Mitochondrial regulator based on nucleic acid reaction, preparation method and application thereof

Abstract

The invention discloses a mitochondrial regulator based on nucleic acid reaction as well as a preparation method and application of the mitochondrial regulator. The mitochondrial regulator is composed of three different DNA hairpin structures, and is formed by self-assembly of a trigger DNA chain Photo modified with a photo-cleavable nitrobenzyl linking group and two linking DNAs of triphenylphosphine molecules metastably existing in a solution and marked with targeted mitochondria. The mitochondrial regulator can spontaneously react in a solution to be combined with a plurality of mitochondria and induce the mitochondria to aggregate and fuse after being irradiated by ultraviolet light, has good controllability and biocompatibility, is easy to biodegrade, does not influence the expression of protein on the surface of the mitochondria, and can be used for preparing the mitochondria regulator. The method has potential application prospects in clinical application in the fields of cell biology research and precise cancer diagnosis and treatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of mitochondrial regulators, and relates to a mitochondrial regulator based on nucleic acid reaction, a preparation method and application thereof. Background Art

[0002] Mitochondria are a type of organelles covered by two membranes that exist in most cells. They are structures that produce energy in cells and are also the main place for cells to perform aerobic respiration. In addition, mitochondria are the first line of defense for cells under various stresses. In addition to participating in the normal energy metabolism of cells and living organisms, the dynamic changes and morphology of mitochondria are closely related to the occurrence and development of a variety of diseases. Mitochondria are related to many diseases, such as tumor diseases, neurodegenerative diseases, endocrine diseases, etc. In particular, the dynamic balance of mitochondrial fission and fusion affects the normal morphology, physiological function and apoptosis of cells. Dysfunctional mitochondria can be repaired through a series of complex adaptive responses, such as mitochondrial biogenesis, mitochondrial fission and fusion, mitochondrial unfolded protein response and mitochondrial autophagy. Therefore, mitochondria have gradually become a powerful target for the treatment of related diseases. Regulating the dynamic process of mitochondrial fusion is of great significance for the study of mitochondrial-related diseases.

[0003] Mitochondrial fusion protein 1 / 2 (Mfn1 / 2) is a key protein for mitochondrial outer membrane fusion. The two can form homotypic or heterotypic dimers to enable adjacent mitochondria to fuse. Using organic small molecule compounds to regulate the expression of mitochondrial surface fusion protein Mfn1 / 2 can promote mitochondrial fusion and achieve the treatment of mitochondrial-related diseases ([1] Wang, DL; Wang, JN; Bonamy, GMC; et al. A Small Molecule Promotes Mitochondrial Fusion in Mammalian Cells. Angew. Chem. Int. Ed. 2012, 51, 9302-9305). However, due to the high cytotoxicity and poor controllability of organic small molecule compounds, using them as mitochondrial regulators may have a counterproductive effect, and regulating the expression of mitochondrial surface fusion proteins may affect mitochondrial biological functions. Therefore, it is of great significance to develop new mitochondrial regulators that are not organic small molecule compounds.

[0004] DNA can not only be used as a carrier of genetic information of life, but also as a tool for constructing nanostructures. DNA nanotechnology is a technology that artificially designs and produces useful nucleic acid structures. DNA nanotechnology mainly uses the characteristics of DNA being nanometer-sized, rigid, and highly coded to construct various nanostructures. Its precise base complementary pairing rules, good programmability, and good biocompatibility make it widely used in biomedicine, chemistry, materials, and other fields. At present, various DNA nanomaterials have been applied to the detection of biological molecules, cell regulation, diagnosis and treatment of diseases, etc. For example, DNA nanomaterials can form macromolecules through self-assembly to participate in the regulation of intracellular organelles, promote cell apoptosis, or achieve the effect of treating diseases; for example, DNA nanomaterials can bind proteins to lysosomes through special DNA sequences, and target the degradation of specific proteins to achieve the effect of treating diseases; for example, DNA nanomaterials can modify triphenylphosphine on DNA nanomaterials by forming a DNA tetrahedral structure, so as to cover the mitochondrial membrane with DNA nanomaterials, reduce the production of ATP in cells, and inhibit the migration of cancer cells. ([2] Li, F.; Liu, YJ; Dong, YH; et al. Dynamic Assembly of DNA Nanostructures in Living Cells for Mitochondrial Interference. J. Am. Chem. Soc. 2022, 144, 4667-4677.). Hybridization chain reaction (HCR) is a simple and effective signal amplification method. It is a one-dimensional DNA polymerization process proposed by Dirks and Pierce in 2004. Compared with other amplification methods, the uniqueness of the HCR amplification method is that specific ssDNA fragments will not be amplified, but act as initiators to self-assemble with two metastable hairpin DNAs. It is currently mainly used in the detection of various targets, such as protein detection, DNA detection, etc. Summary of the invention

