangbanna cucumber (Cucumis sativus L. var. xishuangbannanesis Qi et Yuan), whose mature fruit has orange flesh. This conforms to the quantitative trait inheritance pattern of major genes, with lighter colors being dominant over darker colors (Shen Di, 2009). Cuevas et al. (2010) conducted a genetic analysis of the Xishuangbanna cucumber, concluding that the orange inner pericarp is controlled by two recessive genes, while the orange inner pericarp is controlled by one recessive gene. Furthermore, PI200815 has been described as having yellow flesh (Kooistra, 1971). Lu et al. (2015) found that yellow flesh is controlled by a recessive gene (yf) and located it on chromosome 7 (LuHW, Miao H, Tian GL, Wehner TC, Gu XF, Zhang SP (2015) Molecular mapping and candidate gene analysis for yellow fruit flesh in cucumber. Molecular Breeding 35(2):64. doi:10.1007 / s11032-015-0263-z).
[0004] Currently, there are some reports on molecular-level research on yellow cucumber flesh. Song Hui et al. (2009) performed QTL mapping on the flesh color, main carotenoid content, and lutein traits of a population, detecting three QTLs controlling β-carotene content in the endocarp and mesocarp. In the same year, Shen Di also performed QTL mapping using β-carotene content in Xishuangbanna cucumber as a morphological indicator, detecting eight QTLs. Bo et al. (2012) found that the orange color of Xishuangbanna cucumber flesh is due to high levels of β-carotene accumulation and located the orange gene on chromosome 3, naming it ore. Qi et al. (2013) found through GWAS analysis that CsaBCH1 can control the accumulation of β-carotene in mature fruit in Xishuangbanna cucumber, thus leading to orange flesh. Kishor et al. (2021) found through genetic mapping and whole-genome sequencing that CsOr can also lead to an increase in β-carotene content in orange flesh. Wang et al. (2023) discovered a yellow-fleshed mutant in European greenhouse cucumbers and found that abscisic acid 8'-hydroxylase Csyf2 regulates yellow flesh by modulating carotene synthesis. Summary of the Invention
[0005] The purpose of this invention is to address the above-mentioned problems by providing an SNP molecular marker for detecting the yellow flesh trait of cucumbers and its application.
[0006] To achieve its objective, the present invention employs the following technical solution:
[0007] The first aspect of the present invention provides an SNP molecular marker linked to the yf gene for identifying the yellow flesh trait of cucumber. The SNP molecular marker is located at physical position 16,433,384 bp on chromosome 7 of the '9930' cucumber reference genome version V2. The base at this site is either A or G. Cucumber material with a base of A at this site is yellow-fleshed cucumber, and cucumber material with a base of G at this site is white-fleshed cucumber.
[0008] A second aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular markers, comprising a specific primer pair, said specific primer pair including primers SNP-yf-F and SNP-yf-R, the nucleic acid sequences of said primers being as follows:
[0009] SNP-yf-F: 5'-TGACGCTTGCTTAATGAGAT-3',
[0010] SNP-yf-R: 5'-TATCAAAGTTGGGAATGTCG-3'.
[0011] Preferably, the kit further comprises cucumber genomic DNA extraction reagent, PCR amplification reaction reagent, and PCR amplification product sequencing reagent.
[0012] The third aspect of the present invention provides the application of the SNP molecular marker linked to the yf gene for identifying the yellow flesh trait of cucumber in any of the following (1)-(4):
[0013] (1) Identification or auxiliary identification of yellow-fleshed cucumber materials;
[0014] (2) Identify or assist in the identification of the yf gene, the gene for yellow flesh in cucumber;
[0015] (3) Screening or assisting in the screening of yellow-fleshed cucumber varieties;
[0016] (4) Cultivate or assist in the cultivation of yellow-fleshed cucumber varieties.
[0017] In the above applications, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the base at position 305 is A or G. Cucumber material with base A at this position is yellow-fleshed cucumber, and cucumber material with base G at this position is white-fleshed cucumber.
[0018] The above application includes the following steps: extracting genomic DNA from the sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, sequencing the PCR amplification product, and determining whether the sample to be tested has yellow pulp based on the sequencing results.
[0019] For the above applications, the amplification primers for the SNP molecular marker are as follows:
[0020] SNP-yf-F: 5'-TGACGCTTGCTTAATGAGAT-3',
[0021] SNP-yf-R: 5'-TATCAAAGTTGGGAATGTCG-3'.
