Glucose dehydrogenase mutant, encoding gene, plasmid, genetically engineered bacteria, immobilized enzyme and application thereof

By mutating specific amino acids in glucose dehydrogenase, a highly stable immobilized enzyme was constructed, solving the problem of poor stability of glucose dehydrogenase and enabling efficient multi-batch use of the enzyme while reducing costs.

CN119955749BActive Publication Date: 2025-11-28SHIJIAZHUANG UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510157652.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-13
Publication Date
2025-11-28
Estimated Expiration
2045-02-13

AI Technical Summary

Technical Problem

Existing glucose dehydrogenases have poor stability, resulting in poor immobilization effects and making it impossible to use them continuously in multiple batches, thus increasing reaction costs.

Method used

By making specific mutations to the amino acid sequence of glucose dehydrogenase, specifically changing valine at position 62 to glycine and/or alanine at position 197 to arginine, and glutamine at position 252 to isoleucine, corresponding plasmids and genetically engineered bacteria were constructed to prepare immobilized enzymes with ultra-high stability.

Benefits of technology

It significantly improved the stability of glucose dehydrogenase, reaching more than 6 times that of the wild type, reduced the cost of enzyme use, and maintained good reaction efficiency after 10 batches.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955749B_ABST
    Figure CN119955749B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of bioengineering, and particularly relates to a glucose dehydrogenase mutant, a coding gene thereof, a plasmid, a genetically engineered bacterium, an immobilized enzyme and application. The glucose dehydrogenase mutant is a mutant in which the wild-type valine at the 62nd position and / or alanine at the 197th position is mutated into other amino acids, and a mutant coupled with the 252th position. The glucose dehydrogenase mutant disclosed in the application has obviously improved stability, and the highest stability can be more than 6 times of that of the wild type, and the enzyme activity is improved to 2.5 times. The immobilized enzyme prepared by using the glucose dehydrogenase mutant of the application has stable reaction completion time and high reaction efficiency between batches, and is not obviously decreased after being repeatedly used for 10 batches, and is suitable for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering, in particular to a glucose dehydrogenase mutant, a coding gene thereof, a plasmid, a genetically engineered bacterium, an immobilized enzyme and application thereof. BACKGROUND

[0002] Oxidoreductases are widely used to catalyze drug intermediates produced by oxidation-reduction reactions, such as ketoreductase catalyzing the conversion of ethyl 4-chloroacetoacetate into ethyl S-4-chloro-3-hydroxybutyrate. Such reactions often require the participation of coenzymes that are relatively expensive and are continuously consumed during the reaction process. Therefore, using glucose dehydrogenase to achieve in-situ regeneration of coenzyme NAD(P)H, and then to achieve coenzyme (NAD(P)H) recycling, is an effective strategy to reduce reaction costs. Glucose dehydrogenase (GDH) can catalyze the conversion of glucose into gluconic acid, and in the process, catalyze the conversion of NAD(P) + into NAP(P)H. This enzyme has high activity, and the substrate glucose and its product have little effect on the catalytic performance of the enzyme, so it has good application effect.

[0003] In the application of glucose dehydrogenase in coenzyme-mediated oxidation-reduction reactions, various forms such as bacterial cells, enzyme solutions, and immobilized enzymes can be selected. Immobilized enzymes are beneficial to the control of impurities in enzyme-catalyzed reaction systems, and large recycling batch numbers are beneficial to cost control. There are many methods for enzyme immobilization, including resin covalent immobilization, covalent organic frameworks (COFs), and others. Since most natural enzymes are not resistant to immobilization conditions, especially glucose dehydrogenase, which often has poor thermal stability, further limits its application in immobilized enzymes. Therefore, existing glucose dehydrogenase mutants, such as Chinese invention patent applications with application numbers 202310847450.3 and 202410500726.5, only focus on improving the activity of enzymes for non-immobilized use, and these enzyme mutants have the problem of insufficient stability for multiple batch continuous use when used for immobilization. SUMMARY

[0004] The purpose of the present application is to provide a glucose dehydrogenase mutant, a coding gene, a plasmid, a genetically engineered bacterium, and an immobilized enzyme thereof. By using the coding gene of the glucose dehydrogenase mutant, the corresponding plasmid is constructed and the genetically engineered bacterium is transformed, which is used to produce glucose dehydrogenase with ultra-high stability, so as to solve the problem of poor stability of existing glucose dehydrogenase and poor immobilization effect.

