Genetically engineered bacteria and their application in the biological preparation of xylitol

Abstract

The present invention belongs to the field of biotechnology, and particularly relates to a genetically engineered bacterium and its application in the biological preparation of xylitol. The present invention utilizes several expression control techniques such as the theophylline switch, Cre / LoxP etc., so that the genetically engineered bacterium can control its expression product to be arabinose-1-dehydrogenase first and then xylose reductase by whether to add theophylline. After consuming arabinose through arabinose-1-dehydrogenase, xylose reductase is then used to convert xylose into xylitol, preventing the generation of by-products during the preparation of xylitol from hemicellulose hydrolysate.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a genetically engineered bacterium and its application in the biological preparation of xylitol. Background Art

[0002] Xylitol (molecular formula C5H 12 O5) is a sweetener with a sweetness equivalent to sucrose and a calorie content equivalent to glucose. In 2004, it was rated by the US Department of Energy as one of the 12 most promising biomass-based chemicals. Currently, xylitol is commonly prepared by chemical methods in industry. First, pure xylose is separated from hemicellulose hydrolysate through a complex separation process, and then xylose is reduced to xylitol through high-pressure hydrogenation. Due to the relatively complex production process and high cost of the chemical method for preparing xylitol, the price of xylitol has remained high for a long time. Compared with the chemical method, the biological method for producing xylitol has some advantages: mild catalytic conditions, safe operation, low equipment energy consumption, etc. Therefore, it has received attention from the industry in recent years and is expected to become an alternative process to the chemical method. The biological preparation of xylitol can directly convert xylose in hemicellulose hydrolysate into xylitol using biological enzymes or microbial cells, and then xylitol products can be obtained through separation.

[0003] In the existing biological preparation process of xylitol, xylose reductase is the key enzyme. Wild-type xylose reductase usually has poor specificity. When using hemicellulose hydrolysate for biological preparation, while xylose reductase catalyzes the reduction of xylose to xylitol, it will also reduce arabinose in hemicellulose hydrolysate to arabinitol. The structure and physical and chemical properties of arabinitol are very similar to those of xylitol, resulting in the by-product arabinitol affecting the separation and purification of xylitol. In recent years, many studies have tried to improve the specificity of xylose reductase by means of exploring novel xylose reductases and molecular modification of xylose reductase. Although certain results have been achieved, the catalytic activity of xylose reductase towards arabinose still cannot be completely eliminated.

[0004] As a renewable resource with rich reserves in nature, hemicellulose is widely present in agricultural and forestry waste (such as corncobs, sugarcane bagasse, etc.). Xylose in its hydrolysate is an ideal raw material for the microbial fermentation preparation of xylitol. However, there is also a certain amount of arabinose in hemicellulose hydrolysate, and it is difficult to eliminate the by-product arabinitol during the preparation of xylitol. Summary of the Invention

[0005] Aiming at the problem of by-products in the process of preparing xylitol from hemicellulose hydrolysate in the prior art, the present invention provides a genetically engineered bacterium and its application in the biological preparation of xylitol. The specific technical solutions are as follows:

[0006] In a first aspect, the present invention provides a genetically engineered bacterium, comprising a host cell and a functional gene inserted into the host cell, wherein the functional gene comprises: Cre / LoxP system, a theophylline switch gene, and a target gene expression element;

[0007] The target gene expression element comprises a promoter, a xylose reductase gene, and an arabinose-1-dehydrogenase gene; the promoter has the ability to initiate the transcription of the arabinose-1-dehydrogenase gene and the xylose reductase gene; the arabinose-1-dehydrogenase gene is linked downstream of the promoter; the xylose reductase gene is linked upstream of the promoter and the start codon end is close to the promoter;

[0008] The Cre / LoxP system has the function of flipping the sequence to be edited; the sequence to be edited is the promoter in the target gene expression element; the theophylline switch gene is induced by theophylline to regulate the expression of the Cre recombinase gene.

[0009] The present application provides a genetically engineered bacterium that can catalyze substrates containing arabinose and xylose to produce xylitol without producing arabinitol. In the genetically engineered bacterium, the xylose reductase (XR) gene and the arabinose-1-dehydrogenase (araDH) gene are regulated by the same promoter for expression. The arabinose-1-dehydrogenase gene is linked downstream of the promoter, and the xylose reductase gene is linked upstream of the promoter and the start codon end is close to the promoter. By flipping the promoter on the genome, the promoter can regulate the expression of the two enzyme genes.