[0005] The purpose of the present invention is to provide a mitochondrial regulator based on nucleic acid reaction, a preparation method and its application. The mitochondrial regulator has the advantages of simple synthesis triggering conditions, mild reaction conditions, good biocompatibility, low cytotoxicity, good biodegradability and no effect on mitochondrial surface protein expression.

[0006] The technical solution for achieving the purpose of the present invention is as follows:

[0007] The mitochondrial regulator based on nucleic acid reaction is a DNA nanostructure, which is self-assembled by three different DNA chains, all of which have hairpin structures, including a trigger DNA chain Photo modified with a photo-cleavable nitrobenzyl linker and two DNA chains H1 and H2 labeled with triphenylphosphine molecules targeting mitochondria. The trigger chain DNA chain Photo has multiple complementary paired base sequences with the DNA chain H1, and the DNA chain H1 has multiple complementary paired base sequences with the DNA chain H2, and each DNA nanostructure contains one trigger DNA chain Photo and n DNA chains H1 and n DNA chains H2, where n≥50.

[0008] Preferably, the number of complementary paired bases in the hairpin structure of the trigger DNA chain Photo, DNA chain H1 or DNA chain H2 is 18.

[0009] Preferably, the number of bases that trigger the complementary pairing of the DNA chain Photo and the DNA chain H1, and the number of bases that trigger the complementary pairing of the DNA chain H1 and the DNA chain H2 are both 18.

[0010] Preferably, in the DNA chains H1 and H2, the labeling site of the triphenylphosphine molecule is the 3' end of the DNA.

[0011] Preferably, the base sequence of the trigger DNA chain Photo is shown as SEQ ID NO.3, the base sequence of the DNA chain H1 is shown as SEQ ID NO.1, and the base sequence of the DNA chain H2 is shown as SEQ ID NO.2.

[0012] The method for preparing the above-mentioned mitochondrial regulator based on nucleic acid reaction comprises the following steps:

[0013] Step 1, respectively mixing propargyl triphenylphosphine with a DNA chain H1 or DNA chain H2 labeled with an azide group, adding dimethyl sulfoxide (DMSO) and ascorbic acid solution, and then adding copper sulfate solution, reacting at room temperature for more than 12 hours, and purifying three times with a 3kD ultrafiltration tube to obtain DNA chain H1 and DNA chain H2 labeled with a mitochondrial-targeting triphenylphosphine molecule at the 3' end, respectively;

[0014] Step 2, annealing the trigger DNA chain Photo modified with a photocleavable nitrobenzyl linker, the DNA chain H1 and the DNA chain H2 labeled with a mitochondrial-targeting triphenylphosphine molecule at the 3' end at 95° C. for 5 min, and slowly cooling to room temperature to form a hairpin structure;

[0015] Step 3, mixing the trigger DNA chain Photo, DNA chain H1 and DNA chain H2 that form the hairpin structure obtained in step 2, irradiating them under ultraviolet light with an emission wavelength of 365 nm, and then reacting them at 37° C. to obtain a mitochondrial regulator.

[0016] Preferably, in step 3, the molar ratio of the trigger DNA chain Photo, DNA chain H1 and DNA chain H2 is 1:2:2.

[0017] Preferably, in step 3, the irradiation time under ultraviolet light is 10 to 20 minutes, and the reaction time at 37° C. is 4 to 6 hours.

[0018] Furthermore, the present invention provides the use of the above-mentioned nucleic acid reaction-based mitochondrial regulator in inducing mitochondrial aggregation and fusion.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] The DNA nanomaterial mitochondrial regulator synthesized based on nucleic acid reaction of the present invention has the characteristics of low cytotoxicity, high controllability and easy biodegradation. Compared with the reported small molecule compound mitochondrial regulator, the mitochondrial regulator of the present invention has simple synthesis triggering conditions, mild reaction conditions, good biocompatibility and stability, and will not affect the expression of mitochondrial surface proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the preparation of nucleic acid-based mitochondrial regulators and the induction of mitochondrial aggregation and fusion;