[0022] In the above application, PCR amplification yielded a 408bp fragment. Cucumber material with base A at position 305 was a yellow-fleshed cucumber, while cucumber material with base G at position 305 was a white-fleshed cucumber.
[0023] For the above applications, the PCR amplification reaction system is as follows: total reaction volume 20 μL, 5.0 ng·μL -1 2 μL template DNA, 50 ng·μL -1 1 μL each of the forward and reverse primers, 10 μL of 2×Phanta Max Master Mix, and 6 μL of double-distilled water.
[0024] In the above application, the PCR amplification reaction procedure is as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes.
[0025] The beneficial effects of this invention are:
[0026] Prior to this application, no SNP markers located on chromosome 7 for identifying yellow-fleshed cucumbers had been reported. This invention provides a novel molecular marker for identifying yellow-fleshed cucumbers, and this SNP marker is closely linked to the yf gene. Using the SNP marker obtained by this invention, it is possible to determine whether cucumber candidate materials exhibit yellow-fleshed characteristics through molecular identification at any stage. The detection of this marker has the advantages of high efficiency and few limitations, improving the efficiency of breeding yellow-fleshed cucumber materials and significantly shortening the breeding cycle. Combining the SNP marker of this application with previously reported molecular markers for identifying yellow-fleshed cucumbers can improve identification accuracy and accelerate the breeding process. Detailed Implementation
[0027] The present invention will be further described in detail below with reference to specific embodiments, but this does not limit the scope of the invention. Unless otherwise specified, the operations used in the following embodiments are conventional methods, and the reagents used are commercially available.
[0028] Materials and Methods
[0029] The experimental materials used in this study were PI200815 (yellow flesh), 931 (white flesh), and 38 core germplasm materials preserved by this project. All of these materials are preserved in our laboratory and will be released to the public for verification experiments within twenty years from the date of application.
[0030] PI200815 is an Indian-type cucumber with smooth, unribbed fruit, sparse white spines, and yellow flesh. It is a known variety, described in Kooistra's 1971 research paper "Inheritance offlesh and skin colors in powdery mildew resistant cucumbers" published in *Euphytica*, issue 20, pp. 521-523. This laboratory holds a copy and guarantees its release to the public for verification experiments within twenty years from the date of application.
[0031] 931 is a North China dense-spined cucumber variety. The fruit is ribbed, slightly striped, with dense white spines and white flesh. It is a homozygous Xintai dense-spined selection line, originating from our institute's cucumber research group. It is a known variety and is also described in the article "Excellent Variety for Protected Cultivation—A Brief Introduction to Xintai Dense-Spined Cucumber" published by Zhang Fengming et al. in the 7th issue of *Northern Horticulture* in 1989. Our laboratory has a copy and guarantees to distribute it to the public for verification experiments within twenty years from the date of application.
[0032] The SNP-yf marker primers were designed in our laboratory using Primer 5.0 software based on resequencing genomic information and synthesized at Beijing Sangon Biotech Co., Ltd. For details of the resequencing genomic information, please refer to the paper "Agenomic variation map provides insights into the genetic basis of cucumber domestication and diversity" published by Qi et al. in Nature Genetics in 2013.
[0033] Main reagents
[0034] PCR experiments were performed using 2×Phanta Max Master Mix from Vazyme; sequencing was performed at Beijing Sangon Biotech Co., Ltd.
[0035] In our previous study, we used one SSR marker, five Indel markers, and two SNP markers to locate the cucumber yellow flesh gene yf on chromosome 7 between markers yfSNP1 and yfSNP2, a physical distance of 101.81 kb. Based on these results, we conducted this study. Combining cucumber genome sequence data and resequencing data from both parents, we analyzed and located the SNPs within this region. Using bioinformatics combined with phenotypic identification of the F2 genetic population from the PI200815×931 hybrid, we identified two possible SNP markers closely linked to the cucumber yellow flesh gene yf: SNP16433384 A / G and SNP16411700 C / T.
[0036] Example 1. SNP marker linked to the yellow flesh gene in cucumber: SNP16433384 A / G
[0037] I. Obtaining the SNP16433384 A / G Mark
[0038] By combining cucumber genome sequence data and resequencing data from both parents, and using bioinformatics combined with phenotypic identification of the genetic population, SNPs in this region were analyzed and located. The SNP marker at nucleotide 16,433,384 on chromosome 7 of cucumber '9930' reference genome version V2 was found: SNP16433384 A / G. It was found that the base at this site was A in the yellow-fleshed parent material PI200815 (P1) and G in the white-fleshed parent material 931 (P2).
