Exosome microneedle loaded with cytokines as well as preparation method and application of exosome microneedle

Abstract

The invention discloses an exosome microneedle loaded with cytokines as well as a preparation method and application of the exosome microneedle. The needle tip of the exosome microneedle contains exosome loaded with cell factors. The preparation method of the exosome comprises the following steps: constructing a bone marrow mesenchymal stem cell line of overexpression cell factors, and extracting the exosome enriched with the cell factors from culture supernate. The exosome microneedle can be used for preparing drugs or preparations for treating and / or preventing skin diseases. The exosome microneedle loaded with the cytokines combines convenient and painless treatment and good transdermal property of the microneedle and promotion and slow release effects of the cytokines in the modified exosome, is especially suitable for treatment of skin-related diseases, and achieves a safe, side-effect-free and long-term effective treatment effect.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an exosome microneedle loaded with cytokines, and a preparation method and application thereof. Background Art

[0002] Skin is the largest organ in the human body, with multiple functions such as temperature regulation, metabolism and immunity, and is of great significance for maintaining homeostasis. In recent years, various skin diseases and related drugs have attracted widespread attention. Among them, oral drugs are limited by safety and utilization. In contrast, topical application and injection methods of administration effectively improve drug utilization by virtue of their local targeted treatment, but the drugs themselves have certain side effects.

[0003] Androgenetic Alopecia (AGA) is a highly common chronic progressive disease, the pathogenesis of which is closely related to the shrinkage of hair follicles and shortened hair growth cycle caused by androgen dihydrotestosterone (DHT) and related gene mutations. At present, the treatment of AGA is still difficult, and the currently approved drugs mainly include minoxidil and finasteride, both of which have many obvious disadvantages in the treatment process.

[0004] Cytokines are a class of small molecule proteins or polypeptide substances secreted by cells. Their main function is to transmit information between cells, that is, to affect cell proliferation and differentiation, survival status and immune inflammatory response by regulating various signal transduction pathways, and effectively maintain the balance of the body's physiological state.

[0005] Transforming Growth Factor β (TGFβ) is a highly conserved primitive protein family in organisms. It mainly regulates gene expression through the TGFβ / Smad signaling pathway, thereby playing a role in cell proliferation, differentiation and apoptosis. The Wnt / β-catenin signaling pathway is a key pathway for regulating the survival and apoptosis of hair follicle stem cells. Studies have shown that Wnt can significantly enhance the biological effects of TGFβ during cell differentiation and tissue remodeling.

[0006] Exosomes (Exos) are a type of tiny vesicles secreted by cells, with a typical double-layer lipid membrane structure, and are widely present in various biological fluids such as serum and saliva. They contain rich proteins, lipids, RNA and other components, which can participate in the regulation of various physiological or pathological reactions. Due to their good biocompatibility and low immunogenicity, they have become widely used natural drug carriers.

[0007] Microneedles (MNs) are composed of micron-scale needle arrays. Their significant advantage is that they can overcome the stratum corneum barrier and directly reach the reticular layer of the dermis, achieving efficient drug delivery. Due to the limited degree of interaction between microneedles and dermal nerve endings, compared with traditional injections, microneedle drug delivery causes less pain, tissue damage and skin inflammation to patients, so it has become a new drug delivery method widely accepted by patients. Summary of the invention

[0008] The present invention provides a cytokine-loaded exosome microneedle and a preparation method and application thereof. The cytokine-loaded exosome microneedle can effectively avoid the side effects of treating skin-related diseases and delay the efficacy of the drug.

[0009] In one aspect, the present invention provides a method for preparing exosomes loaded with cytokines, the preparation method comprising the following steps:

[0010] (1) Construction of a bone marrow mesenchymal stem cell line overexpressing cytokines;

[0011] (2) extracting the exosomes from the culture supernatant of the cytokine-overexpressing bone marrow mesenchymal stem cell line obtained in step (1).

[0012] As a preferred embodiment, the cytokine is transforming growth factor β (TGFβ);

[0013] Preferably, the bone marrow mesenchymal stem cells overexpressing cytokines are bone marrow mesenchymal stem cells carrying cytokine encoding genes and SAP coding sequences; the SAP coding sequence is as shown in SEQ ID NO.1, specifically: ATGGGATGTATCAATAGTAAGCGGAAGGACGC; in the technical scheme of the present invention, the cytokines secreted by the bone marrow mesenchymal stem cells carrying the cytokine encoding genes and the SAP coding sequences can be specifically enriched in exosomes depending on the polypeptides encoded by the SAP coding sequences.