[0010] The present application uses the Cre / LoxP system to achieve flipping of the promoter. In the Cre / LoxP system, the Cre recombinase can specifically bind to the LoxP site to achieve flipping of the sequence to be edited between the LoxP sites. In the present application, the sequence to be edited is the promoter. Before the Cre recombinase flips the promoter gene, the genetically engineered bacterium expresses the arabinose-1-dehydrogenase gene downstream of the promoter. After the Cre recombinase flips the promoter gene, the genetically engineered bacterium expresses the xylose reductase gene upstream of the promoter.

[0011] In the present application, in order to control the expression of the two enzyme genes, the expression of the Cre recombinase is selected to be controlled. Specifically, a theophylline switch gene is added to the Cre recombinase gene. The theophylline switch is a theophylline-inducible gene switch that can control the expression of the inserted gene. Before adding theophylline induction, the Cre recombinase gene is not expressed. Adding theophylline induction can cause the Cre recombinase gene to be expressed.

[0012] Therefore, in the present application, the finally constructed genetically engineered bacterium has an initial expression product of arabinose-1-dehydrogenase. After being induced by theophylline, the Cre recombinase gene is expressed, and the Cre recombinase binds to the LoxP site and flips the promoter, and the expression product of the genetically engineered bacterium becomes xylose reductase.

[0013] Further, the promoter is P J23119 or P lac .

[0014] Further, the nucleotide sequence of the arabinose-1-dehydrogenase gene is as shown in SEQ ID NO.1.

[0015] Further, the nucleotide sequence of the xylose reductase gene is as shown in SEQ ID NO.2.

[0016] In the present application, combinations of the xylose reductase gene, the arabinose-1-dehydrogenase gene, and the promoter were screened, and two promoters with good regulatory ability for both the xylose reductase gene and the arabinose-1-dehydrogenase gene were obtained: P J23119 or P lac , and the expressed xylose reductase and arabinose-1-dehydrogenase both retained good enzyme activity.

[0017] Further, in the Cre / LoxP system, the nucleotide sequence of the Cre recombinase gene is as shown in SEQ ID NO.7.

[0018] Further, in the Cre / LoxP system, LoxP the nucleotide sequences of the sites are as shown in SEQ ID NO.8 and SEQ ID NO.9.

[0019] In the present application, the Cre / LoxP system is used to achieve the flipping of the promoter. Specifically, a LoxP -promoter- LoxP structure needs to be formed. In this structure, the nucleotide sequence of the previous LoxP site is as shown in SEQ ID NO.8, and the nucleotide sequence of the latter LoxP site is as shown in SEQ ID NO.9, so that the Cre recombinase can correctly bind to the two LoxP sites and flip the promoter between the two LoxP sites.

[0020] Further, the nucleotide sequence of the theophylline switch gene is one of the sequences shown in SEQ ID NOs. 3 to 6.

[0021] Furthermore, in the genetically engineered bacterium, the combination of Int2 and P lac is excluded. Any combination of the theophylline switch and the above promoter can achieve the expression control of the promoter induced by theophylline.

[0022] Furthermore, in the host cell genome, the theophylline switch gene is located downstream of the start codon ATG of the Cre recombinase gene.

[0023] In this application, the theophylline switch gene is placed downstream of the start codon ATG of the Cre recombinase gene, enabling strict control of the expression of the Cre recombinase gene.

[0024] Furthermore, ptsG the gene is knocked out in the host cell genome.

[0025] In this application, knocking out ptsG the gene can slow down the CCR effect of the host cell and improve the co-metabolism efficiency of glucose and other sugars in the host cell in vivo.

[0026] Furthermore, the Cre / LoxP system, the theophylline switch gene, and the target gene expression element are expressed in the host cell in the form of genomic integration or recombinant plasmid.

[0027] Furthermore, the theophylline switch and the Cre recombinase are expressed in the host cell in the form of genomic integration; the LoxP site and the target gene expression element are expressed in the host cell in the form of recombinant plasmid.

[0028] Furthermore, the Cre recombinase gene and the theophylline switch gene are inserted into the nuclease dns site in the host cell genome or the intergenic non-coding region.

[0029] Furthermore, the host cell is Vibrio natriegens or Escherichia coli.

[0030] In a second aspect, the present invention provides a method for preparing xylitol, characterized by comprising:

[0031] (1) Using the hemicellulose hydrolysate as a raw material, performing fermentation culture in a fermentation medium inoculated with the above genetically engineered bacterium until there is no arabinose residue in the fermentation broth;

[0032] (2) After adding theophylline to the reaction solution, continuing the fermentation culture to obtain a fermentation product containing xylitol.

