Construction and application of recombinant saccharomyces cerevisiae strain for producing liquiritigenin

Abstract

The invention discloses construction and application of a recombinant saccharomyces cerevisiae strain for producing liquiritigenin, and belongs to the field of metabolic engineering and synthetic biology. According to the invention, an improved galactose induction system is introduced into a naringenin production strain, and GmCHR5 is subjected to integrated expression in saccharomyces cerevisiae NHB52, so that synthesis of liquiritigenin is realized. Further through optimization of an endogenous NADPH biosynthesis pathway, supply of NADPH is promoted, and the synthesis proportion of liquiritigenin is increased; the acyltransferase is knocked out, so that the content of intracellular malonyl-CoA is increased, and the yield of liquiritigenin is further increased. The liquiritigenin yield of the saccharomyces cerevisiae engineering strain in the fermentation tank level reaches 867.67 mg / L, a foundation is laid for subsequent flavonoid compound biosynthesis, and the saccharomyces cerevisiae engineering strain has potential value and significance for development of synthetic biology.

Description

Technical Field

[0001] The invention relates to the construction and application of a recombinant saccharomyces cerevisiae strain for producing liquiritigenin, and belongs to the fields of metabolic engineering and synthetic biology. Background Art

[0002] Licoricein is a natural flavonoid found primarily in the genus Licorice, known for its diverse biological properties, including anti-inflammatory, antioxidant, antitumor, and antimicrobial activities. It is also a precursor to several important flavonols and isoflavones, such as fisetin, daidzein, and glabridin. These properties make licoricein a compound with considerable potential for pharmaceutical, nutraceutical, and synthetic biology applications.

[0003] Licoricein is usually extracted from licorice plants, however, the process is limited by the limited availability of raw materials, low yields and complex purification processes. The traditional chemical method for preparing licoricein has the disadvantages of difficult preparation, difficult separation and purification, and low selectivity for the target compound. Compared with traditional extraction methods, the rapid development of synthetic biology and metabolic engineering can provide a feasible solution for the production of plant secondary metabolites, reducing the impact on the environment.

[0004] Based on the naringenin production strain, the introduction of the chalcone reductase gene CHR from soybean has been shown to achieve de novo synthesis of glycyrrhizin. At the same time, by regulating the regulatory network of Saccharomyces cerevisiae, the impact of natural products on the growth of the host can be well alleviated. In addition, increasing the supply of endogenous NADPH in the cell may further improve the proportion of glycyrrhizin synthesis, and increasing the supply of intracellular malonyl-CoA may further increase the yield of glycyrrhizin. Summary of the invention

[0005] The present invention provides a recombinant Saccharomyces cerevisiae chassis cell, with promoter P HXT1 Regulate GAL80 expression, and / or use the promoter tP HXT7 Regulate GAL4 gene expression to better decouple production and growth.

[0006] In one embodiment, the Saccharomyces cerevisiae chassis cell has (a) and / or (b) promoter replaced on the genome of the starting strain:

[0007] (a) Promoter P that regulates GAL80 expression GAL80 Replaced by promoter P HXT1 .

[0008] (b) Promoter P that regulates GAL4 gene expression GAL4 Replaced by truncated promoter tP HXT7 ; The truncated P HXT7 Promoter tPHXT7 The nucleotide sequence is shown in SEQ ID NO.4.

[0009] In one embodiment, the promoter ΔP in the genome of the recombinant Saccharomyces cerevisiae chassis cell GAL80 Replaced by promoter P HXT1 .

[0010] In one embodiment, the promoter ΔP in the genome of the recombinant Saccharomyces cerevisiae chassis cell GAL4 Replaced by truncated promoter tP HXT7 .

[0011] In one embodiment, the promoter ΔP in the genome of the recombinant Saccharomyces cerevisiae chassis cell GAL80 Replaced by promoter P HXT1 , and the promoter ΔP GAL4 Replaced by truncated promoter tP HXT7 .

[0012] In one embodiment, the P HXT1 The promoter nucleotide sequence is shown in SEQ ID NO.2.