[0014] As a preferred implementation, the specific steps of step (1) are:

[0015] S1 obtains a recombinant plasmid capable of overexpressing cytokines;

[0016] S2 packaging the recombinant plasmid overexpressing the cytokine to obtain an overexpression lentiviral vector;

[0017] S3 transfects bone marrow mesenchymal stem cells with the overexpression lentiviral vector to obtain the bone marrow mesenchymal stem cell line overexpressing the cytokine.

[0018] As a preferred embodiment, in step S1, the recombinant plasmid is a pCDH plasmid carrying a cytokine encoding gene and a SAP encoding sequence; the SAP encoding sequence is shown in SEQ ID NO.1, specifically: ATGGGATGTATCAATAGTAAGCGGAAGGACGC.

[0019] As a preferred embodiment, in step S2, the packaging is performed by using HEK293T cells to package the virus.

[0020] As a preferred embodiment, in step S3, the transfection is performed by screening with puromycin to obtain a bone marrow mesenchymal stem cell line that overexpresses cytokines;

[0021] Preferably, the screening comprises two screenings: the first screening has a puromycin concentration of 0.5-1.5 μg / mL in the culture medium and a culture time of 2-3 days; the second screening has a puromycin concentration of 1.5-2.5 μg / mL in the culture medium and a culture time of 2-3 days.

[0022] As a preferred embodiment, in step (2), the concentration of cytokines in the culture supernatant of the bone marrow mesenchymal stem cells overexpressing cytokines is 500-750 pg / mL.

[0023] Preferably, the exosomes are extracted by ultracentrifugation; the speed of the ultracentrifugation is 100000-120000g; the time of the ultracentrifugation is 60-90min;

[0024] In certain specific embodiments, the ultracentrifugation is performed twice;

[0025] In certain specific embodiments, the ultracentrifugation temperature is 4°C;

[0026] Preferably, the ultracentrifugation further comprises a differential centrifugation to remove dead cells and cell debris;

[0027] In some specific embodiments, the specific parameters of the differential centrifugation are:

[0028] i 300g 2min;

[0029] ii 300 × g for 10 min;

[0030] iii 2,000 × g for 20 min;

[0031] iv 8,000 × g for 30 min;

[0032] In certain specific embodiments, the temperature of the differential centrifugation is 4°C.

[0033] In another aspect, the present invention provides cytokine-loaded exosomes obtained by the above preparation method.

[0034] In yet another aspect, the present invention provides a microneedle, the needle tip of the microneedle contains the above-mentioned cytokine-loaded exosomes.

[0035] As a preferred embodiment, it also includes a backing layer;

[0036] Preferably, the backing layer is a pullulan backing layer.

[0037] As a preferred embodiment, the needle tip is made of a matrix material and exosomes loaded with cytokines doped therein;

[0038] Preferably, the matrix material is selected from at least one of ① a mixture of sodium hyaluronate and chitosan, ② a mixture of sodium hyaluronate and gelatin, ③ a mixture of sodium hyaluronate and pectin, and ④ a mixture of sodium hyaluronate and agar;

[0039] In certain specific embodiments, the matrix material is sodium hyaluronate and chitosan in a mass ratio of 1:1.

[0040] In certain specific embodiments, the microneedle is a conical needle with a needle length of 1 mm, a needle tip of 0.015 to 0.02 mm, a needle tip spacing of 0.7 mm, and a bottom diameter of 0.36 mm.

[0041] In another aspect, the present invention provides a method for preparing the above-mentioned microneedle, comprising the following steps:

[0042] A needle tip solution and a backing layer solution are prepared separately; and the microneedle is prepared by injection molding.

[0043] As a preferred embodiment, the concentration of the exosomes loaded with cytokines in the needle tip solution is 2.0×10 10 ~2.5×10 10 particles / mL;

[0044] Preferably, the needle tip solution contains 200-400 mg / mL of sodium hyaluronate and 150-600 mg / mL of chitosan.