[0005] Another purpose of the present application is to provide a method for preparing an immobilized enzyme using a glucose dehydrogenase mutant and the application of the immobilized enzyme in the regeneration of coenzyme NADH and NADPH in oxidation-reduction reactions.

[0006] To achieve the above object, the technical scheme adopted by the present application is:

[0007] A glucose dehydrogenase mutant, the amino acid sequence of which is based on the sequence shown in SEQ ID NO. 1, the valine at position 62 and / or the alanine at position 197 is mutated to other amino acids.

[0008] Among them, the sequence SEQ ID NO. 1 is the wild type Glucose 1-dehydrogenase [Bacillus] publicly disclosed by NCBI, Sequence ID: WP_003246720.1 gene sequence SEQ ID NO. 2 corresponds to the encoded amino acid sequence.

[0009] The sequence SEQ ID NO. 2 is as follows:

[0010] ATGTACCCGGATCTGAAAGGTAAAGTGGTTGCAATTACTGGTGCTGCGAGCGGTCTGGGCAAAGCGATGGCAATTCGTTTCGGTAAAGAACAGGCCAAAGTTGTCATCAATTACTACTCCAACAAACAGGACCCGAACGAAGTGAAAGAGGAAGTGATCAAGGCTGGTGGCGAAGCTGTCGTGGTACAGGGTGACGTGACGAAAGAGGAAGACGTGAAGAACA TCGTTCAGAC T G CAAT TAAA GA GT T T GG C A C C C T G GATAT C AT GAT CAACAAC GC GGGT CT GGAGAAT C C GGTAC C GT C C CAC GAAA T GC C GCT GAAAGACTGGGACAAGGT CAT C GGTAC GAAC CT GACCGGCGCT TTCCTGGGTT CCCGTGAAGC TATCAAATACTTCGTCGAGA ACGACATCAAAGGTAACGTTATCAATATGTCCTCTGTGCACGAAGTGATTCCTTGGCCGCTGTTCGTTCATTACGCGGCATCCAAAGGTGGTATCAAACTGATGACCGAAACCCTGGCGCTGGAATATGCACCGAAGGGTATCCGCGTTAACAACATTGGCCCGGGCGCTATTAACACCCCGATCAACGCTGAAAAATTCGCGGACCCAAAACAAAAGGCGGATGTAGAGTCTATGATTCCGATGGGCTACATTGGCGAACCGGAAGAAATTGCTGCTGTGGCTGCGTGGCTGGCCTCTAAGGAAGCGTC TTATGTCACCGGTATCACCCTGTTCGCCGATGGTGGCATGA C T C A AT A C CC G T C T T T C C A G G C T G G T C G T G G C T G A

[0011] As a limitation of the application, on the basis of the sequence of the amino acid sequence as shown in SEQ ID NO. 1, the valine at position 62 is mutated to glycine and / or the alanine at position 197 is mutated to arginine.

[0012] As another limitation of the present application, the glutamine at position 252 is mutated to isoleucine based on the sequence shown in SEQ ID NO. 1.

[0013] The glucose dehydrogenase mutant has an amino acid sequence shown in SEQ ID NO. 2. The mutation sites compared with the wild type are underlined, which are V62G, A197R and Q252I, respectively. The corresponding amino acid sequence is shown in SEQ ID NO. 3:

[0014] Met-Tyr-Pro-Asp-Leu-Lys-Gly-Lys-Val-Val-Ala-Ile-Thr-Gly-Ala-Ala-Ser-Gly-Leu-Gly-Lys-Ala-Met-Ala-Ile-Arg-Phe-Gly-Lys-Glu-Gln-Ala-Lys-Val-Val-Ile-Asn-Tyr-Tyr-Ser-Asn-Lys-Gln-Asp-Pro-Asn-Glu-Val-Lys-Glu-Glu-Val-Ile-Lys-Ala-Gly-Gly-Glu-Ala-Val-Val- Gly -Gln-Gly-Asp-Val-Thr-Lys-Glu-Glu-Asp-Val-Lys-Asn-Ile-Val-Gln-Thr-Ala-Ile-Lys-Glu-Phe-Gly-Thr-Leu-Asp-Ile-Met-Ile-Asn-Asn-Ala-Gly-Leu-Glu-Asn-Pro-Val-Pro-Ser-His-Glu-Met-Pro-Leu-Lys-Asp-Trp-Asp-Lys-Val-Ile-Gly-Thr-Asn-Leu-Thr-Gly-Ala-Phe-Leu-Gly-Ser-Arg-Glu-Ala-Ile-Lys-Tyr-Phe-Val-Glu-Asn-Asp-Ile-Lys-Gly-Asn-Val-Ile-Asn-Met-Ser-Ser-Val-His-Glu-Val-Ile-Pro-Trp-Pro-Leu-Phe-Val-His-Tyr-Ala-Ala-Ser-Lys-Gly-Gly-Ile-Lys-Leu-Met-Thr-Glu-Thr-Leu-Ala-Leu-Glu-Tyr-Ala-Pro-Lys-Gly-Ile-Arg-Val-Asn-Asn-Ile-Gly-Pro-Gly-Ala-Ile-Asn-Thr-Pro-Ile-Asn-Arg -Glu-Ly s-Phe-Ala-Asp-Pro-Lys-Gln-Lys-Ala-Asp-Val-Glu-Ser-Met-Ile-Pro-Met-Gly-Tyr-Ile-Gl y-Glu-Pro-Glu-Glu-Ile-Ala-Ala-Val-Ala-Ala-Trp-Leu-Ala-Ser-Lys-Glu-Ala-Ser-Tyr-Va l-Thr-Gly-Ile-Thr-Leu-Phe-Ala-Asp-Gly-Gly-Met-Thr- Ile -Tyr-Pro-Ser-Phe-Gln-Ala-Gl y-Arg-Gly.

[0015] The present application also provides a coding gene, which codes for the glucose dehydrogenase mutant according to any one of the above.

[0016] The present application also provides a plasmid, which carries the coding gene of the glucose dehydrogenase mutant.

[0017] The present application also provides a genetically engineered bacterium, which contains the above plasmid, for expressing the glucose dehydrogenase mutant.

[0018] The present application also provides a kind of immobilized enzyme, which is a COFs immobilized enzyme (i.e. immobilized enzyme based on covalent organic framework material) or resin immobilized enzyme prepared from the glucose dehydrogenase mutant expressed by the above plasmid.

[0019] The present application also provides the application of the immobilized enzyme in the regeneration of coenzyme NADH and NADPH in redox reaction.

[0020] The present application also provides the application of the glucose dehydrogenase mutant in the preparation of immobilized enzyme, the preparation of genetically engineered bacterium containing the coding gene of glucose dehydrogenase mutant, the collection of bacterium after culture, the crushing of bacterium to extract supernatant, the preparation of enzyme freeze-dried powder, the covalent immobilization of epoxy resin or COFs immobilization, i.e. the preparation of immobilized enzyme.

[0021] Due to the adoption of the above technical solutions, the present application has the following technical progress compared with the prior art:

[0022] (1) This invention is based on the protein structure information Sequence ID:8W0O_A published by NCBI to infer possible mutation positions, select positions for mutation and combine mutations, unexpectedly obtained mutants with outstanding stability and high enzyme activity, suitable for preparing immobilized enzymes. Among them, the core mutations V62G and A197R can greatly improve stability, with stability increased to 224% and 344% of wild type, respectively, and the enzyme activity can be further improved when the amino acid at position 252 is mutated to isoleucine.

[0023] (2) The glucose dehydrogenase mutant provided by this invention can be applied to enzymatic reaction systems requiring coenzyme cycling in the form of enzyme solution or immobilized enzyme. This mutant enzyme has high activity and requires a small amount, which can reduce the cost of enzyme use. At the same time, its stability is more than 6 times that of the wild type, and it can be made into an immobilized enzyme with a longer lifespan. After repeating 10 batches, the reaction time did not decrease significantly and remained stable at about 4 hours, while the wild type showed a significant decrease, requiring an overnight reaction to complete about 10 batches. Therefore, the glucose dehydrogenase mutant of this invention can further reduce reaction costs and is compatible with a variety of demanding coupling reactions.