[0013] In one embodiment, the P HXT7 The promoter nucleotide sequence is shown in SEQ ID NO.3; the truncated P HXT7 Promoter tP HXT7 The nucleotide sequence is shown in SEQ ID NO.4.

[0014] In one embodiment, the chassis cells express a bifunctional lycopene cyclase / phytoene synthase crtYB, a β-carotene biosynthesis protein crtE, and a geranylgeranyl diphosphate synthase crtI; the amino acid sequence of the functional lycopene cyclase / phytoene synthase is shown in UniProtKB: Q7Z859.1, the amino acid sequence of the β-carotene biosynthesis protein crtE is shown in Genbank: AAX20903.1, and the amino acid sequence of the geranylgeranyl diphosphate synthase crtI is shown in Genbank: AAD16018.1.

[0015] In one embodiment, the expression of tHMG1 is driven by promoter PGAL2, the expression of crtI is driven by promoter PGAL1, the expression of crtE is driven by promoter PGAL10, and the expression of crtYB is driven by promoter PGAL7.

[0016] The invention provides a recombinant cerevisiae yeast capable of producing glycyrrhizin. On the basis of a starting strain, a glycyrrhizin synthesis pathway is introduced, NADPH supply is strengthened, malonyl-CoA supply is strengthened, and de novo synthesis of glycyrrhizin is successfully achieved.

[0017] In one embodiment, the starting strain includes but is not limited to Saccharomyces cerevisiae CEN.PK2-1D or Saccharomyces cerevisiae HB52.

[0018] In one embodiment, the starting strain integrates the expression cassette P at the int1 site of Saccharomyces cerevisiae HB52. HXT1 -GAL80-tP HXT7 -KlGAL4, the Saccharomyces cerevisiae HB52 is disclosed in the paper "Synergetic Engineering of Multiple Pathways for De Novo (2S)-Naringenin Biosynthesis in Saccharomyces cerevisiae".

[0019] In one embodiment, the enhanced NADPH supply is overexpressing the gene UTR1 and the gene IDH2, and expressing the gene IDP1.

[0020] In one embodiment, the recombinant Saccharomyces cerevisiae integrates and expresses the chalcone reductase gene GmCHR5 in the genome, and the nucleotide sequence thereof is shown in SEQ ID NO.1.

[0021] In one embodiment, using promoter P GAL10 Promotes expression of the CHR encoding gene.

[0022] In one embodiment, the isocitrate dehydrogenase gene IDP1 is integrated and expressed at the int3 site.

[0023] In one embodiment, the gene UTR1 and gene IDH2 are integrated and expressed at the int4 site.

[0024] In one embodiment, using promoter P GPD To activate the expression of IDH2 encoding gene, promoter P TEF Promote the expression of UTR1 gene.

[0025] In one embodiment, using promoter P GAL1 Promotes the expression of the gene encoding IDP1.

[0026] In one embodiment, the nucleotide sequence of the gene UTR1 is shown as SEQ ID NO.16, the nucleotide sequence of the gene IDH2 is shown as SEQ ID NO.17, and the nucleotide sequence of the gene IDP1 is shown as SEQ ID NO.18.

[0027] In one embodiment, the nucleotide sequence of the KlGAL4 gene is shown as SEQ ID NO.5.

[0028] In one embodiment, the enhancement of malonyl-CoA supply is to knock out one or more genes among ATF1, ATF2, EAT1, and DGA1.

[0029] In one embodiment, the recombinant Saccharomyces cerevisiae has knocked out the genes ATF1, ATF2, EAT1 or DGA1.

[0030] In one embodiment, the recombinant Saccharomyces cerevisiae has knocked out the ATF1 gene and the ATF2 gene.

[0031] In one embodiment, the recombinant Saccharomyces cerevisiae has knocked out the genes ATF1 and EAT1.

[0032] In one embodiment, the recombinant Saccharomyces cerevisiae has knocked out the genes ATF1, ATF2 and EAT1.