[0045] As a preferred embodiment, the injection molding comprises the following steps: injecting the needle tip solution into the mold and centrifuging it, then adding the backing layer solution, standing it and then drying it;

[0046] Preferably, the drying temperature is 30-40°C;

[0047] Preferably, the drying time is 2 to 3 days.

[0048] In another aspect, the present invention provides use of the above-mentioned cytokine-loaded exosomes or the above-mentioned microneedles in the preparation of drugs or preparations for treating and / or preventing hair loss and skin diseases.

[0049] Preferably, the hair loss is androgenic alopecia;

[0050] Preferably, the skin diseases include psoriasis, scars and pigmented skin diseases; the pigmented skin diseases include chloasma and the like.

[0051] The present invention has the following beneficial effects:

[0052] The present invention uses bone marrow mesenchymal stem cells to prepare exosomes endogenously loaded with transforming growth factor β through exosome modification technology, and uses the exosomes to prepare microneedles. The microneedles provided by the present invention maximize the ability of the microneedles to encapsulate the agent while ensuring the effect of the microneedles, giving full play to the advantages of the microneedles being convenient, painless and slow-release. Not only can they exert their efficacy in a safe and side-effect-free manner, effectively treat diseases such as androgenic alopecia, but they can also be used for the prevention of risk areas.

[0053] Compared with the prior art, the present invention has the following advantages:

[0054] 1. The exosomes and microneedles provided by the present invention can be made of natural biomaterials with good biocompatibility, which are safe and reliable and can be controlled by dosage to achieve no side effects and reduce risk factors.

[0055] 2. The microneedles provided in the present invention can effectively prolong the overall efficacy time and reduce the frequency of medication by slowly releasing the cytokines loaded in the exosomes to the cells in the lesion area.

[0056] 3. The exosomes loaded with transforming growth factor β provided by the present invention have significant growth-promoting effects and immunomodulatory advantages. Therefore, the exosome microneedles prepared based on them have the outstanding advantage of not relying on traditional drug treatments. They are not only suitable for the treatment of diseased areas, but also suitable for targeted prevention and treatment of risk areas.

[0057] 4. The present invention loads endogenous cytokines into exosomes derived from bone marrow mesenchymal stem cells with extremely low immunogenicity, and fully utilizes the high diffusion ability and anti-degradation effect of low-immunogenic exosomes to achieve excellent therapeutic effects.

[0058] 5. The present invention improves the formula of the soluble microneedle body layer, and is committed to maximizing the drug loading performance of the microneedle while ensuring the rigidity, solubility, needle removal and needle retention rate of the microneedle. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1It is a structural diagram of the pCDH-SAP-TGFβ plasmid in Example 1 of the present invention;

[0060] Figure 2 This is a flow chart for preparing cytokine-loaded exosomes in Example 2 of the present invention;

[0061] Figure 3 This is a comparison diagram of transmission electron microscopy observation of TGFβ-modified exosomes in Example 2 of the present invention;

[0062] Figure 4 This is a comparison chart of the NTA detection results of TGFβ-modified exosomes in Example 2 of the present invention;

[0063] Figure 5 This is a graph showing the results of the detection of the loading rate of TGFβ in exosomes in Example 2 of the present invention;

[0064] Figure 6 This is a scanning electron microscope detection image of the needle extraction rate and morphological structure of the microneedles prepared in Example 3 of the present invention;

[0065] Figure 7 A comparison diagram of mechanical strength test between the improved microneedle and the common microneedle in Example 3 of the present invention;

[0066] Figure 8 This is a graph showing the results of a skin healing experiment for detecting the repair ability of microneedles in Example 3 of the present invention;

[0067] Fig. 9 This is a graph showing the immunofluorescence test results for evaluating the microneedle penetration and drug delivery capabilities in Example 3 of the present invention;

[0068] Fig.10 The diagram is a test result of the microneedle drug encapsulation effect and gel performance in Example 3 of the present invention; wherein, Figure a shows that the microneedles dissolved in the body gradually degrade over time; Figure b shows that as the microneedle gel degrades, the drugs encapsulated therein are continuously released, and the drug concentration in the pathological area continues to increase and is maintained for a long time;