[0024] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments. Attached Figure Description

[0025] Figure 1 The wild type of this invention and the glucose dehydrogenase mutant GDH in Example 5. TB2 The soluble expression results are shown in the figure. Detailed Implementation

[0026] The present invention will be further described in detail below through specific embodiments. It should be understood that the described embodiments are only for explaining the present invention and do not limit the present invention.

[0027] Unless otherwise specified, all materials and reagents used in the embodiments of this invention are commercially available. Experimental methods not specifically described in the embodiments are generally performed under standard conditions or as recommended by the manufacturer.

[0028] The molecular biology experimental procedures in the examples, including plasmid construction and culture medium preparation, were mainly performed in accordance with "Molecular Cloning: A Laboratory Manual" (3rd edition), edited by J. Sambrook and DW Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002.

[0029] In this invention, the LB medium consists of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0030] Example 1: Glucose dehydrogenase mutant GDH containing the V62G mutation siteTB0 and genetically engineered bacteria thereof

[0031] The present embodiment is a glucose dehydrogenase mutant GDH TB0 , which is synthesized according to the Sequence ID: WP_003246720.1 sequence, codon-optimized for E. coli, modeled according to the NCBI published protein structure information Sequence ID: 8W0O_A, and screened after designing primers and mutating the possible mutation positions. Compared with the wild-type glucose dehydrogenase corresponding to the Glucose 1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1 gene sequence SEQ ID NO. 2, the amino acid at position 62 in the amino acid sequence of the glucose dehydrogenase mutant GDH TB0 is mutated from valine in the wild type to glycine.

[0032] The preparation method of the glucose dehydrogenase mutant GDH TB0 is as follows:

[0033] (1) Constructing genetically engineered bacteria: insert SEQ ID NO. 2 between Nde1 and EcoR1 enzyme cutting sites to construct pET-29aGDH vector, construct wild-type genetically engineered bacteria, then design site-directed mutation primers based on SEQ ID NO. 2, as shown in Table 1; use primers with sequence numbers SEQ ID NO. 4 and SEQ ID NO. 5 for PCR reaction, transformation, and sequencing to obtain genetically engineered bacteria containing the V62G mutation site of the glucose dehydrogenase mutant gene, and use the genetically engineered bacteria to express the glucose dehydrogenase mutant GDH TB0 .

[0034] In the PCR system, the template is 1 μL, the corresponding upstream and downstream primers are each 1 μL, 2x PCR mix is 25 μL, and water is supplemented to 50 μL. The PCR program is 95°C for 10 min; 95°C for 1 min, 55°C for 30 sec, 72°C for 7 min for 15 cycles; 72°C for 10 min. Digest the 10 μL PCR product in the template, add 1 μL Dpn1, and supplement water to 50 μL; 37°C for 30 min. Take 10 μL of bacterial liquid to transform and coat the resistant plate, pick single colonies and sequence, and store the correct genetically engineered bacteria.

[0035] (2) Preparation of enzyme solution and enzyme freeze-dried powder of glucose dehydrogenase mutant: pick the correct genetically engineered bacteria single colony from the plate and inoculate into LB medium with kanamycin, so that the concentration of kanamycin is 50 mg / L, cultivate in a 37℃, 220 rpm constant temperature shaker for 6h, add IPTG with a final concentration of 0.2 mmol / L, induce overnight at 25℃, centrifuge at 8500 rpm for 15 min to collect the bacteria, resuspend in 1xPBS to 100 g / L, ultrasonic crushing for 2s, stop ultrasonic standing for 6s, ultrasonic crushing again for 20 min, take out the bacteria liquid, centrifuge at 12000 rpm for 2 min, collect the supernatant, which is the glucose dehydrogenase mutant GDH TB0 Enzyme solution, enzyme solution is freeze-dried by small freeze-drying machine for 48h to obtain enzyme freeze-dried powder.