[0033] In one embodiment, the nucleotide sequence of gene ATF1 is shown as Gene ID: 854559, the nucleotide sequence of gene ATF2 is shown as Gene ID: 853088, the nucleotide sequence of gene EAT1 is shown as Gene ID: 852898, and the nucleotide sequence of gene DGA1 is shown as Gene ID: 854419.

[0034] In one embodiment, pY26 series vectors or pESC series vectors are used as expression vectors.

[0035] The invention provides a method for producing glycyrrhizin in a fermentation tank, wherein the recombinant saccharomyces cerevisiae is fermented in a medium containing glucose to produce glycyrrhizin.

[0036] In one embodiment, the culture medium uses glucose as the carbon source.

[0037] In one embodiment, the recombinant Saccharomyces cerevisiae is cultured in a culture medium to prepare a seed solution, and then the seed solution is transferred to a fermentation medium for fermentation.

[0038] In one embodiment, the seed liquid culture method is: the recombinant brewer's yeast is cultured in YPD medium at 28-32°C and 200-230rpm for 18-24h, and then inoculated in the same medium at an inoculation amount of 1-3% and cultured for 10-20h.

[0039] In one embodiment, the YPD medium contains 10-30 g / L peptone, 5-15 g / L yeast powder, and 10-30 g / L glucose.

[0040] In one embodiment, the fermentation medium contains 10-20 g / L ammonium sulfate, 8-10 g / L potassium dihydrogen phosphate and 2-5 g / L magnesium sulfate.

[0041] In one embodiment, the organic nitrogen source is fed during the fermentation process and its component is yeast powder with a concentration of 250-300 g / L.

[0042] In one embodiment, glucose is further added during the fermentation process to make the glucose concentration in the fermentation system 1 g / L and the ethanol concentration ≤ 5 g / L.

[0043] The present invention also provides the application of the recombinant cerevisiae yeast or the method in the fields of food, medicine or chemical industry.

[0044] In one embodiment, the application includes but is not limited to the production of products containing liquiritigenin.

[0045] Beneficial effects:

[0046] 1. The present invention uses the engineered yeast CEN.PK2-1D of Saccharomyces cerevisiae as a host, redesigns the galactose induction system in Saccharomyces cerevisiae, and responds to glucose in the culture system through the tHXT promoter, thereby achieving better decoupling of the production and growth stages, thereby improving the adaptability of the heterologous pathway.

[0047] 2. The present invention uses the engineered yeast HB52 of Saccharomyces cerevisiae as the host, introduces an improved galactose induction system, and introduces a chalcone reductase gene to achieve the de novo synthesis of glycyrrhizin, so that the glycyrrhizin yield of the constructed engineered yeast NCL14 after fermentation for 120 hours reaches 213.52 mg / L.

[0048] 3. The present invention increases the synthesis ratio of glycyrrhizin by strengthening the supply of NADPH, so that the molar concentration ratio of glycyrrhizin to naringenin after fermentation is increased from 1.32 to 1.58; further, by strengthening the supply of malonyl-CoA, the yield of glycyrrhizin is increased, and the glycyrrhizin yield at the shake flask level can reach 314.25 mg / L.

[0049] 4. The present invention also optimizes the fermentation process of the engineered yeast Saccharomyces cerevisiae, so that the glycyrrhizin production in the fermenter after 84 hours of horizontal fermentation reaches 867.67 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Schematic diagram of the β-carotene synthesis pathway and the pY26-hBEI plasmid map.

[0051] Figure 2 This is a graph showing the carotene production of the strain after modification of the galactose induction system.

[0052] Figure 3 Schematic diagram of the synthesis pathway and yield of liquiritigenin.

[0053] Figure 4 The diagram shows the production and ratio of licorice radical after NADPH enhancement.

[0054] Figure 5 This is a graph showing the production of liquiritigenin after fortification with malonyl-CoA.

[0055] Figure 6 Production of licorice in NCL51 fermenter. DETAILED DESCRIPTION

[0056] (I) Culture medium

[0057] LB medium: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L. Add 20g / L agar powder to prepare LB solid medium.