[0069] Fig.11 The results of HE staining of skin sections of mice in the MN-TExos group in the in vivo experiment for detecting the therapeutic effect of the TGFβ-loaded modifiable exosome microneedle in Example 4 of the present invention; wherein, Figure a shows that dihydrotestosterone (DHT) can significantly induce atrophy of mouse hair follicle stem cells; Figure b shows that the hair follicle stem cells in the pathological area of ​​the mice in the treatment group with MN-TExos added have more proliferation and differentiation;

[0070] Fig.12 The above is the observation record and result statistical chart of hair regeneration during the hair removal, modeling and treatment process of mice in Example 4 of the present invention. DETAILED DESCRIPTION

[0071] The present application is further described in detail below in conjunction with the examples. It is particularly noted that if no specific conditions are specified in the following examples, the experiments are carried out according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can be obtained from common commercial sources.

[0072] In the following embodiments:

[0073] SAP, or Signal Peptide, refers to a specific amino acid sequence that plays a role in protein synthesis in cells and is used to guide the transfer of newly synthesized proteins to specific cell compartments or secretion outside the cells. Its encoding nucleotide sequence is shown in SEQ ID NO.1.

[0074] pCDH-SAP: Overexpression pCDH plasmid backbone carrying SAP sequence, structure as Figure 1 shown.

[0075] pCDH-SAP-Cytokine: The gene expressing the target cytokine is specifically connected to the pCDH-SAP backbone vector.

[0076] LV-SAP-Cytokine fusion expression lentiviral vector: LV-SAP-Cytokine is a lentivirus carrying the pCDH-SAP-Cytokine overexpression vector generated by HEK293T cells, wherein LV is a lentivirus (Lentivirus).

[0077] MSCs: Mesenchymal Stem Cells.

[0078] BMSCs-SAP-Cytokine: Bone Mesenchymal Stem Cells (MBC, CLM0106-RT). Lentivirus-carrying overexpression vector infects bone marrow mesenchymal stem cells to generate a stable cell line that stably expresses cytokines.

[0079] Puromycin: Puromycin is used to screen successfully transfected bone marrow mesenchymal stem cells. Only positive cell clones that have been successfully transfected with lentivirus can survive.

[0080] TGFβ: Transforming Growth Factor Beta, a common multifunctional cytokine that is widely involved in various biological processes such as cell proliferation, differentiation, immune regulation and tissue repair.

[0081] PBS solution: phosphate buffered saline.

[0082] Example 1 Construction of BMSCs-SAP-TGFβ stable cell line

[0083] In this embodiment, constructing a stable cell line specifically includes the following steps:

[0084] 1. Extract the pCDH-SAP-TGFβ recombinant plasmid (structure as Figure 1 (shown)

[0085] S1. Amplify pCDH-SAP-TGFβ positive strains: Take a culture dish containing solid culture medium containing sodium ampicillin (solaber, CA2031-5g), add the mixed bacterial solution, shake it back and forth and left and right until it is covered with a layer, and culture it upside down in a bacterial incubator at 37°C overnight for 14 hours; pick a single clone and add it to a 15mL centrifuge tube containing 6mL LB liquid culture medium (containing ampicillin), seal the tube with a sealing film after mixing, and culture it in a shaking incubator at 37°C, 220rpm overnight for 14 hours.

[0086] S2. Extraction of pCDH-SAP-TGFβ recombinant plasmid: First, insert the CP3 adsorption column (TIANGEN, DP103-02) into the collection tube for column balancing step, then take the bacterial solution and place it in a centrifuge to centrifuge to precipitate the bacteria to the bottom of the tube, discard the waste liquid and add solution P1 (TIANGEN, DP103-02) to resuspend, add solution P2 (TIANGEN, DP103-02) and solution P3 (TIANGEN, DP103-02) in turn, gently invert until the bacteria are lysed and the genomic DNA is completely precipitated, transfer the supernatant to the balanced adsorption column after centrifugation, centrifuge again to allow the plasmid DNA to bind to it, discard the waste liquid and add PW rinsing solution (TIANGEN, DP103-02), rinse twice, pour out the liquid and empty it, take a clean centrifuge tube to collect the extracted plasmid DNA, insert the adsorption column and add ddH2O to the center of the column, let it stand at room temperature for 2 minutes and then centrifuge to elute.