[0036] Table 1 primer sequence

[0037]

[0038] In addition, in addition to the primers used for site-directed mutagenesis, the specific primers selected in Table 1, the glucose dehydrogenase wild type (without site-directed mutation) and each glucose dehydrogenase mutant enzyme solution and enzyme freeze-dried powder are prepared according to the above method for subsequent detection experiments.

[0039] Example 2 glucose dehydrogenase mutant GDH containing A197R mutation site TB1 and its genetically engineered bacteria

[0040] This example provides a glucose dehydrogenase mutant GDH TB1 , compared with the wild type glucose dehydrogenase corresponding to Glucose 1-dehydrogenase [Bacillus], Sequence ID: WP_003246720.1 gene sequence SEQ ID NO. 1, the amino acid at position 197 in the amino acid sequence of the glucose dehydrogenase mutant GDH TB1 is mutated from alanine in the wild type to arginine.

[0041] The glucose dehydrogenase mutant GDH TB1 of this example and the genetically engineered bacteria expressing the mutant are prepared by basically the same method as in Example 1, except that the primers used for site-directed mutagenesis are different, and the primer sequences used are SEQ ID NO. 6 and SEQ ID NO. 7 in Table 1.

[0042] Example 3 glucose dehydrogenase mutant GDH containing V62G and Q252I mutation sites TB01 and its genetically engineered bacteria

[0043] The embodiment provides a glucose dehydrogenase mutant GDH TB01 , wherein the amino acid at the 62th position in the amino acid sequence of the glucose dehydrogenase mutant GDH TB01 is changed from valine in the wild type into glycine, and the amino acid at the 252th position is changed from glutamine in the wild type into isoleucine.

[0044] The preparation method of the glucose dehydrogenase mutant and the genetically engineered bacterium expressing the mutant in the embodiment is basically the same as that in Embodiment 1, except that the primers used for site-directed mutagenesis are different, and the four primers used are the primers with the sequence numbers of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 8 and SEQ ID NO. 9 in Table 1.

[0045] Embodiment 4 provides a glucose dehydrogenase mutant GDH TB11 and a genetically engineered bacterium thereof

[0046] The embodiment provides a glucose dehydrogenase mutant GDH TB11 , wherein the amino acid at the 197th position in the amino acid sequence of the glucose dehydrogenase mutant GDH TB11 is changed from alanine in the wild type into arginine, and the amino acid at the 252th position is changed from glutamine in the wild type into isoleucine.

[0047] The preparation method of the glucose dehydrogenase mutant and the genetically engineered bacterium expressing the mutant in the embodiment is basically the same as that in Embodiment 1, except that the primers used for site-directed mutagenesis are different, and the four primers used are the primers with the sequence numbers of SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9 in Table 1.

[0048] Embodiment 5 provides a glucose dehydrogenase mutant GDH TB2 and a genetically engineered bacterium thereof

[0049] The embodiment provides a glucose dehydrogenase mutant GDH TB2, the amino acid sequence of which is as shown in SEQ ID NO. 2, wherein the amino acid at position 62 in the amino acid sequence of the glucose dehydrogenase mutant GDH is mutated from valine in the wild type to glycine, the amino acid at position 197 is mutated from alanine in the wild type to arginine, and the amino acid at position 252 is mutated from glutamine in the wild type to isoleucine. TB2

[0050] The preparation method of the glucose dehydrogenase mutant and the genetically engineered bacterium expressing the mutant of the present example is basically the same as that of Example 1, except that the primers used for site-directed mutagenesis are different. The primers used are the six primers with the sequence numbers of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9 in Table 1.

[0051] (I) Soluble expression detection experiment

[0052] The wild type genetically engineered bacterium of glucose dehydrogenase and the glucose dehydrogenase mutant GDH TB2 of Example 5 were identified by SDS-PAGE, and the results are shown in Figure 2. Figure 1 .

[0053] Figure 1 In Figure 2, lane M is a marker, lane 1 is the protein in the precipitate of the wild type genetically engineered bacterium of glucose dehydrogenase, lane 2 is the protein in the supernatant of the wild type genetically engineered bacterium of glucose dehydrogenase, lane 3 is the protein in the precipitate of the genetically engineered bacterium of glucose dehydrogenase mutant GDH TB2 , and lane 4 is the protein in the supernatant of the genetically engineered bacterium of glucose dehydrogenase mutant GDH TB2 .