[0058] YPD medium: 20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose. Add 20 g / L agar powder to prepare YPD solid medium.

[0059] YNB medium: 20 g / L glucose, 20 mL / L YNB medium (purchased from Shanghai Sangon Biotechnology Co., Ltd.) Add 20 g / L agar powder to prepare YNB solid medium.

[0060] (II) Strains and plasmids

[0061] pY26-GDP-TEF and pESC-URA are commercial plasmids, Saccharomyces cerevisiae CEN.PK2-1D is a commercial yeast cell, and chassis cell HB52 is a published strain disclosed in the paper "Synergetic Engineering of Multiple Pathways for De Novo (2S)-Naringenin Biosynthesis in Saccharomyces cerevisiae".

[0062] (III) Preparation of competent cells of Saccharomyces cerevisiae

[0063] Preparation of Saccharomyces cerevisiae competent cells: Use the Frozen-EZ Yeast Transformation II kit and culture Saccharomyces cerevisiae with 10 mL YPD medium at 30°C to OD 600 =0.8-1.0. The following steps were carried out at room temperature.

[0064] 1. Centrifuge the cells at 3500 rpm for 5 min and remove the supernatant;

[0065] 2. Add 10 mL of EZ1 solution to wash the precipitate, centrifuge the precipitated cells again, and aspirate the supernatant;

[0066] 3. Add 1 mL of EZ2 solution to resuspend the pelleted cells.

[0067] 4. Transformation of Saccharomyces cerevisiae

[0068] 1. Take 50 μL competent cells and mix with 0.2-1 μg DNA (volume less than 5 μL); add 500 μL EZ3 solution and mix thoroughly;

[0069] 2. Incubate at 30℃ for 45min. During the incubation, flick the tube or vortex 2-3 times to mix well.

[0070] 3. Transfer 50-150 μL of the transformation mixture to appropriate auxotrophic plates.

[0071] 4. Incubate the plates at 30°C for 3 days to grow transformants.

[0072] (V) HPLC determination of glycyrrhizin

[0073] Shimadzu high performance liquid chromatography was used for determination. HPLC conditions: chromatographic column: DAISOPAK UG120 250mm×4.6mm column (particle size 5μm); mobile phase A, ultrapure water containing 1‰ formic acid; mobile phase B, methanol containing 1‰ formic acid; mobile phase ratio conditions, 0-10min, 10-60% B, 10-20min, 60-80% B, 20-22min, 80-10% B, 22-25min, 10% B; flow rate: 1mL / min; column temperature: 40℃; injection volume: 10μL; detector wavelength: 290nm.

[0074] (VI) Strain information

[0075] Table 1 Strains involved in the present invention

[0076]

[0077]

[0078] Example 1 Modification of the endogenous galactose induction system of Saccharomyces cerevisiae

[0079] Using Saccharomyces cerevisiae CEN.PK2-1D as the host, in order to explore how to better decouple the growth and production processes. The promoters of the activator GAL4 and the repressor GAL80 of the galactose regulatory network were replaced respectively. The specific construction process is as follows: using the Saccharomyces cerevisiae genome as a template, the downstream homology arm pGAL4down of the GAL4 promoter was extended with the primer pair pGAL4down-F / pGAL4down-R. Similarly, the primer pairs pGAL4up-F / pGAL4up-R, pGAL80down-F / pGAL80down-R, pGAL80up-F / pGAL80up-R were used to amplify the homology arms pGAL4up, pGAL80down, and pGAL80up, and the primer pairs pHXT7-F / tHXT7p-R, tpHXT7-F / tHXT7p-R, and pHXT1-F / HXT1p-R were used to extend the promoter P HXT7 (shown in SEQ ID NO.3), tP HXT7 (shown in SEQ ID NO.4), P HXT1 (shown in SEQ ID NO.2) fragment, and the homologous fragments PGAL80-PHXT1, PGAL4-PHXT7, and PGAL4-tPHXT7 required for promoter replacement were constructed by fusion PCR. The primer pairs g-pGAL4-F / g-pGAL4-R and g-pGAL80-F / g-pGAL80-R were used to construct CRISPR plasmids targeting the GAL4 promoter and the GAL80 promoter, respectively. The GAL4 promoter and the GAL80 promoter of CEN.PK 2-1D were replaced singly or in combination, and strains Jn01 to Jn08 with different regulatory modes (GAL4 gene and / or GAL80 gene regulated by different promoters) were constructed, and the strain information is shown in Table 1.