[0087] S3. Enzyme digestion detection of extracted plasmid:

[0088] Mix the enzyme digestion system and digest for 30 minutes under 37°C metal bath conditions. The specific system preparation is shown in Table 1 below:

[0089] Table 1 Enzyme digestion detection system for extracted plasmids

[0090] Reagents Usage Target plasmid Make its mass 500ng XOt 0.5μL EcoRI 0.5μL Green buffer 2μL <![CDATA[ddH2O]]> Increase to 20 μL

[0091] Among them, EcoRI (Thermo, FD0274); Green buffer (YEASEN, 11201ES08).

[0092] 2. Lentiviral packaging of pCDH-SAP-TGFββ fusion expression vector using HEK293T cells

[0093] S1. Thawing HEK293T cells: Select cells at the early generation for subculture, digest and count them after they have grown to full size, and transfer 5×10 6 Cells were plated in culture dishes until the confluence reached 90%.

[0094] S2. Prepare transfection system: Take two 1.5 mL centrifuge tubes, label them A and B respectively, and prepare the system as shown in Table 2:

[0095] Table 2 HEK293T cell plasmid transfection system

[0096]

[0097] After the prepared tubes A and B are allowed to stand at room temperature for 5 minutes, slowly add the PEI-containing solution B to the plasmid-containing solution A, pipette 30-50 times to mix thoroughly, and then let stand at room temperature for 20 minutes to complete the preparation of the transfection solution.

[0098] S3.HEK293T cell transfection and virus collection: After discarding the HEK293T cell culture supernatant, rinse once with PBS, and then add serum-free and antibiotic-free basic culture medium DMEM for culture; after mixing the transfection mixture again, add it evenly to the cell supernatant, culture in a CO2 incubator for 6 hours, discard the supernatant, add 10mL HEK293T cell complete culture medium containing serum and double antibodies to replace the medium; after culture in a CO2 incubator for 48 hours, take the supernatant and add it to a 0.22μm filter (Millipore) for filtration, transfer the filtrate to a new 15mL centrifuge tube, add 2.5mL PEG8000 (Sangon, a600433), mix thoroughly and incubate at 4℃ overnight; take it out and centrifuge at 4℃5,000rpm for 30min, discard the supernatant, resuspend it in sterile PBS and divide it into packages to obtain the purified virus.

[0099] 3. LV-SAP-TGFβ lentiviral vector infection of in vitro cultured bone marrow mesenchymal stem cells

[0100] First, BMSCs were revived, and then digested and counted after the cells were stable. Then, 2, 4, 6, 8, 10, and 20 μL of virus and 3 μL of Polybrene (concentration of 10 μg / mL) were added to 3 mL of complete culture medium to prepare transfection medium. 5 The cells were seeded in a 24-well plate at a cell density of 1.5 cells / mL, 500 μL of transfection medium was added to each well, and 6 replicate wells were set up; the cells were collected after overnight transfection and centrifuged at 300×g for 5 min at 4°C, the supernatant was discarded, and complete medium was added for culture.

[0101] 4. Two rounds of drug addition screening of bone marrow mesenchymal stem cells after infection

[0102] The cells were cultured for 3 days, and the culture medium was replaced with a transfection medium containing 0.5 μg / mL Puromycin for the first round of drug addition screening. After 3 days of culture, the culture medium was replaced with a complete culture medium. After 3 days of complete culture, the transfection medium was replaced with 2.5 μg / mL Puromycin for a second round of drug addition screening. After 3 days of culture, stably proliferating cells were finally obtained. The cell line was named BMSCs-SAP-TGFβ stable transfection cell line and frozen.

[0103] Example 2

[0104] In this example, exosomes were extracted from the cell culture supernatant of the BMSCs-SAP-TGFβ stable cell line in Example 1. Figure 2 As shown, the specific steps include:

[0105] 1. Preparation steps before ultracentrifugation: After the cells have stabilized and proliferated, they are digested and counted, with a count of 2 × 10 6 The cells were seeded at a density of 10 cm cells / plate in multiple 10 cm cell culture dishes and cultured in a 37°C incubator until adhered to the wall; the supernatant was transferred to a 50 mL centrifuge tube, centrifuged at 300 × g for 2 min at 4°C, and the supernatant was aspirated with a syringe, filtered through a 0.22 μm filter (Millipore) into a new 50 mL centrifuge tube, kept at room temperature for later use, and the remaining cells were passaged and frozen; the filtered supernatant was weighed and balanced with a new 50 mL centrifuge tube, and centrifuged in a 4°C centrifuge at the following speeds: 300 × g, 10 min; 2,000 × g, 20 min; 8,000 × g, 30 min, in order to remove dead cells and cell debris.