[0039] II. Detection of SNP16433384 A / G marker
[0040] Based on the obtained SNP marker SNP16433384 A / G of the yellow flesh gene in cucumber, the DNA sequence of the above-mentioned segment of chromosome 7 of the reference genome of the Chinese Long cucumber inbred line '9930' (V2 version) was downloaded from the cucumber genome database website (http: / / cucurbitgenomics.org / ), and primers were designed using the primer design software Primer Premier 5.0.
[0041] The designed primer sequences are shown below:
[0042] Forward primer: SNP-yf-F (SEQ ID NO.1): 5'-TGACGCTTGCTTAATGAGAT-3', Reverse primer: SNP-yf-R (SEQ ID NO.2): 5'-TATCAAAGTTGGGAATGTCG-3'.
[0043] DNA was extracted from leaves of the yellow-fleshed inbred line 'PI200815' and the white-fleshed inbred line '931'. PCR amplification of SNP-yf-F / SNP-yf-R was performed using primers, and the amplified products were then sequenced. The PCR reaction system was: 20 μL total reaction volume, 2 μL DNA (5.0 ng / μL). -1 Forward and reverse primers (50 ng / μL) -1 1 μL each of the following: 10 μL of 2x Phanta Max Master Mix (Vazyme), and 6 μL of double-distilled water. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, and storage at 4℃. Sequencing of the amplified products was performed at Beijing Sangon Biotech Co., Ltd. The obtained sequences were compared with the 9930(V2) genome sequence to identify the mutations at the corresponding SNP sites.
[0044] A 408bp band was obtained from the yellow-fleshed inbred line 'PI200815', the nucleotide sequence of which is shown in SEQ ID NO.3. The 305th base of the sequence shown in SEQ ID NO.3 is A.
[0045] The white-fleshed inbred line '931' also yielded a 408bp band, the nucleotide sequence of which is shown in SEQ ID NO.4. The 305th base of the sequence shown in SEQ ID NO.4 is G.
[0046] The sequence of SEQ ID NO.3 is as follows:
[0047] TGACGCTTGCTTAATGAGATTTCGTTGTTTACTATACGTGAAGGGGTATTTTGATTTAA
[0048] ACATTGTATAATTGTTAAAATATATATATTAAAAATGGTTTTGTCTTGGCACATAAGATC
[0049] TCCAAATGTCTACAAGTTCATAGACTTTTGGAATGGGTTACCAATATCAAACAAAATT
[0050] GGTGAATTGAGTAGTTTTTAATGGATGTGGATCAAATAAAGAAAGTGTTAGTGTGTG
[0051] TTGGACAATTATAATTATAAAAATGGCAAATTAATAGATATTTGAGTTTTCTTAAGCAA
[0052] AGGGTAGTTAG A TCATTTTCTCCATGGTAAGTGGCTACAAACTGACCAATGCCAAAG
[0053] GCTTAACCAAAAGGCGACCAATGGTAATGGAAGCTTTTCGACATTCCCAACTTTGAT
[0054] A。
[0055] The sequence of SEQ ID NO.4 is as follows:
[0056] TGACGCTTGCTTAATGAGATTTCGTTGTTTACTATACGTGAAGGGGTATTTTGATTTAA
[0057] ACATTGTATAATTGTTAAAATATATATATTAAAAATGGTTTTGTCTTGGCACATAAGATC
[0058] TCCAAATGTCTACAAGTTCATAGACTTTTGGAATGGGTTACCAATATCAAACAAAATT
[0059] GGTGAATTGAGTAGTTTTTAATGGATGTGGATCAAATAAAGAAAGTGTTAGTGTGTG
[0060] TTGGACAATTATAATTATAAAAATGGCAAATTAATAGATATTTGAGTTTTCTTAAGCAA
[0061] AGGGTAGTTAG G TCATTTTCTCCATGGTAAGTGGCTACAAACTGACCAATGCCAAAG
[0062] GCTTAACCAAAAGGCGACCAATGGTAATGGAAGCTTTTCGACATTCCCAACTTTGAT
[0063] A。
[0064] II. Verification of SNP16433384 A / G
[0065] Using 38 core cucumber germplasm materials preserved in this study, the previously obtained marker SNP16433384 A / G linked to the yf gene was validated to determine the accuracy of this marker for molecular marker-assisted selection.