[0080] Table 2 Primers used to construct the modified galactose inducible system

[0081]

[0082]

[0083] Example 2 Construction of plasmid pY26-hBEI

[0084] In order to characterize the expression pattern of the series of strains constructed in Example 1, a plasmid pY26-hBEI containing genes of the β-carotene synthesis pathway was constructed. The construction process was as follows: using the pY26TFE-GPD plasmid as a template, the vector backbone was extended using primer pair adh1t-F / cyc1t-F, the primer pairs crtB-F / crtB-R, crtE-F / crtE-R, crtI-F / crtI-R and tHMG1-F / tHMG1-R were used to amplify the fragments crtYB (shown in SEQ ID NO.9), crtE (shown in SEQ ID NO.10), crtI (shown in SEQ ID NO.11) and tHMG1 (shown in SEQ ID NO.12), the primer pairs ter22-F / ter22-R, gal7p-R / gal7p-F, pGAL2-F / pGAL2-R, gal10 / 1-F / gal10 / 1-R were used to amplify the promoter P Gal1,10 (shown in SEQ ID NO.13), P Gal7 (shown in SEQ ID NO.14) and the terminator fragment, and the above fragments were homologously connected using the Gibson assembly method to construct plasmid pY26-hBEI. The plasmid map is shown in Figure 1 shown.

[0085] Table 3 Primers used to construct pY26-hBEI

[0086] Primer Sequence (5'-3') adh1t-F TCGCTTTCAGGCAAAACTAAAGCTCTTAATTAACAATTCTTCGCCAGAG crtB-F ATGACTGCTTTGGCTTACTACCAAATT crtB-R TTATTGACCTTCCCAACCAGACATAACAAC crtE-F ATGGCTTATACCGCAATGGCAG crtE-R TTAGTTTTGCCTGAAAGCGATGTAATCG crtI-F ATGTCTGATCAGAAGAAGCACATTGTC crtI-R TTATATCCTAATATCGTTAGAGTTCTGTCCTTGGA cyc1t-F CTGGTTGGGAAGGTCAATAACTCGAGTCATGTAATTAGTTATGTCACGC gal7p-R TAGTAAGCCAAAGCAGTCATTTTTGAGGGAATATTCAACTGTTTTTTTTTATCATGTTG gal7p-F GGTATAGCATGAGGTCGCTCTTTGCCAGCTTACTATCCTTCTTGAAAATATG pGAL2-F GAACAAAAGCTGGAGCTCGGCAGAAGGCACATCTATTACATTTAC pGAL2-R TATGAAAGAATTATTTTTTTTATTATGTTAATCTTGTGTTTAC gal10 / 1-F GCCATTGCGGTATAAGCCATGAATTCGAATTTTCAAAAATTCTTACTTTTTTTTTG gal10 / 1-R TGCTTCTTCTGATCAGACATTTTTTTCTCCTTGACGTTAAAGTATAGAGG ter22-F CTTCTAAATTGTTGTCTTAAAATGTCAAAAGCCTCAAGGTGCC ter22-R GGAACAAAAGCTGGAGCTCGATAGGTTGGCTTCCATGTTGGCTAT tHMG1-F AAAAAAATAATTCTTTCATAATGGCTGCAGACCAATTGGTGAAAACTGAAGTCACCA tHMG1-R CAACATGGAAGCCAACCTATTTAGGATTTAATGCAGGTGACGGACC

[0087] Example 3 Characterization of the modified galactose inducible system

[0088] The plasmid pY26-hBEI constructed in Example 2 was transformed into the recombinant engineered bacteria Jn01 to Jn08 constructed in Example 1 using the yeast transformation kit Frozen-EZ Yeast Transformation II, spread on YNB plates and grow for 2-3 days, pick colonies and copy them on new YNB plates, culture them on the copy plates for 4-6 days, and observe the color changes of the colonies on the plates. Strain Jn07 showed better decoupling.