[0106] 2. Collect exosomes by ultracentrifugation: Transfer the supernatant of the above centrifugation step to a Beckman ultracentrifuge tube that had been disinfected with 75% alcohol in advance, and weigh and balance it; use 75% alcohol to disinfect the sleeve and sleeve cover of the centrifuge tube, then put the ultracentrifuge tube into the tube sleeve, tighten the lid, and arrange it on the 40Ti rotor in the corresponding order; move the rotor to an ultracentrifuge (OptimaXPN-100, Beckman Coulter), 110,000×g, 4°C centrifuge for 70 minutes, release the vacuum after completion, remove it, discard most of the supernatant and retain 500μL of liquid, add PBS, weigh and balance it, and ultracentrifuge again under the same conditions as above to obtain the separated exosomes.

[0107] 3. Determination of the final concentration of TGFβ-modified exosomes: Based on the BMSCs-derived TGFβ-rich exosomes extracted in the above steps, the exosome concentration was first measured, and then the exosomes were reasonably diluted according to the measured concentration. The human TGFβ-ELISA detection kit (Jingmei Biotechnology, J1767-B) was used to measure the OD value of TGFβ in exosomes of different concentrations, and the concentration ratio of exosomes per milliliter was determined based on the measured results and the optimal dosage of TGFβ.

[0108] Transmission electron microscopy (HITACHI HT 7800) showed that ( Figure 3 ), exosomes loaded with TGFβ showed a typical "teacup-shaped" morphology; nanoparticle tracking analysis results showed that ( Figure 4 ), the particle size of exosomes loaded with TGFβ meets the standard; the results of the microplate reader test show that ( Figure 5 ), with a density of 3×10 6 The exosomes in the supernatant of BMSCs were successfully loaded with TGFβ, and the final concentration of TGFβ was determined to be 689.81 pg / mL.

[0109] Example 3

[0110] In this example, the exosomes in Example 2 are prepared into microneedles, which specifically include the following steps:

[0111] 1. Determination of the ratio of sodium hyaluronate and chitosan gel

[0112] The initial range of chitosan was 0.15g-0.6g, and the detection gradients with dosages of 0.15g, 0.3g, 0.45g, and 0.6g were set to carry out sol inclination test. According to the test results, 0.3g was taken as the optimal dosage, and the concentration gradients of sodium hyaluronate were further set to 0.25g, 0.3g, and 0.35g to carry out microneedle extraction rate and mechanical property tests. Finally, it was determined that the matrix material of the microneedle tip was sodium hyaluronate and chitosan in a mass ratio of 1:1.

[0113] 2. Preparation of Gel Solution

[0114] Under ultrasonic dissolution conditions, sodium hyaluronate and chitosan were dissolved in PBS and mixed evenly, and then mixed with the PBS resuspension of exosomes to obtain the needle body layer gel solution; in the needle body layer gel solution, the concentrations of sodium hyaluronate and chitosan were both 300 mg / mL, and the concentration of exosomes was 2.2×10 10 particles / mL;

[0115] Pullulan was mixed with double distilled water to prepare a 200 mg / mL backing layer gel solution;

[0116] The two gel solutions were centrifuged at 3000 rpm for 3 min to remove bubbles.

[0117] 3. Pour the gel and centrifuge to shape

[0118] First, inject the needle tip gel solution into the 20*20 array, 16.3*16.3mm 2 , a TM-16 microneedle mold with a groove depth of 2.5 mm (BT Bio, BT-TM16). After filling, the mold was fixed in a 50 mL centrifuge tube and centrifuged at 3900 rpm for 5 min. After removing excess glue, the backing layer gel solution was added. After standing for 5 min to make the glue surface flat, it was placed in a 37°C oven for drying for 2 days.

[0119] 4. Demolding and standby after microneedle drying

[0120] The molded microneedles were taken out from the mold, and the needle rate was checked and placed at 4°C for later use. The mold was soaked in pure water, and then cleaned by water bath ultrasound for 10 minutes, and then centrifuged upside down at 3000 rpm for 3 minutes to remove the liquid in the pores.