[0054] It can be seen from Figure 1 that the mutation of glucose dehydrogenase does not affect its soluble expression.

[0055] (II) Enzyme activity and stability detection experiment

[0056] ​Enzyme activity detection method: under room temperature, respectively, take equal amounts of wild-type glucose dehydrogenase and glucose dehydrogenase mutant enzyme solution of examples 1-5, 50x-100x PBS is diluted to 100 μL, as the enzyme solution to be tested, using the principle of NADPH absorption peak at 340 nm, using spectrophotometry to detect the generation of NADPH. Among them, the total reaction system volume is 3 mL, the reaction system contains: 1.75 mL PBS, 1 mL 120 mmol / L D-glucose, 150 μL 2 mmol / L NADPNa2, finally add 100 μL of the enzyme solution to be tested, immediately record the initial value of OD 340 of the reaction system, strictly record the change of OD 340 Within 1 min, continuously record for 3 min, calculate the average value, and bring the absorbance of NADPH molar absorption coefficient formula, calculate the enzyme activity. Control the dilution ratio during detection, so that the change of OD 340 Per minute is not more than 0.7.

[0057] Among them, the definition of enzyme activity 1 U is: under the above conditions, the amount of enzyme required to generate 1 μmol NADPH per minute.

[0058] Stability test method: when testing the stability, equal amounts of each group of enzyme solution to be tested are placed at 50℃ for 10 min, and then the activity is determined according to the above enzyme activity test method. The specific results are shown in table 2.

[0059] Table 2 enzyme activity and stability test results

[0060]

[0061] As shown in table 2, the stability of enzyme mutants GDH TB0 , GDH TB1 Containing core mutations V62G and A197R is significantly improved, which is 224% and 344% of the wild type respectively, indicating that V62G and A197R two mutant forms can greatly improve the stability, and A197R also has a certain degree of improvement on the activity. Q252 position is the mutation position screened in the early stage which can improve the activity to a certain extent, but not every mutation can significantly improve the activity. Only when the mutation is isoleucine, the effect of the early stability improvement point can be better combined and the activity and stability can be further improved. The final superposition of the mutant GDH TB2 Is 265% of the wild-type enzyme activity, and the stability is 611% of the wild type.

[0062] In other detection experiments, the freeze-dried powder solution with appropriate dilution, and the immobilized enzyme instead of the solution, all obtained similar results.

[0063] The above results show that the glucose dehydrogenase with three mutations of V62G, A197R and Q252I can significantly improve the stability of the enzyme to more than 6 times of the wild type, and the enzyme activity is also improved obviously, which is more suitable for immobilization.

[0064] Example 6 Glucose dehydrogenase mutant GDH TB0 coding gene and plasmid

[0065] This example is a coding gene, and the gene sequence is the coding gene corresponding to the amino acid sequence with the mutation of V62G based on SEQ ID NO. 1, and the other sequences are unchanged. The plasmid of this example carries the coding gene of the glucose dehydrogenase mutant GDH TB0 .

[0066] Example 7 Glucose dehydrogenase mutant GDH TB1 coding gene and plasmid

[0067] This example is a coding gene, and the gene sequence is the coding gene corresponding to the amino acid sequence with the mutation of A197R based on SEQ ID NO. 1, and the other sequences are unchanged. The plasmid of this example carries the coding gene of the glucose dehydrogenase mutant GDH TB1 .

[0068] Example 8 Glucose dehydrogenase mutant GDH TB01 coding gene and plasmid

[0069] This example is a coding gene, and the gene sequence is the coding gene corresponding to the amino acid sequence with the mutations of V62G and Q252I based on SEQ ID NO. 1, and the other sequences are unchanged. The plasmid of this example carries the coding gene of the glucose dehydrogenase mutant GDH TB01 .