[0089] A single colony on the plate was picked and inoculated into YNB liquid medium for 24 h as seed solution, and then inoculated into fresh YNB medium at a 1% inoculum, cultured at 30°C for 5 days, and the β-carotene yield was determined by HPLC. Figure 2 As shown, strain Jn01 does not produce β-carotene, and the production of strains Jn02 to Jn08 are 2.11 mg / L, 0.05 mg / L, 0.44 mg / L, 3.00 mg / L, 0.31 mg / L, 9.28 mg / L, and 0.77 mg / L, respectively.

[0090] Example 4 Construction of Licorice Synthesis Strain

[0091] HB52 (published in the paper "Synergetic Engineering of Multiple Pathways for DeNovo(2S)-Naringenin Biosynthesis in Saccharomyces cerevisiae") was used as the host strain. HXT1 The GAL80 gene controlled by tP HXT7 Control K1GAL4 gene to construct expression cassette P HXT1 -GAL80-tP HXT7 -K1GAL4 was integrated into the int1 site of strain HB52 (shown in SEQ ID NO.6) to construct strain NHB52, and the expression cassette P of the GmCHR5 gene was inserted into the GAL10 -GmCHR5 was integrated into the Ty3 site of the genome of strain NHB52 (SEQ ID NO.7) to construct strain NCL14. The construction method of the expression cassette is referred to Example 1. Pick a single colony and transfer it into 5 mL of the corresponding YNB medium. After 24 hours, transfer it into 25 mL of YPD medium at a 1% inoculation amount. After culturing at 30°C for 120 hours, take 500 μL of fermentation broth, add 500 μL of methanol, centrifuge the resuspension at 12000 rpm for 10 minutes, filter through a 0.22 μm organic filter membrane, and perform HPLC analysis. The results showed that NHB52 can produce 724.38 mg / L naringenin, and strain NCL14 can produce 213.52 mg / L licorice. Figure 3 shown.

[0092] Table 4 Primers used to construct liquiritigenin synthesis strains

[0093]

[0094] Example 5 Strengthening NADPH supply to improve the synthesis ratio of licorice

[0095] Using the Saccharomyces cerevisiae CEN.PK2-1D genome as a template, the primer pairs INT4-UIDH2-F / INT4DOWN-R1 and INT4-UIDH2-R / INT4UP-F1 were used to amplify the upstream and downstream homology arm fragments of int4 (site sequence such as SEQ ID NO.8), and the primer pairs INT3-IDP1-F / INT3DOWN-R1 and INT3-IDP1-R / INT3UP-F1 were used to amplify the upstream and downstream homology arm fragments of int3; the primers UIDH2-F / UIDH2-FR were used to amplify the UIDH2 fragment (containing T ADH1-UTR1-P TEF -P GPD -IDH2-T CYC， The gene UTR1 sequence is shown in SEQ ID NO.16, and the gene IDH2 sequence is shown in SEQ ID NO.17). Primers IDP1-F / IDP1-R are used to amplify the IDP1 fragment shown in SEQ ID NO.18; the upstream and downstream homology arm fragments of int4 are fused with the UIDH2 fragment by the fusion PCR method, and similarly, the upstream and downstream homology arm fragments of int3 are fused with IDP1.

[0096] The pRS426 vector carrying the cas9 fragment was used as a template, and the primers g-int4-F / g-int4-R and g-int3-F / g-int3-R were used to amplify the linearized vector pRS426, and the obtained vector was transformed into Escherichia coli JM109 and sequenced to obtain the correct recombinant vectors pRS426-int3 and pRS426-int4. About 1 μg of the integration fragment and about 500 ng of the corresponding pRS426-int3 series plasmids were transformed into the cerevisiae NCL14 constructed in Example 4 using the yeast transformation kit Frozen-EZ Yeast Transformation II, and the plasmid was eliminated by continuous passage to obtain strain NCL41. The expression cassette UIDH fragment was integrated into the int4 site of the genome of NCL41 using the same method to obtain strain NCL45.