[0022] Figure 2 It is the polyacrylamide gel electrophoresis diagram of the raw material chain and the mitochondrial regulator, wherein the lanes are 1: Maker, 2: Photo (no illumination), 3: H1, 4: H2, 5: Photo+H1+H2 (illumination), 6: Photo+H1+H2 (no illumination), 7: H1+H2, 8: Photo+H1 (illumination), 9: Photo+H2 (illumination), 10: Photo (illumination);

[0023] Figure 3 The dynamic light scattering diagram of mitochondrial aggregation and fusion induced by different test groups in Example 3;

[0024] Figure 4 This is a confocal microscopy image of mitochondrial aggregation and fusion induced by mitochondrial regulators in Example 4. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below with reference to specific embodiments and accompanying drawings.

[0026] Example 1

[0027] Schematic diagram of the preparation of nucleic acid-based mitochondrial regulators and the induction of mitochondrial aggregation and fusion Figure 1 As shown, the specific synthesis steps are as follows:

[0028] (1) Preparation of DNA chains H1-TPP and H2-TPP: 5 μL, 13 mM propargyl triphenylphosphine and 163 μL, 100 μM azide-labeled DNA chain H1 (base sequence: ATTCAA GCGACA CCGTGGACGTGC ACCCACGCACGTCCACGGTGTCGCACC, SEQ ID NO.1) or DNA chain H2 (base sequence: GTTGCACGTCCACGGTGTCGCTTGAAT GCGACACCGTGGA CGTGC GTGGGT, SEQ ID NO.2), wherein the base sequences of the underlined and bold parts in the single chain are the base complementary pairing sequences when the DNA chain H1 and the DNA chain H2 each form a hairpin structure, the base sequence of the italic part in the DNA chain H1 is complementary to the base sequence of the italic part in the DNA chain H2, and the base sequence of the bold part in the DNA chain H1 is complementary to the base sequence of the underlined part in the DNA chain H2. Then, 247 μL DMSO and 32 μL 50 mM ascorbic acid are added to the mixed solution. 40 μL 10 mM copper sulfate solution is added to the above mixed solution and reacted at room temperature for 12 hours, and then ultrafiltered 2-3 times with a 3kD ultrafiltration tube to obtain DNA chain H1-TPP and DNA chain H2-TPP respectively.

[0029] (2) Annealing of DNA chains: 100 μL and 10 μM of the trigger DNA chain Photo (commissioned to Shanghai Shenggong Biotechnology Technology Service Co., Ltd. for synthesis, with the base sequence of GCACGTCCACGGTGTCGCTTGAAT / ipclink / GGTGCGACACCGTGGACGTGCAAC, SEQ ID NO. 3), DNA chain H1-TPP, and DNA chain H2-TPP, respectively, which were modified with a photocleavable nitrobenzyl linker, were placed in a PCR instrument, annealed at 95° C. for 5 minutes, slowly cooled to room temperature, and placed in a refrigerator overnight to obtain the trigger DNA chain Photo, DNA chain H1-TPP, and DNA chain H2-TPP with a hairpin structure, respectively. The base sequence in the italic part of the trigger DNA chain Photo is complementary to the base sequence in the italic part of the DNA chain H1.

[0030] (3) Take 10 μL, 20 μL, and 20 μL of the 10 μM hairpin-structured trigger DNA chain Photo, DNA chain H1-TPP, and DNA chain H2-TPP obtained in step (2), respectively, mix them, illuminate them under ultraviolet light with an emission wavelength of 365 nm for 10 min, and react at 37°C for 4 hours to obtain a mitochondrial regulator.

[0031] Example 2

[0032] The raw DNA used in Example 1 was subjected to polyacrylamide gel electrophoresis under the conditions of 10% polyacrylamide, 100 V voltage, and 45 minutes of running time. Figure 2 It can be seen that when DNA chains H1 and H2 are present in the solution, and when the trigger DNA chain Photo is present in the solution, DNA chains H1 and H2 will not react without illumination (see lanes 6 and 7). When the trigger DNA chain Photo and DNA chain H1 are present in the solution and illuminated, the trigger DNA chain Photo and DNA chain H1 react to form a long DNA chain (see lane 8). Under the same circumstances, the trigger DNA chain Photo and DNA chain H2 will not react under illumination (see lane 9). When the trigger DNA chain Photo, DNA chains H1 and H2 are simultaneously present in the solution and illuminated, reactions will occur to generate DNA chains of various lengths (see lane 5).