[0121] 5. Microneedle morphology characterization and performance testing

[0122] In this example, mature C57BL / 6 mice were selected to carry out a skin healing experiment to evaluate the ability of the microneedles after the improved formula to promote wound repair. Exosomes were labeled with DiL red fluorescent probe and encapsulated into microneedles for drug penetration test. The degradation rate of the microneedles after entering the body and their drug sustained-release characteristics were evaluated through drug encapsulation effect and gel performance testing.

[0123] Experimental results:

[0124] like Figure 6 As shown, the scanning electron microscope observation results show that the needle extraction rate of the prepared microneedles can reach 100% and have a complete morphological structure;

[0125] like Figure 7 As shown, the results of the mechanical property test of the microneedles showed that the microneedles modified by adding 0.3g chitosan had stronger rigidity than the ordinary microneedles and did not break during the pressure application process;

[0126] like Figure 8 As shown in the figure, the results of the skin healing experiment show that microneedling has a significant effect on promoting the repair of skin wounds and can accelerate wound healing;

[0127] like Fig. 9 As shown, the fluorescence detection results of the drug penetration test showed that the microneedles can effectively carry exosomes through the surface layer of the skin and directly reach the dermis;

[0128] like Fig.10As shown, the results of drug encapsulation effect and gel performance test showed that after the microneedles were dissolved in the body, they slowly degraded over a long period of time and achieved continuous release of drugs, significantly prolonging the duration of drug efficacy.

[0129] Example 4

[0130] This embodiment uses the AGA animal model to detect the therapeutic effect of the above-mentioned microneedles, which specifically includes the following steps:

[0131] 1. AGA modeling

[0132] Based on the pathogenesis of AGA, 1 mg of dihydrotestosterone (DHT) was injected into C57BL / 6 mice daily for 19 consecutive days to induce hair loss in mice.

[0133] 2. Experimental Animal Grouping

[0134] In this evaluation, 6 groups of experiments were set up, with 5 mice in each group, for a total of 30 mice. All operations performed on animals in this experiment complied with the relevant regulations of the Animal Experiment Ethics Committee of Shaanxi Normal University.

[0135] To verify the AGA modeling effect, a blank control group (Control) and an AGA model (Model) group were set up. To evaluate the hair growth effects of different therapeutic agents under pathological conditions, an empty microneedle (MN) group, a microneedle-loaded BMSC-Exos (MN-Exos) group, a microneedle-loaded TGFβ (MN-TGFβ) group, and a microneedle-loaded BMSC-TGFβ-Exos (MN-TExos) group were set up, as follows:

[0136] Blank control group: The mice were subjected to back hair removal every day for 19 consecutive days.

[0137] AGA model group: 1 mg DHT was injected into mice every day for 19 consecutive days to induce hair loss.

[0138] Empty microneedle (MN) group: Based on the treatment of mice in the Model group, empty microneedles were applied to the hair removal area for treatment on days 1, 4, 7, 10, 13, and 19.

[0139] Microneedle-loaded BMSC-Exos (MN-Exos) group: The only difference from the MN group in the treatment is that microneedles containing BMSC-Exos are used to treat the hair removal area. The microneedles containing BMSC-Exos are microneedles prepared under the same conditions as the exosomes extracted from the culture supernatant of ordinary bone marrow mesenchymal stem cells.

[0140] Microneedle-loaded TGFβ (MN-TGFβ) group: The only difference from the MN group in the treatment was that microneedles containing TGFβ were used to treat the hair removal area. The microneedles containing TGFβ were prepared by replacing the exosomes loaded with cytokines in Example 3 with TGFβ;

[0141] BMSC-TGFβ-Exos (MN-TExos) group: The only difference from the MN group in the treatment was that the microneedles containing BMSC-TGFβ-Exos were used to treat the hair removal area. The microneedles containing BMSC-TGFβ-Exos were the exosome microneedles loaded with cytokines prepared in Example 3.

[0142] The experimental results are as follows Fig.11 As shown in the figure, DHT can induce hair follicles in mice to shrink and move closer to the epidermis. The hair follicle stem cells in the MN-TExos group proliferate in larger numbers and differentiate more obviously. Fig.12 As shown, the observation records and statistical results during the hair regeneration process showed that the hair regeneration rate of mice in the MN-TExos treatment group was the fastest.