[0097] Pick a single colony and transfer it to 5mL of the corresponding YNB medium. After 24h, transfer it to 25mL YPD medium at a 1% inoculation amount. After culturing at 30℃ for 120h, take 500μL of fermentation broth, add 500μL of methanol, centrifuge the resuspension at 12000×g for 10min, filter through a 0.22μm organic filter membrane, and perform HPLC analysis. The results showed that the content of glycyrrhizin in the fermentation broth of strain NCL41 was 218.16mg / L, and the molar concentration ratio of glycyrrhizin to naringenin was 1.32; the content of glycyrrhizin in the fermentation broth of strain NCL45 was 238.91, and the molar concentration ratio of glycyrrhizin to naringenin was 1.58. Figure 4 shown.

[0098] Table 5 Primers used to enhance NADPH

[0099]

[0100] Example 6 Strengthening the synthesis of malonyl-CoA to increase the yield of liquiritigenin

[0101] Using the genome of Saccharomyces cerevisiae CEN.PK2-1D as a template, primer pairs ATF1DOWN-R1 / ATF1DOWN-F, ATF1UP-F1 / ATF1UP-R, ATF2DOWN-R1 / ATF2DOWN-F, ATF2UP-F1 / ATF2UP-R, EAT1DOWN-R1 / EAT1DOWN-F, EAT1UP-F1 / EAT1UP-R, DGA1DOWN-R1 / DGA1DOWN-F, and DGA1UP-F1 / DGA1UP-R were used to amplify ATF1 (Gene ID: 854559), ATF2 (Gene ID: 853088), EAT1 (Gene ID: 852898), DGA1 (Gene ID: 852899), and DGA1 (Gene ID: 852891). ID: 854419), and the upstream and downstream homology arm fragments of ATF1, ATF2, EAT1, and DGA1 were fused using the fusion PCR method.

[0102] Using the pRS426 vector carrying the cas9 fragment as a template, the linearized vector pRS426 was amplified using primers g-ATF1-F / g-ATF1-R, g-ATF2-F / g-ATF2-R, g-EAT1-F / g-EAT1-R, and g-DGA1-F / g-DGA1-R. The obtained vector was transformed into Escherichia coli JM109 and sequenced for verification to obtain the correct recombinant vectors pRS426-ATF1, pRS426-ATF2, pRS426-EAT1 and pRS426-DGA1. About 1 μg of the integration fragment and about 500 ng of pRS426-ATF1 or pRS426-ATF2 or pRS426-EAT1 or pRS426-DGA1 plasmid were transformed into the Saccharomyces cerevisiae engineering NCL45 constructed in Example 5 using the yeast transformation kit Frozen-EZ Yeast TransformationII, and the plasmid was eliminated by continuous passage to obtain strains NCL46 to strain NCL51, respectively.

[0103] Single colonies of strains NCL46 to NCL51 were picked and transferred into 5 mL of the corresponding YNB medium. After 24 hours, they were transferred into 25 mL of YPD medium at a 1% inoculum. After culturing at 30°C for 120 hours, 500 μL of fermentation broth was taken, 500 μL of methanol was added, and the resuspension was centrifuged at 12000×g for 10 minutes, filtered through a 0.22 μm organic filter membrane, and analyzed by HPLC. The results showed that strain NCL51 could produce 314.25 mg / L of glycyrrhizin, such as Figure 5 shown.