[0033] In this application, the above-mentioned genetically engineered bacteria are used to catalyze the production of xylitol from hemicellulose hydrolysate. First, in the absence of theophylline induction, the genetically engineered bacteria express arabinose-1-dehydrogenase, which converts arabinose in the hemicellulose hydrolysate into arabinonic acid. After the arabinose conversion is complete, theophylline is added to the reaction solution to induce the activation of the theophylline switch, enabling the smooth expression of Cre recombinase. After the expression of Cre recombinase, it binds specifically to LoxP the site, and flips the promoter between LoxP sites, causing the genetically engineered bacteria to express xylose reductase. Xylose reductase converts xylose in the hemicellulose reaction solution into xylitol, obtaining a fermentation product containing xylitol and arabinonic acid. After further product separation, pure xylitol is obtained, and no by-product arabinitol is produced during this process.

[0034] Furthermore, the hemicellulose hydrolysate is obtained by hydrolyzing biomass rich in hemicellulose; the biomass rich in hemicellulose is corn cob, papermaking short fiber, bagasse, straw, rice husk, etc.; the hemicellulose hydrolysate contains at least L-arabinose, glucose, and xylose.

[0035] Furthermore, in the hemicellulose hydrolysate, the mass ratio of arabinose, glucose, and xylose is 2-5:5-10:20-25.

[0036] Furthermore, the amount of theophylline added is 5-10 mM.

[0037] Furthermore, the reaction temperature is 25°C-35°C.

[0038] Furthermore, based on the initial fermentation volume, the inoculation amount of the genetically engineered bacteria is 1-15%.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The present invention provides a genetically engineered bacterium that can produce xylitol using hemicellulose hydrolysate as a raw material. By using several expression control technologies such as the theophylline switch and Cre / LoxP etc., the genetically engineered bacteria can control their expression products to be arabinose-1-dehydrogenase first and then xylose reductase by whether to add theophylline. After consuming arabinose through arabinose-1-dehydrogenase, xylose reductase is then used to convert xylose into xylitol, preventing the generation of by-products during the preparation of xylitol from hemicellulose hydrolysate. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1Schematic diagrams of different expression regulation tools in the genetically engineered bacteria constructed in this application; among them, A is a schematic diagram of the positions of the theophylline switch gene and the Cre recombinase gene in the host cell genome, and B is the relative position and direction schematic diagram of the target gene expression element and the loxP site in the host cell plasmid before and after theophylline regulation.

[0042] Figure 2 It is a curve graph showing the changes of substrate and product components during the preparation of xylitol by strain S3 using hemicellulose hydrolysate as a raw material. Detailed implementation manners

[0043] To enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and are only a part of the embodiments of the present invention, rather than all of the embodiments.

[0044] All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0045] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the art and can be obtained through commercial channels. The experimental methods without detailed conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers.

[0046] Detection of xylitol, glucose, arabinose, arabitol, and xylose: Determined by high-performance liquid chromatography, the mobile phase is ultrapure water, Agilent Hi-Plex Ca chromatographic column (7.7 mm×300 mm), column temperature 85 °C; flow rate is 0.6 mL / min.

[0047] In the following embodiments, the method for measuring the activity of xylose reductase: Measured with a 1 mL reaction system, the system includes: 100 μL of 1 M xylose mother liquor (final concentration 100 mM), 50 μL of 0.4 M NADPH mother liquor (final concentration 20 mM), 750 μL of PBS buffer, and 100 μL of cell lysate. After preheating the reaction solution and the cell lysate in a metal bath at 30 °C for 10 minutes, the two are quickly mixed, and the change in absorbance at 340 nm is monitored with a spectrophotometer. Definition of enzyme activity unit: Under standard reaction conditions, 1 μM NADP is generated per minute +The amount of enzyme required. The calculation formula for the activity of xylose reductase: Enzyme activity of enzyme solution (U / mL) = (△A / min) × (1 / ɛ) × (1 / d) × (Vt / Vs) × X, where △A / min represents the change value of absorbance per minute; ɛ represents the molar extinction coefficient, which is 6.402 mL / (μmol*cm) here; d represents the optical path of the cuvette, which is 1 cm here; Vt represents the total reaction volume, which is 1000 μL here; Vs represents the volume of the cell lysate, which is 100 μL here; X represents the dilution factor.