[0066] Cucumber materials were planted in the field, with three biological replicates per material and five plants per replicate. Thirty days after flowering, the flesh color of fruits at the same nodes on each plant was visually inspected. DNA was extracted from individual plant leaves and PCR amplified using the aforementioned primers for SNP-yf-F / SNP-yf-R. Sequencing of the PCR products yielded 408 bp bands in all samples, confirming the 305th base of the PCR sequence. The results are shown in Table 1.
[0067] Compared with the phenotype of flesh color in the selected materials, the genotypes of the markers in the 38 core germplasm materials were basically consistent with the phenotypes of flesh color, with an accuracy rate of 94.74%, indicating that SNP16433384 A / G can be applied to the molecular identification of cucumber flesh color.
[0068] Table 1. Field phenotypic and gene detection results of cucumber flesh color.
[0069] Cucumber material number genotype Pulp phenotype Cucumber material number genotype Pulp phenotype CG4 G white CG40 G white CG6 G white CG43 G white CG8 G white CG45 G white CG9 G white CG47 G white CG10 G white CG50 A white CG11 G white CG55 A white CG12 G white CG59 G white CG13 G white CG20 A yellow CG14 G white CG66 A yellow CG15 G white CG70 A yellow CG16 G white CG71 A yellow CG28 G white CG72 A yellow CG29 G white CG77 A yellow CG30 G white CG78 A yellow CG31 G white CG81 A yellow CG32 G white CG82 A yellow CG35 G white CG83 A yellow CG36 G white CG84 A yellow CG37 G white CG85 A yellow
[0070] Example 2. SNP labeling SNP16411700 C / T
[0071] I. Detection of SNP16411700 C / T Marking in Parental Materials
[0072] This embodiment further investigated and confirmed the SNP marker SNP16411700C / T, which is closely linked to the possible yellow flesh gene of cucumber. SNP16411700C / T is located at nucleotide 16,411,700 on chromosome 7 of cucumber '9930' reference genome version V2, and the base at this site is C or T.
[0073] Based on the obtained SNP marker SNP16411700 C / T of the cucumber yellow flesh gene, the DNA sequence of the above-mentioned segment of chromosome 7 of cucumber '9930' reference genome V2 version was downloaded from the cucumber genome database website (http: / / cucurbitgenomics.org / ), and primers were designed using primer design software Primer Premier 5.0.
[0074] The designed primer sequences are shown below:
[0075] Forward primer SNP-2yf-F (SEQ ID NO.5): 5'-ACTCCCATCAGCATGTTAGC-3', reverse primer SNP-2yf-R (SEQ ID NO.6): 5'-TCATTCAGTTTGGTCACCC-3'.
[0076] DNA was extracted from leaves of the yellow-fleshed inbred line 'PI200815' and the white-fleshed inbred line '931'. PCR amplification of SNP-2yf-F / SNP-2yf-R was performed using primers, and the amplified products were then sequenced. The PCR reaction system was: 20 μL total reaction volume, 2 μL DNA (5.0 ng / μL). -1 Forward and reverse primers (50 ng / μL) -1 1 μL each of the following: 10 μL of 2x Phanta Max Master Mix (Vazyme), and 6 μL of double-distilled water. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, and storage at 4℃. Sequencing of the amplified products was performed at Beijing Sangon Biotech Co., Ltd.
[0077] A 515bp band was obtained from the white pulp inbred line '931', and its nucleotide sequence is shown in SEQ ID NO.7. The 342nd base of the sequence shown in SEQ ID NO.7 is T.
[0078] A 515bp band was obtained from the yellow-fleshed inbred line 'PI200815', the nucleotide sequence of which is shown in SEQ ID NO.8. The 342nd base of the sequence shown in SEQ ID NO.8 is C.