[0143] The above is only an exemplary embodiment of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present disclosure should be included in the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be based on the protection scope of the claims.

Claims

1. A method for preparing exosomes loaded with cytokines, characterized in that: The preparation method comprises the following steps: (1) Construction of a bone marrow mesenchymal stem cell line overexpressing cytokines; (2) extracting the exosomes from the culture supernatant of the cytokine-overexpressing bone marrow mesenchymal stem cell line obtained in step (1).

2. The preparation method according to claim 1, characterized in that: The cytokine is transforming growth factor β; Preferably, the bone marrow mesenchymal stem cells overexpressing cytokines are bone marrow mesenchymal stem cells carrying cytokine encoding genes and SAP encoding sequences; the SAP encoding sequence is shown as SEQ ID NO.

1.

3. The preparation method according to claim 1, characterized in that: The specific steps of step (1) are: S1 obtains a recombinant plasmid capable of overexpressing cytokines; S2 packaging the recombinant plasmid overexpressing the cytokine to obtain an overexpression lentiviral vector; S3 transfecting bone marrow mesenchymal stem cells with the overexpression lentiviral vector to obtain the bone marrow mesenchymal stem cell line overexpressing the cytokine; Preferably, in step S1, the recombinant plasmid is a pCDH plasmid carrying a cytokine encoding gene and a SAP encoding sequence; the SAP encoding sequence is shown as SEQ ID NO.1; Preferably, in step S2, the packaging is performed by using HEK293T cells for virus packaging; Preferably, in step S3, the transfection is screened with puromycin to obtain a bone marrow mesenchymal stem cell line that overexpresses cytokines; Preferably, the screening comprises two screenings: the first screening has a puromycin concentration of 0.5-1.5 μg / mL in the culture medium and a culture time of 2-3 days; the second screening has a puromycin concentration of 1.5-2.5 μg / mL in the culture medium and a culture time of 2-3 days.

4. The preparation method according to claim 1, characterized in that: In step (2), the concentration of cytokines in the culture supernatant of the bone marrow mesenchymal stem cells overexpressing cytokines is 500 to 750 pg / mL; Preferably, the exosomes are extracted by ultracentrifugation; the speed of the ultracentrifugation is 100000-120000g; the time of the ultracentrifugation is 60-90min; Preferably, the ultracentrifugation further comprises an operation of removing dead cells and cell debris by differential centrifugation.

5. The cytokine-loaded exosomes obtained by the preparation method according to any one of claims 1 to 4.

6. A microneedle, characterized in that: The needle tip of the microneedle contains the cytokine-loaded exosomes according to claim 5.

7. The microneedle according to claim 6, characterized in that Also included is a backing layer; Preferably, the backing layer is a pullulan backing layer; Preferably, the needle tip is made of a matrix material and cytokine-loaded exosomes doped therein; Preferably, the matrix material is selected from at least one of ① a mixture of sodium hyaluronate and chitosan, ② a mixture of sodium hyaluronate and gelatin, ③ a mixture of sodium hyaluronate and pectin, and ④ a mixture of sodium hyaluronate and agar.

8. The method for preparing the microneedle according to claim 6, characterized in that: The following steps are involved: A needle tip solution and a backing layer solution are prepared separately; and the microneedle is prepared by injection molding.

9. The preparation method according to claim 8, characterized in that: In the needle tip solution, the concentration of the cytokine-loaded exosomes is 2.0×1010 to 2.5×1010 particles / mL; Preferably, the needle tip solution contains 200-400 mg / mL of sodium hyaluronate and 150-600 mg / mL of chitosan; Preferably, the injection molding comprises the following steps: injecting the needle tip solution into the mold and centrifuging it, then adding the backing layer solution, standing it and then drying it; Preferably, the drying temperature is 30-40°C; Preferably, the drying time is 2 to 3 days.

10. Use of the cytokine-loaded exosomes according to claim 5 or the microneedles according to claim 6 in the preparation of drugs or preparations for treating and / or preventing hair loss and skin diseases; Preferably, the hair loss is androgenic alopecia; Preferably, the skin diseases include psoriasis, scars and pigmented skin diseases; Preferably, the pigmented skin disease is melasma.

Images