[0070] Example 9 Glucose dehydrogenase mutant GDH TB11 coding gene and plasmid

[0071] This example is a coding gene, and the gene sequence is the coding gene corresponding to the amino acid sequence with the mutations of A197R and Q252I based on SEQ ID NO. 1, and the other sequences are unchanged. The plasmid of this example carries the coding gene of the glucose dehydrogenase mutant GDH TB11 .

[0072] Example 10 Glucose dehydrogenase mutant GDH TB2 coding gene and plasmid

[0073] The present embodiment is a coding gene, and the gene sequence is an amino acid sequence corresponding to a coding gene with mutations of V62G, A197R and Q252I based on SEQ ID NO. 1, and other sequences remain unchanged. The plasmid of the present embodiment carries the coding gene of glucose dehydrogenase mutant GDH TB2 .

[0074] Example 11 Resin covalently immobilized enzyme

[0075] Take epoxy resin LX-1000HFA, rinse with purified water for 4 times, and filter dry to complete the pretreatment of the epoxy resin. Weigh the pretreated epoxy resin into a conical flask, add glucose dehydrogenase mutant GDH TB2 enzyme solution, add the epoxy resin at a ratio of 300 U:1 g of enzyme activity to the weight of the epoxy resin, add potassium phosphate buffer with a final concentration of 2 mol / L pH=7.3, and make up to 5 mL / g of resin with purified water, and shake at 25°C under 150 rpm for 24 h. Filter the immobilized resin, wash with purified water for 5 times, and store at 4°C to obtain the GDH TB2 resin covalently immobilized enzyme.

[0076] Example 12 COFs immobilized enzyme

[0077] The COFs material (i.e. immobilized material) prepared by toluenesulfonic acid and sodium bicarbonate was activated with 0.5% glutaraldehyde for 24 h, washed with water for 3 times, and then filtered dry. Add 6500 U / g of glucose dehydrogenase mutant GDH TB2 lyophilized powder 0.2 g, immobilized material 1 g, add potassium phosphate buffer with a final concentration of 0.5 mol / L pH=7, shake at 25°C under 150 rpm for 24 h. Wash with purified water for 4 times, and store at 4°C to obtain the COFs immobilized enzyme of GDH TB2 .

[0078] In addition to the above embodiments, in other embodiments, the enzyme activity of each mutant enzyme solution (or enzyme lyophilized powder) and the epoxy resin (or immobilized material) is any value in the range of 100-400 U / g, respectively, to prepare resin covalently immobilized enzyme (or COFs immobilized enzyme). The enzyme activity of the obtained resin covalently immobilized enzyme is in the range of 200-400 U / g, and the enzyme activity of the COFs immobilized enzyme is in the range of 150-300 U / g, which varies slightly according to the batch.

[0079] Example 13 Application of immobilized enzyme in redox reaction

[0080] The present embodiment is the application of immobilized enzyme in the regeneration of coenzyme NADH and NADPH in redox reaction, and the application effect is detected by testing the catalytic performance of the immobilized enzyme.

[0081] Covalently immobilized enzymes of wild type resin, GDH TB2 Covalently immobilized enzymes of wild type resin, GDH TB2 The total activity of the three immobilized enzymes was controlled to 150 U, and the catalytic performance of the immobilized enzymes was tested by the reaction endpoint method. The details are as follows:

[0082] A sufficient amount of liquid ketoreductase was added to establish the following reaction: ketoreductase catalyzes the conversion of ethyl 4-chloroacetoacetate into S-4-chloro-3-hydroxybutyric acid ethyl ester, and glucose dehydrogenase is used for the coenzyme NADPH cycle.

[0083] Ethyl 4-chloroacetoacetate 15 g, glucose 21.65 g were added to 63 mL of 0.1 mol / L pH 7.0 ethanolamine buffer and 75 mL of butyl acetate, stirred and mixed, and the pH was adjusted to 7.0 with 2 mol / L sodium carbonate. During stirring, 350 mg of ketoreductase, three kinds of immobilized enzymes and 15 mg of NADPNa2 were added. As the reaction proceeded, the pH decreased, and sodium carbonate was added dropwise to control the pH to 7.0 with a pH controller. After the reaction was completed, the immobilized enzyme buffer was collected and washed before being used in the next batch of reaction.