[0048] In the following examples, the determination of the activity of arabinose-1-dehydrogenase: The 1 mL reaction system includes: 100 μL of 1 M L-arabinose mother liquor (final concentration 100 mM), 50 μL of 0.4 M NADP + mother liquor (final concentration 20 mM), 750 μL of PBS buffer, and 100 μL of cell lysate. After preheating the reaction solution and the cell lysate in a metal bath at 30 °C for 10 minutes, the two are quickly mixed, and the change in absorbance at 340 nm is monitored by a spectrophotometer. Definition of enzyme activity unit: Under standard reaction conditions, the amount of enzyme required to generate 1 μM NADPH per minute. The calculation formula for AraDH enzyme activity: Enzyme activity of enzyme solution (U / mL) = (△A / min) × (1 / ɛ) × (1 / d) × (Vt / Vs) × X, where △A / min represents the change value of absorbance per minute; ɛ represents the molar extinction coefficient, which is 6.402 mL / (μmol*cm) here; d represents the optical path of the cuvette, which is 1 cm here; Vt represents the total reaction volume, which is 1000 μL here; Vs represents the volume of the cell lysate, which is 100 μL here; X represents the dilution factor.

[0049] In the following examples, the working concentration of kanamycin (kan) for the culture of Vibrio natriegens is 200 μg / mL; the working concentration of kanamycin (kan) for the culture of Escherichia coli is 50 μg / mL.

[0050] In the following examples, a mixed solution containing 20 - 25 g / L of xylose, 5 - 10 g / L of glucose, and 2 - 5 g / L of arabinose is prepared as the hemicellulose hydrolysate for fermentation.

[0051] In the genetically engineered bacteria constructed in the following examples, the positions of the respective functional genes are as Figure 1 shown in A and B.

[0052] The nucleotide sequence of the arabinose-1-dehydrogenase gene is shown in SEQ ID NO.1; the nucleotide sequence of the xylose reductase gene is shown in SEQ ID NO.2; the nucleotide sequences of the theophylline switch genes are shown in SEQ ID NOs.3-6; the nucleotide sequence of the Cre recombinase gene is shown in SEQ ID NO.7; LoxP The nucleotide sequences of the LoxP locus are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0053] SEQ ID NO.1:

[0054] ATGAGCGATCAGGTGAGCCTGGGCGTTGTTGGTATTGGTAAAATTGCACGTGATCAGCATCTGCCGGCCATTGATGCAGAACCGGGTTTTAAACTGACCGCATGTGCAAGCCGTCATGCAGAAGTGACCGGTGTTCGTAATTATCGTGATCTGCGTGCCCTGCTGGCAGCCGAGCGTGAGCTGGACGCAGTGAGCTTATGTGCACCGCCGCAGGTGCGTTATGCACAGGCAAGAGCCGCACTGGAAGCAGGTAAACATGTGATGCTGGAAAAACCGCCGGGCGCAACCCTGGGTGAAGTTGCAGTTCTGGAAGCCCTGGCACGCGAACGTGGTTTAACCCTGTTTGCCACCTGGCATAGCCGTTGCGCCAGTGCAGTGGAACCGGCAAGAGAATGGCTGGCCACCCGTGCAATTCGTGCCGTTCAGGTTCGCTGGAAAGAAGATGTGCGCCGTTGGCATCCGGGCCAACAATGGATTTGGGAACCGGGCGGCCTGGGTGTTTTTGATCCGGGTATTAATGCCCTGAGTATTGTTACCCGTATTCTGCCGCGCGAACTGGTTCTGCGTGAAGCTACCCTGATTGTGCCGAGCGATGTTCAGACCCCGATTGCCGCAGAACTGGATTGTGCAGATACCGATGGTGTTCCGGTTCGCGCAGAATTTGATTGGCGTCATGGCCCGGTTGAACAGTGGGAAATTGCCGTGGATACCGCAGATGGCGTTCTGGCAATTAGCCGCGGTGGCGCACAGTTAAGCATTGCAGGTGAACCGGTGGAACTGGGTCCGGAACGTGAATATCCGGCCCTGTATGCCCATTTTCATGCACTGATTGCACGCGGTGAAAGTGATGTGGATGTTCGTCCGCTGCGTCTGGTGGCAGATGCTTTTCTGTTTGGTCGTCGCGTTCAGACCGATGCCTTTGGTCGT

[0055] SEQ ID NO.2:

[0056] atgagtcagcaaataccctcagtaaaactaagcaacggcgtcgaattcccgttgcttggtttcggcacctggcagagcgcaccgggtgaggtgggtaaggccgtcgaggtggctctgaaggctggttatcgtcacctggatctggcaaaagtttatggtaaccaaaaggagatcgctccggcgatcgcgaactccggtgtggaccgcaaagatattttcatcaccagtaaactgtggaattcgcaacacaagccggaattggttgaagctgcgctggacgacaccctgaaggagctgggcctggaatacctggacttgtacctgattcattggcctgttgcgtttccagccgaaggtgacccgcatagcaacctgtttccgaaagagaacggtgagtgcaaaattgatacctccgtatctatcgtggacacgtggaaagccatgattaagttgctggatactggcaagaccaaagcggttggcgtgtctaacttcagcccggcaatggtggacgccatcaccgaagccaccggtgtgaagccggttgttaatcaaattgaacgtcacccacgtctgctgcaaaaggacttgattaaacaccacaaagagaaaaatattgtggtcacggcatatagcggcttcggcaacaactccgttggcgagccgctcttgttggagcacccgactgtaaagaaaatcgcggaagcgaagggcgcgaatccgggtcaggtcctgatcgcgtggggtatgcatggtggtcatgcaatcattccgaaaagcgttaccccttctcgcattgaaagcaatttcaaagtgattagcctgaccgatgatgaagtggcggaaatcaacaaaatcggcgaggagaaaccggcgcgttttaatcttccgatcctgtactcaccgctgtggccgattaacgtttttgatacgccggaagagcagaaggcgaagtaccaggttaagatccagtaagcggccgc

[0057] SEQ ID NO.3:

[0058] TCCtcaGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA

[0059] SEQ ID NO.4:

[0060] TCCtcgGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA

[0061] SEQ ID NO.5:

[0062] TCCttgGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA

[0063] SEQ ID NO.6:

[0064] TCCtctGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGATACCAGCATCGTCTTGATGCCCTTGGCAGCATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTA

[0065] SEQ ID NO.7:

[0066]

[0067] SEQ ID NO.8:

[0068] ATAACTTCGTATAGCATACATTATACGAAGTTAT

[0069] SEQ ID NO.9:

[0070] ATAACTTCGTATAATGTATGCTATACGAAGTTAT。

[0071] Example 1: Vibrio natriegens dns Integrate Cre recombinase with a theophylline switch at the locus

[0072] Integrate Cre recombinase into the Vibrio natriegens genome using the NT-CRISPR method (DOI: 10.1038 / s42003-022-03150-0) published in the literature. Design sgRNA sequences targeting the nuclease on the Vibrio natriegens genome and construct the plasmid pNT-CRISPR-dns. Transform the plasmid pNT-CRISPR-dns into Vibrio natriegens ATCC△ptsG with the gene knocked out by electrotransformation to obtain the strain ATCC△ptsG / pNT-CRISPR-dns. dns of ptsG the

[0073] pSIBR001-Cre (Addgene219437), pSIBR002-Cre (Addgene219438), pSIBR003-Cre (Addgene219439), pSIBR004-Cre (Addgene219435) (Biotechnol Bioeng. 2024 Mar;121(3):1163-1172. doi: 10.1002 / bit.28639) are plasmids already available in our laboratory, each carrying a different theophylline switch and the Cre gene. Design specific primers to PCR amplify the Cre gene fragments containing the theophylline switch: int1-Cre fragment, int2-Cre fragment, int3-Cre fragment, int4-Cre fragment. Design specific primers to amplify the 1 kb homologous arms upstream and downstream of the dns locus of Vibrio natriegens respectively, and construct the repair templates: dnsaLR-int1-Cre fragment, dnsaLR-int2-Cre fragment, dnsaLR-int3-Cre fragment, dnsaLR-int4-Cre fragment.

[0074] Using the natural transformation method, the repair template fragments were separately introduced into the strain ATCC△ptsG / pNT-CRISPR-dns and integrated into the genome dns at the corresponding sites to construct 4 strains of Vibrio natriegens with the theophylline switch and Cre recombinase expression cassette integrated into the genome: ATCC△ptsG△dns::(int1-Cre), ATCC△ptsG△dns::(int2-Cre), ATCC△ptsG△dns::(int3-Cre), ATCC△ptsG△dns::(int4-Cre).

[0075] Example 2 Integration of Cre recombinase containing the theophylline switch into the intergenic non-coding region of Escherichia coli

[0076] Genomic integration of Cre recombinase in Escherichia coli was carried out using the CRISPR-Cas9 method disclosed in the literature (DOI: 10.1093 / abbs / gmab036). The sgRNA sequences targeting the intergenic non-coding region on the Escherichia coli genome were designed, and the plasmid pTargetF-Cre was constructed. Four repair template sequences alR-int1-Cre, aLR-int2-Cre, aLR-int3-Cre, and aLR-int4-Cre for Cre recombinase integration were constructed according to the 500 bp sequences upstream and downstream of the insertion site. The Cas9 expression plasmid pCas, pTargetF-Cre, and the four repair templates were separately and sequentially electrotransformed into Escherichia coli W3110△ptsG in which the ptsG gene was knocked out to construct the strains W3110△ptsG::int1-Cre, W3110△ptsG::int2-Cre, W3110△ptsG::int3-Cre, and W3110△ptsG::int4-Cre.

[0077] Example 3 Construction of xylose reductase XR and arabinose dehydrogenase araDH expression plasmids

[0078] In the present invention, the constitutive promoters P lac , P tac , P J23119 were selected to construct different XR and araDH expression plasmids. Using the p18-kan plasmid as the backbone, specific primers were designed to amplify the XR gene and the araDH gene respectively, and then the LoxP -promoter- LoxP fragment containing the specific recognition site of Cre recombinase was obtained by gene synthesis. Among them, the two of LoxP were in opposite directions to achieve the purpose of sequence inversion of the promoter by using Cre recombinase, and the LoxP -promoter- LoxP fragment was as follows:LoxP -P lac - LoxP 、 LoxP -P tac - LoxP 、 LoxP -P J23119 - LoxP . Recombine the plasmid backbone, XR gene fragment, araDH gene fragment, LoxP -promoter- LoxP gene fragment and construct plasmids to obtain three plasmids: p18-kan-P lac -araDH-XR, p18-kan-P tac -araDH-XR, p18-kan-P J23119 -araDH-XR. Electrotransform the three plasmids into the 4 Vibrio natriegens genetically engineered bacteria constructed in Example 1 respectively to obtain a total of 12 genetically engineered bacteria: ATCC△ptsG△dns::(int1-Cre) / p18-kan-P lac -araDH-XR, ATCC△ptsG△dns::(int1-Cre) / p18-kan-P tac -araDH-XR, ATCC△ptsG△dns::(int1-Cre) / p18-kan-P J23119 -araDH-XR, ATCC△ptsG△dns::(int2-Cre) / p18-kan-P lac -araDH-XR, ATCC△ptsG△dns::(int2-Cre) / p18-kan-P tac -araDH-XR, ATCC△ptsG△dns::(int2-Cre) / p18-kan-P J23119 -araDH-XR, ATCC△ptsG△dns::(int3-Cre) / p18-kan-P lac -araDH-XR, ATCC△ptsG△dns::(int3-Cre) / p18-kan-P tac -araDH-XR, ATCC△ptsG△dns::(int3-Cre) / p18-kan-P J23119 -araDH-XR, ATCC△ptsG△dns::(int4-Cre) / p18-kan-P lac -araDH-XR, ATCC△ptsG△dns::(int4-Cre) / p18-kan-P tac-araDH-XR, ATCC△ptsG△dns::(int4-Cre) / p18-kan-P J23119 -araDH-XR, named as strain S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11 and S12 respectively. The three plasmids were electrotransformed into the 4 genetically engineered Escherichia coli strains constructed in Example 2 respectively, and 12 genetically engineered strains were obtained in total: W3110△ptsG::(int1-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int1-Cre) / p18-kan-P tac -araDH-XR, W3110△ptsG::(int1-Cre) / p18-kan-P J23119 -araDH-XR, W3110△ptsG::(int2-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int2-Cre) / p18-kan-P tac -araDH-XR, W3110△ptsG::(int2-Cre) / p18-kan-P J23119 -araDH-XR, W3110△ptsG::(int3-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int3-Cre) / p18-kan-P tac -araDH-XR, W3110△ptsG::(int3-Cre) / p18-kan-P J23119 -araDH-XR, W3110△ptsG::(int4-Cre) / p18-kan-P lac -araDH-XR, W3110△ptsG::(int4-Cre) / p18-kan-P tac -araDH-XR, W3110△ptsG::(int4-Cre) / p18-kan-P J23119 -araDH-XR, named as strain E1, E2, E3, E4, E5, E6, E7, E8, E9, E10, E11 and E12 respectively.