[0104] Table 6 Primers used to enhance malonyl-CoA

[0105]

[0106]

[0107] Example 7 Fermentation tank fermentation of licorice-producing strains

[0108] The strain NCL51 constructed in Example 6 was fermented in a 5-L fermentor using a working volume of 2.5 L and inoculated with a secondary seed solution. First, a single colony was inoculated into 5 mL of YPD and incubated at 30°C and 220 rpm for 24 hours. This culture was then inoculated into a 250 mL shake flask containing 50 mL of YPD at a rate of 1% (v / v) and cultured to an optical density (OD 600 ) reaches 8-10. Subsequently, the culture was inoculated into the fermenter at 10% (v / v) so that the OD after inoculation was 0.8-1. The stirring speed was maintained at 300-1200rpm to keep the dissolved oxygen level at 30% throughout the fermentation process. The pH value of the fermentation broth was maintained at 5.5 using 50% NH3·H2O. The carbon source (glucose at a concentration of 600g / L) was added at a flow rate of 12mL / h, and 100mL of yeast powder solution at a concentration of 300g / L was added every 8h. Samples were taken regularly to monitor the residual glucose and ethanol levels to ensure that the glucose concentration was ≤1g / L and the ethanol concentration was ≤5g / L. Within 120h of co-fermentation, the fermentation broth was taken regularly for testing during the fermentation period, methanol was added to the sampled fermentation broth, the resuspension was centrifuged at 12000×g for 10min, filtered through a 0.22μm organic filter membrane, and analyzed by HPLC. Figure 6 As shown, strain NCL51 can produce 867.67 mg / L glycyrrhizin in a 5L fermenter for 84 h.

[0109] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A Saccharomyces cerevisiae chassis cell, characterized in that Based on the starting strain, it has the characteristics of (a) and / or (b): (a) From the promoter P HXT1 Regulates GAL80 expression; (b) by promoter tP HXT7 Regulates GAL4 gene expression; the truncated P HXT7 Promoter tP HXT7 The nucleotide sequence is shown in SEQ ID NO.4; The starting strains include but are not limited to Saccharomyces cerevisiae CEN.PK2-1D or Saccharomyces cerevisiae HB52.

2. Use of the Saccharomyces cerevisiae chassis cells according to claim 1 in constructing genetically engineered bacteria.

3. The use according to claim 2, characterized in that: The method comprises expressing a bifunctional lycopene cyclase / phytoene synthase crtYB, a β-carotene biosynthesis protein crtE and a geranylgeranyl diphosphate synthase crtI in the Saccharomyces cerevisiae chassis cell.

4. A recombinant Saccharomyces cerevisiae producing licorice root, characterized in that: The genes related to the liquiritigenin synthesis pathway are expressed, and the supply of NADPH and / or malonyl-CoA is strengthened; the genes related to the liquiritigenin synthesis pathway include the chalcone reductase gene GmCHR5.

5. The recombinant Saccharomyces cerevisiae according to claim 4, characterized in that The genes related to the liquiritigenin synthesis pathway are expressed in the chassis cells of claim 1.

6. The recombinant Saccharomyces cerevisiae according to claim 4 or 5, characterized in that The transcriptional activator K1GAL4 from Kluyveromyces lactis was also expressed.

7. The recombinant Saccharomyces cerevisiae according to claim 6, characterized in that With promoter P HXT1 Regulate GAL80 expression and use the promoter tP HXT7 Regulates the expression of KlGAL4.

8. The recombinant Saccharomyces cerevisiae according to any one of claims 4 to 7, characterized in that The enhanced NADPH and / or malonyl-CoA supply comprises (1) and / or (2): (1) Expression of IDP1 gene, IDH2 gene and / or UTR1 gene; (2) One or more genes among ATF1, ATF2, EAT1, and DGA1 were knocked out.

9. A method for producing glycyrrhizin in a fermentation tank, characterized in that: The recombinant Saccharomyces cerevisiae described in any one of claims 4 to 8 is fermented in a culture medium with glucose as a carbon source to produce glycyrrhizin.

10. The method according to claim 9, characterized in that The recombinant brewer's yeast is cultured in a culture medium to prepare a seed solution, and then the seed solution is transferred to a fermentation medium for fermentation.

11. The method according to claim 9 or 10, characterized in that: During the fermentation, an organic nitrogen source and / or glucose was fed.

12. Use of the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 8 or the method according to any one of claims 9 to 11 in producing a product containing glycyrrhizin.

Images