[0079] The sequence of SEQ ID NO.7 is as follows:
[0080] ACTCCCATCAGCATGTTAGCGACTTCGAGATTGTGATTAGTTGAGCTATGCTTGTCGT
[0081] CTATAATTATTGCTATGTGCTCTTTAAAAAAAATACCCCACCTCACTATCGTCTTCTCC
[0082] GTCACCCATTGCTCCGTAATCATCCACGTTGAATATCTCCGGTGATGCCAAAGGCGAT
[0083] GACGCCATCTTCTCCAACCTCGTCCTCAACATGCTGGAGAATTCAGAGGAGTATTTAT
[0084] AATGTTGACCATCAACTTCTTTATCACCGCTGCTAATTGACGGTAGAGGATTATCAAC
[0085] ATCAGGATACGAGCCGGAGCATGTCGAGAGAATGTCAAAGATGACAACGA T GACGA
[0086] AGAGAAACGTAAGAAGGGAAAGGCAACAAGGACGGCCGAGTAATGGACGACACAT
[0087] ATTGGAATGATATTGTGTGGAGTTTTTAAAAGAGGGAATGGAGTTTGAGGGGGGGG
[0088] AAGGGGAAGAAAAGTAGGGAAAGTTTTGATGGAATAGTGGGTGACCAAACTGAAT
[0089] GA。
[0090] The sequence of SEQ ID NO.8 is as follows:
[0091] ACTCCCATCAGCATGTTAGCGACTTCGAGATTGTGATTAGTTGAGCTATGCTTGTCGT
[0092] CTATAATTATTGCTATGTGCTCTTTAAAAAAAATACCCCACCTCACTATCGTCTTCTCC
[0093] GTCACCCATTGCTCCGTAATCATCCACGTTGAATATCTCCGGTGATGCCAAAGGCGAT
[0094] GACGCCATCTTCTCCAACCTCGTCCTCAACATGCTGGAGAATTCAGAGGAGTATTTAT
[0095] AATGTTGACCATCAACTTCTTTATCACCGCTGCTAATTGACGGTAGAGGATTATCAAC
[0096] ATCAGGATACGAGCCGGAGCATGTCGAGAGAATGTCAAAGATGACAACGA C GACGA
[0097] AGAGAAACGTAAGAAGGGAAAGGCAACAAGGACGGCCGAGTAATGGACGACACAT
[0098] ATTGGAATGATATTGTGTGGAGTTTTTAAAAGAGGGAATGGAGTTTGAGGGGGGGG
[0099] AAGGGGAAGAAAAGTAGGGAAAGTTTTGATGGAATAGTGGGTGACCAAACTGAAT
[0100] GA.
[0101] II. Validation of the SNP16411700 C / T marker in cucumber core germplasm materials
[0102] Using 38 core cucumber germplasm materials preserved in this project, the previously obtained marker SNP16411700 C / T was validated to determine the accuracy of this marker for molecular marker-assisted selection.
[0103] Cucumber materials were planted in the field, with three biological replicates per material and five plants per replicate. Thirty days after fruit flowering, the flesh color of fruits at the same nodes on each plant was visually inspected. DNA was extracted from individual plant leaves and PCR amplified using the aforementioned primers for SNP-2yf-F / SNP-2yf-R. Sequencing of the PCR products yielded 515 bp bands in all samples, confirming the PCR amplification at position 342. The results are shown in Table 2.
[0104] Table 2
[0105]
[0106] Compared with the phenotypes for flesh color identification of the selected cucumber materials, the concordance rate between the SNP16411700C / T marker genotype and flesh color identification in the 38 core germplasm materials was only 34.21%, and the concordance rate at this locus in the 26 materials with white flesh was only 3.85%. This indicates that the SNP16411700C / T marker is not suitable as a molecular marker for identifying yellow flesh color in cucumbers, and the difference at this locus cannot indicate flesh color.
Claims
1. Used to identify the yellow flesh trait of cucumbers and yf Application of gene-linked SNP molecular markers in any of the following (1)-(3): (1) Identification of yellow-fleshed cucumber materials; (2) Screening cucumber varieties with yellow flesh; (3) Cultivate cucumber varieties with yellow flesh; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 305th base is A or G.
2. The application according to claim 1, characterized in that, The application includes the following steps: extracting genomic DNA from the sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, sequencing the PCR amplification product, and determining whether the sample to be tested has yellow pulp based on the sequencing results.
3. The application according to claim 2, characterized in that: The amplification primers for the SNP molecular marker are as follows: SNP-yf -F:5'- TGACGCTTGCTTAATGAGAT -3', SNP-yf -R:5'- TATCAAAGTTGGGAATGTCG -3'.
4. The application according to claim 3, characterized in that: The PCR amplification reaction system was as follows: total reaction volume 20 μL, 5.0 ng / μL -1 2 μL of template DNA, 50 ng / μL -1 1 μL each of the forward and reverse primers, 10 μL of 2 × Phanta Max Master Mix, and 6 μL of double-distilled water.
5. The application according to claim 4, characterized in that: The PCR amplification reaction procedure was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes.