RNase r mutant for improving reaction temperature and thermal stability, and preparation method and application thereof

Abstract

The application discloses RNase R mutants with improved reaction temperature and thermal stability, and a preparation method and application thereof, and relates to the technical field of biology.The application obtains three RNase R mutants with amino acid sequences shown in SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7 by using protein structure prediction related software to design, transform and screen RNase R.The reaction temperature and thermal stability of the RNase R mutants are improved compared with wild-type RNase R, and the RNase R mutants have obvious advantages in applications such as circular RNA enrichment, and the application range of RNase R in the field of RNA research is expanded.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to an RNase R mutant with improved reaction temperature and thermal stability, and a preparation method and application thereof. BACKGROUND

[0002] RNase R is a magnesium-dependent 3'→5' exoribonuclease, which has important applications in molecular biology, genome editing, and especially in the study of circular RNA (circRNA). However, in traditional experiments and application scenarios, the enzyme structure of wild-type RNase R is prone to thermal denaturation at temperatures higher than room temperature, resulting in rapid decline or even complete inactivation of catalytic activity, which cannot meet the requirements of industrial nucleic acid production and certain high-temperature experiments. In particular, in applications such as long-chain RNA degradation and RNA quality control, the reaction temperature limitation requires additional environmental control, increasing the complexity and cost of operation and limiting its applicability in a wide range of scenarios. Therefore, it is necessary to provide a RNase R with high thermal stability and adaptability to higher temperatures. SUMMARY

[0003] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides a RNase R mutant with improved reaction temperature and higher thermal stability compared to wild-type RNase R.

[0004] The present application also provides a recombinant protein.

[0005] The present application also provides a biological material related to the above-mentioned RNase R mutant or recombinant protein.

[0006] The present application also provides an enzyme preparation.

[0007] The present application also provides a preparation method of the above-mentioned RNase R mutant or recombinant protein.

[0008] The present application also provides applications related to the above-mentioned RNase R mutant, recombinant protein, biological material, or enzyme preparation.

[0009] The present application also provides a kit.

[0010] According to the first aspect of the present application, the RNase R mutant comprises a mutation site H486Q compared to wild-type RNase R, and the amino acid sequence of the wild-type RNase R is shown in SEQ ID NO: 1.

[0011] According to the RNase R mutant of the present application, at least the following beneficial effects are achieved:

[0012] Compared with the wild-type RNase R, the RNase R mutant of the embodiment has a higher reaction temperature, and after being treated at 55℃ for 30min, the RNase R mutant still has a high RNA degradation performance, and the thermal stability is better than that of the wild-type RNase R, and the RNase R mutant has a good application prospect in the fields of degrading linear RNA and preparing circular RNA.

[0013] According to some embodiments of the present application, compared with the wild-type RNase R, the RNase R mutant further comprises at least one of the mutation sites M188E and K385Q.

[0014] According to some embodiments of the present application, compared with the wild-type RNase R, the RNase R mutant comprises any one of the following groups of mutation sites:

[0015] A1), H486Q;

[0016] A2), K385Q, H486Q;

[0017] A3), M188E, K385Q, H486Q.

[0018] According to some embodiments of the present application, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7, respectively.

[0019] According to some embodiments of the present application, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 3, and the reaction temperature for degrading the linear RNA is 35℃-45℃. For example, it can be 35℃, 36℃, 37℃, 38℃, 39℃, 40℃, 41℃, 42℃, 43℃, 44℃ or 45℃.

[0020] According to some embodiments of the present application, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 3, and the reaction time for degrading the linear RNA is 5min-30min. For example, it can be 5min, 10min, 15min, 20min, 25min or 30min.

[0021] According to some embodiments of the present application, the amino acid sequence of the RNase R mutant is shown in SEQ ID NO: 5, and the reaction temperature for degrading the linear RNA is 35℃-45℃. For example, it can be 35℃, 36℃, 37℃, 38℃, 39℃, 40℃, 41℃, 42℃, 43℃, 44℃ or 45℃.

[0022] According to some embodiments of the present application, the RNase R mutant has an amino acid sequence as shown in SEQ ID NO: 5, and the reaction time for degrading the linear RNA is 5 min to 30 min. For example, the reaction time can be 5 min, 10 min, 15 min, 20 min, 25 min, or 30 min.

[0023] According to some embodiments of the present application, the RNase R mutant has an amino acid sequence as shown in SEQ ID NO: 7, and the reaction temperature for degrading the linear RNA is 35°C to 55°C. For example, the reaction temperature can be 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, or 55°C.

[0024] According to some embodiments of the present application, the RNase R mutant has an amino acid sequence as shown in SEQ ID NO: 7, and the reaction time for degrading the linear RNA is 5 min to 30 min. For example, the reaction time can be 5 min, 10 min, 15 min, 20 min, 25 min, or 30 min.