[0084] Gas chromatography detected the yield of S-4-chloro-3-hydroxybutyric acid ethyl ester: at the initial stage of the reaction, the butyl acetate and aqueous phase could be layered, and gradually became a milky emulsion as the reaction proceeded. Samples were taken under stirring, and uniform samples were obtained under mixing. 100 μL of reaction liquid was taken at different time points, 900 μL of butyl acetate was added, and after mixing, it was filtered with a 0.45 μm microporous filter. Gas chromatography was performed with 1 uL injection.

[0085] Samples were taken at intervals of 0.5 h, and the results of gas chromatography were used to calculate the time required to complete the reaction. The results are shown in Table 3:

[0086] Table 3 Immobilized enzyme stability test

[0087]

[0088] The results show that the immobilized enzyme of wild type gradually takes longer to complete the reaction as the number of reaction batches increases, indicating that the instability of the immobilized enzyme continues to increase, requiring longer reaction time, which affects the application effect in continuous batch reactions. The two immobilized enzymes of glucose dehydrogenase mutant GDH TB2 can be stable for 10 batches of 4 h, and the reaction can be repeated once in a shorter time, indicating that the reaction efficiency is higher and the immobilized enzyme stability is good, and can be reused more than 10 times, reducing the cost.

[0089] It should be noted that the above only describes the preferred embodiments of the present application and is not used to limit the present application. Although the present application is described in detail with reference to the above embodiments, those skilled in the art can modify the technical solutions recorded in the above embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the scope of protection of the claims of the present application.

Claims

1. A glucose dehydrogenase mutant, characterized in that, The amino acid sequence thereof is based on the sequence shown as SEQ ID NO. 1, only the valine at position 62 is mutated to glycine, or only the alanine at position 197 is mutated to arginine.

2. A glucose dehydrogenase mutant, characterized in that, The amino acid sequence thereof is based on the sequence shown as SEQ ID NO. 1, only the following mutations occur: the valine at position 62 is mutated to glycine, and the glutamine at position 252 is mutated to isoleucine.

3. A glucose dehydrogenase mutant, characterized in that, The amino acid sequence thereof is based on the sequence shown as SEQ ID NO. 1, only the following mutations occur: the alanine at position 197 is mutated to arginine, and the glutamine at position 252 is mutated to isoleucine.

4. A glucose dehydrogenase mutant, characterized in that, The amino acid sequence thereof is based on the sequence shown as SEQ ID NO. 1, only the following mutations occur: the valine at position 62 is mutated to glycine, the alanine at position 197 is mutated to arginine, and the glutamine at position 252 is mutated to isoleucine.

5. A gene encoding a gene, characterized in that, The coding gene encodes the glucose dehydrogenase mutant of any one of claims 1-4.

6. A plasmid, characterized in that, The plasmid carries the coding gene of claim 5.

7. A genetically engineered bacterium, characterized by, The plasmid of claim 6 is used for expressing the glucose dehydrogenase mutant.

8. An immobilized enzyme characterized in that, The COFs immobilized enzyme or resin immobilized enzyme prepared from the glucose dehydrogenase mutant expressed by the plasmid of claim 6.

9. The use of the immobilized enzyme of claim 8 in the regeneration of coenzyme NADH and NADPH in redox reactions.

10. Use of a glucose dehydrogenase mutant according to any one of claims 1 to 4 for the preparation of an immobilized enzyme, characterized in that, The genetically engineered bacteria containing the gene encoding the glucose dehydrogenase mutant gene are prepared, the bacterial bodies of the genetically engineered bacteria are collected after cultivation, the bacterial bodies are broken to extract the recombinant enzyme, and the enzyme is covalently immobilized by epoxy resin or COFs immobilization, thereby obtaining the immobilized enzyme.

Citation Information

Patent Citations

  • Glucose dehydrogenase mutant as well as preparation method and application thereof

    CN117487772A

  • Glucose dehydrogenase mutant, nucleic acid molecule, recombinant vector, engineering bacterium and application

    CN118222525A

  • Multiseparation paper money counting machine

    CN2657108Y

  • Glucose dehydrogenase mutant and application

    CN116254240A

  • Human secreted proteins

    US20060223088A1