[0079] Example 4 Shake Flask Fermentation of Xylitol Strains

[0080] Vibrio natriegens strains S1 - S12 were streaked on LB-kan solid plates to isolate single colonies respectively. Single colonies were picked and inoculated into 5 mL LB-kan test tubes, and cultured in a shaker at 30 °C and 200 rpm for 4 - 6 hours. Prepare the xylitol shake flask fermentation medium: yeast extract 5 g / L, Na2HPO4 6 g / L, KH2PO4 5.31 g / L, NH4Cl 1 g / L, NaCl 10 g / L, MgSO4 0.1 g / L, CaCl2 0.1 g / L. Inoculate the genetically engineered bacteria at a ratio of 2% into the fermentation medium, and culture in a shaker at 30 °C and 200 rpm for 2 hours. Then add xylose with a final concentration of 20 g / L, glucose with a final concentration of 10 g / L, and arabinose with a final concentration of 2.3 g / L, and culture in a shaker at 30 °C and 200 rpm for another 2 hours. Meanwhile, take 1 mL of the fermentation broth to measure the araDH enzyme activity and XR enzyme activity. Then, add theophylline with a final concentration of 6 mM, and culture in a shaker at 30 °C and 200 rpm for another 10 hours, and measure the araDH enzyme activity and XR enzyme activity. After fermentation, use HPLC to detect the contents of xylose, xylitol, arabinose, and arabinitol.

[0081] Escherichia coli strains E1 - E12 were streaked on LB-kan solid plates to isolate single colonies respectively. Single colonies were picked and inoculated into 5 mL LB-kan test tubes, and cultured in a shaker at 37 °C and 200 rpm for 6 - 8 hours. Prepare the xylitol shake flask fermentation medium: yeast extract 5 g / L, Na2HPO4 6 g / L, KH2PO4 5.31 g / L, NH4Cl 1 g / L, MgSO4 0.1 g / L, CaCl2 0.1 g / L. Inoculate the genetically engineered bacteria at a ratio of 2% into the fermentation medium, and culture in a shaker at 37 °C and 200 rpm for 2 hours. Then add xylose with a final concentration of 20 g / L, glucose with a final concentration of 10 g / L, and arabinose with a final concentration of 2.3 g / L, and culture in a shaker at 30 °C and 200 rpm for another 2 hours. Meanwhile, take 1 mL of the fermentation broth to measure the araDH enzyme activity and XR enzyme activity. Then, add theophylline with a final concentration of 6 mM, and culture in a shaker at 30 °C and 200 rpm for another 10 hours, and measure the araDH enzyme activity and XR enzyme activity. After fermentation, use HPLC to detect the contents of xylose, xylitol, arabinose, and arabinitol.

[0082] The results of AraDH and XR enzyme activities of different strains are shown in Table 1. It can be seen from Table 1 that in Escherichia coli and Vibrio natriegens, all 4 theophylline switches effectively play the role of switching the promoter direction. Before theophylline induction, araDH is expressed and XR is not expressed; after theophylline induction, araDH is not expressed and XR is expressed. Due to the use of three different strengths of constitutive promoters, the activities of araDH and XR are different, but in both host cells, the enzyme activity sizes are: P J23119 >P lac >Ptac 。

[0083] After the fermentation ended, the liquid-phase detection results are shown in Table 2. Since the P tac promoter had low araDH and XR enzyme activities in both host cells, before the theophylline induction, arabinose was not completely converted to arabinoic acid or was metabolized by itself, resulting in a small amount of arabitol still being produced after the addition of theophylline. The P J23119 and P lac promoter strains did not produce any arabitol, and xylose could be completely converted.

[0084] Table 1 Results of araDH and XR enzyme activities

[0085]

[0086] Table 2 Liquid-phase results after shake-flask fermentation

[0087]

[0088] Example 5 Shake-flask fermentation of theophylline-switch strains to produce xylitol