[0033] Example 3

[0034] The mitochondrial regulator prepared in Example 1 was added to the freshly extracted mitochondria, placed in a 4° C. refrigerator overnight, and then subjected to dynamic light scattering.

[0035] from Figure 3 From the dynamic light scattering experiment results, it can be seen that compared with the blank control group, DNA chain H1 and H2 groups and the triggered DNA chain Photo, DNA chain H1 and H2 groups without ultraviolet light, the triggered DNA chain Photo, DNA chain H1 and H2 groups after illumination can significantly aggregate and fuse mitochondria, making their particle size exceed 500μm and reach 1000μm.

[0036] Example 4

[0037] The mitochondrial regulator prepared in Example 1 was used to induce mitochondrial aggregation and fusion, and confocal imaging of mitochondria was performed.

[0038] 40 μL of the mitochondrial regulator prepared in Example 1 was mixed with 200 μL of the mitochondrial sample, and after reacting overnight, the mixture was dropped onto a glass slide and imaged using a confocal microscope.

[0039] exist Figure 4 In the figure, a is the blank control group, and b is the group with mitochondrial regulators. It can be seen that compared with the blank control group, in the samples containing mitochondrial regulators, the size of mitochondria becomes larger and aggregated, indicating that mitochondrial regulators can induce mitochondrial aggregation and fusion.

Claims

1. A mitochondrial regulator based on nucleic acid response, characterized in that It is a DNA nanostructure, which is composed of three different self-assembled DNA chains, all of which are hairpin structures, including a trigger DNA chain Photo modified with a photo-cleavable nitrobenzyl linker and two DNA chains H1 and H2 labeled with triphenylphosphine molecules targeting mitochondria. The trigger chain DNA chain Photo has multiple complementary paired base sequences with the DNA chain H1, and the DNA chain H1 has multiple complementary paired base sequences with the DNA chain H2, and each DNA nanostructure contains one trigger DNA chain Photo, n DNA chains H1 and n DNA chains H2, where n≥50.

2. The mitochondrial regulator according to claim 1, characterized in that The number of complementary paired bases in the hairpin structure of the trigger DNA chain Photo, DNA chain H1 or DNA chain H2 is 18.

3. The mitochondrial regulator according to claim 1, characterized in that The number of bases that trigger complementary pairing between DNA chain Photo and DNA chain H1, and the number of bases that trigger complementary pairing between DNA chain H1 and DNA chain H2 are both 18.

4. The mitochondrial regulator according to claim 1, characterized in that In DNA chains H1 and H2, the labeling site of the triphenylphosphine molecule is the 3' end of the DNA.

5. The mitochondrial regulator according to claim 1, characterized in that The base sequence of the trigger DNA chain Photo is shown in SEQ ID NO.3, the base sequence of the DNA chain H1 is shown in SEQ ID NO.1, and the base sequence of the DNA chain H2 is shown in SEQ ID NO.

2.

6. The method for preparing a mitochondrial regulator according to any one of claims 1 to 5, characterized in that: The steps include: Step 1, respectively mixing propargyl triphenylphosphine with a DNA chain H1 or DNA chain H2 labeled with an azide group, adding DMSO and ascorbic acid solution, and then adding copper sulfate solution, reacting at room temperature for more than 12 hours, and purifying three times with a 3kD ultrafiltration tube to obtain DNA chain H1 and DNA chain H2 labeled with a mitochondrial-targeting triphenylphosphine molecule at the 3' end, respectively; Step 2, annealing the trigger DNA chain Photo modified with a photocleavable nitrobenzyl linker, the DNA chain H1 and the DNA chain H2 labeled with a mitochondrial-targeting triphenylphosphine molecule at the 3' end at 95° C. for 5 min, and slowly cooling to room temperature to form a hairpin structure; Step 3, mixing the trigger DNA chain Photo, DNA chain H1 and DNA chain H2 that form the hairpin structure obtained in step 2, irradiating them under ultraviolet light with an emission wavelength of 365 nm, and then reacting them at 37° C. to obtain a mitochondrial regulator.

7. The preparation method according to claim 6, characterized in that: In step 3, the molar ratio of the trigger DNA chain Photo, DNA chain H1 and DNA chain H2 is 1:2:

2.

8. The preparation method according to claim 6, characterized in that: In step 3, the illumination time under ultraviolet light is 10 to 20 minutes, and the reaction time at 37° C. is 4 to 6 hours.

9. Use of the mitochondrial regulator according to any one of claims 1 to 5 in inducing mitochondrial aggregation and fusion.

Images