[0089] According to the experimental results of Example 3, taking strain S3 as an example, shake-flask fermentation was carried out and the changes in metabolites during the process were monitored. Specific steps: Streak S1 on an LB-kan plate to separate single colonies, pick a single colony and inoculate it into a 5 mL LB-kan test tube, and culture it in a shaker at 30 °C and 200 rpm for 5 hours. Prepare a xylitol shake-flask fermentation medium: 5 g / L yeast extract, 6 g / L Na2HPO4, 5.31 g / L KH2PO4, 1 g / L NH4Cl, 10 g / L NaCl, 0.1 g / L MgSO4, 0.1 g / L CaCl2. Inoculate the genetically engineered bacteria at a ratio of 2% into the fermentation medium, culture it in a shaker at 30 °C and 200 rpm for 2 hours, then add xylose with a final concentration of 20 g / L, glucose with a final concentration of 10 g / L, and arabinose with a final concentration of 2.3 g / L, and culture it in a shaker at 30 °C and 200 rpm for another 2 hours, then add theophylline with a final concentration of 6 mM, and culture it in a shaker at 30 °C and 200 rpm for another 10 hours. Samples were taken at regular intervals for HPLC detection of the contents of xylose, xylitol, arabinose, and arabitol. The fermentation results are as Figure 2 shown. At the 3rd hour of fermentation, arabinose had been completely consumed. At the 10th hour of fermentation, xylose was completely converted into xylitol.

Claims

1. A genetically engineered bacterium, comprising a host cell and a functional gene inserted into the host cell, characterized in that: The functional genes include: Cre / LoxP system, theophylline switch gene, and target gene expression element; The target gene expression element includes a promoter, a xylose reductase gene and an arabinose-1-dehydrogenase gene; the promoter has the ability to initiate transcription of the arabinose-1-dehydrogenase gene and the xylose reductase gene; the arabinose-1-dehydrogenase gene is connected to the downstream of the promoter; the xylose reductase gene is connected to the upstream of the promoter and the start codon end is close to the promoter; The Cre / LoxP The system has the function of flipping the sequence to be edited; the sequence to be edited is the promoter in the target gene expression element; the theophylline switch gene is induced by theophylline to regulate the expression of the Cre recombinase gene.

2. The genetically engineered bacterium according to claim 1, characterized in that: The promoter is P J23119 or P lac .

3. The genetically engineered bacterium according to claim 1, characterized in that: The nucleotide sequence of the arabinose-1-dehydrogenase gene is shown in SEQ ID NO.

1.

4. The genetically engineered bacterium according to claim 1, characterized in that The nucleotide sequence of the xylose reductase gene is shown in SEQ ID NO.

2.

5. The genetically engineered bacterium according to claim 1, characterized in that: The Cre / LoxP In the system, the nucleotide sequence of the Cre recombinase gene is shown in SEQ ID NO.

7.

6. The genetically engineered bacterium according to any one of claims 1 or 5, characterized in that The Cre / LoxP In the system, LoxP The nucleotide sequences of the sites are shown in SEQ ID NO.8 and SEQ ID NO.

9.

7. The genetically engineered bacterium according to claim 1, characterized in that The nucleotide sequence of the theophylline switch gene is one of the sequences shown in SEQ ID NO. 3 to 6.

8. The genetically engineered bacterium according to any one of claims 1 or 7, characterized in that: In the host cell genome, the theophylline switch gene is located downstream of the start codon ATG of the Cre recombinase gene.

9. The genetically engineered bacterium according to claim 1, characterized in that: knockout in the host cell genome ptsG Gene.

10. The genetically engineered bacterium according to claim 6, characterized in that: Cre / LoxP The system, theophylline switch gene and target gene expression element are expressed in host cells in the form of genome integration or recombinant plasmid.

11. The genetically engineered bacterium according to claim 10, characterized in that: The theophylline switch and Cre recombinase are expressed in the host cell in the form of genome integration; LoxP The site and target gene expression elements are expressed in the host cell in the form of a recombinant plasmid.

12. The genetically engineered bacterium according to claim 11, characterized in that: The theophylline switch and Cre recombinase are inserted into the host cell genome nuclease DNS Non-coding regions within or between genes.

13. The genetically engineered bacterium according to claim 1, characterized in that: The host cell is Vibrio natriuresis or Escherichia coli.

14. A method for preparing xylitol, characterized in that: include: (1) using hemicellulose hydrolyzate as a raw material, and fermenting in a fermentation medium inoculated with the genetically engineered bacteria as claimed in claim 1, until no arabinose remains in the fermentation liquid; (2) After adding theophylline to the reaction solution, the fermentation culture is continued to obtain a fermentation product containing xylitol.

15. The method according to claim 14, characterized in that The amount of theophylline added is 5-10 mM.

16. The method according to claim 14, characterized in that The reaction temperature is 25℃~35℃.

17. The method according to claim 14, characterized in that The inoculation amount of the genetically engineered bacteria is 1-15% based on the initial fermentation volume.

Images