[0025] According to some embodiments of the second aspect of the present application, the recombinant protein comprises a tag and the RNase R mutant.

[0026] According to some embodiments of the present application, the tag is connected to the N-terminus or / and the C-terminus of the RNase R mutant.

[0027] According to some embodiments of the present application, the tag comprises at least one of a tag facilitating solubilization, purification, and detection of the RNase R mutant. It can be understood that the RNase R mutant of the present application can comprise one or more tags; the multiple tags can comprise a combination of multiple identical tags, or a combination of multiple different tags. For example, the tag facilitating solubilization of the RNase R mutant includes but is not limited to a nus tag or a maltose binding protein tag; the tag facilitating purification of the RNase R mutant includes but is not limited to a strep tag, a His tag, a GST tag, a pelB signal tag, or an ompA signal tag; the tag facilitating detection of the RNase R mutant includes but is not limited to a horseradish peroxidase (HRP) tag, a beta-galactosidase tag, a luciferase tag, a green fluorescent protein (GFP) tag, an HcRed tag, a DsRed tag, or a cyan fluorescent protein (CFP) tag. The tag can be specifically a His tag.

[0028] According to the third aspect of the present application, the biological material associated with the RNase R mutant of the first aspect of the present application or the recombinant protein of the second aspect of the present application is any one of B1) to B4):

[0029] B1) a nucleic acid molecule encoding the RNase R mutant of the first aspect of the present application or the recombinant protein of the second aspect of the present application;

[0030] B2) an expression cassette comprising the nucleic acid molecule of B1);

[0031] B3) a recombinant vector comprising the nucleic acid molecule of B1) or the expression cassette of B2);

[0032] B4) a recombinant biological cell comprising the nucleic acid molecule of B1), the expression cassette of B2), or the recombinant vector of B3).

[0033] According to some embodiments of the present application, the nucleic acid molecule is any one of B11) to B14):

[0034] B11) a DNA molecule having the nucleotide sequence as set forth in SEQ ID NO: 4;

[0035] B12) a DNA molecule having the nucleotide sequence as set forth in SEQ ID NO: 6;

[0036] B13) a DNA molecule having the nucleotide sequence as set forth in SEQ ID NO: 8;

[0037] B14) a DNA molecule having 80%, 85%, or 90% or more homology to the nucleotide sequence as set forth in B11), B12), or B13), and encoding the RNase R mutant;

[0038] B15) a DNA molecule hybridizing to the nucleotide sequence as defined in any one of B11) to B13) under stringent conditions, and encoding the RNase R mutant.

[0039] According to some embodiments of the present application, the stringent conditions can be hybridization in a solution of 2xSSC, 0.1% SDS at 68°C and washing the membrane twice for 5 min each time, or hybridization in a solution of 0.5xSSC, 0.1% SDS at 68°C and washing the membrane twice for 15 min each time.

[0040] According to some embodiments of the present application, the expression cassette refers to DNA capable of expressing the RNase R mutant in a host cell. The DNA can include not only a promoter for initiating transcription of the RNase R mutant coding gene, but also a terminator for terminating transcription of the RNase R mutant coding gene. Further, the expression cassette can also include an enhancer sequence.

[0041] According to some embodiments of the present application, the vector can be a plasmid, a cosmid, a bacteriophage or a viral vector. For example, it can be a PET-28a vector.

[0042] According to some embodiments of the present application, the recombinant vector can be a recombinant vector obtained by inserting a DNA molecule encoding the RNase R mutant into a multiple cloning site of the vector.

[0043] According to some embodiments of the present application, the biological cell includes a prokaryotic cell and a eukaryotic cell. The prokaryotic cell includes bacteria or algae. The eukaryotic cell includes fungi, mammalian cells or insect cells. Among them, the bacteria can be E. coli, such as E. coli DH5a or E. coli BL21. The recombinant organism does not contain reproductive material.

[0044] According to some embodiments of the present application, the recombinant biological cell is a recombinant biological cell obtained by introducing B1) the nucleic acid molecule, B2) the expression cassette or B3) the recombinant vector into a biological cell. Specifically, it can be a recombinant E. coli obtained by introducing a recombinant vector into E. coli DH5a or E. coli BL21.

[0045] According to some embodiments of the fourth aspect of the present application, an enzyme preparation includes the RNase R mutant described in the first aspect of the present application or the recombinant protein described in the second aspect of the present application.

[0046] According to some embodiments of the present application, the enzyme preparation further includes a reaction premix.

[0047] According to some embodiments of the present application, the reaction premix includes at least one of Tris-HCl, Mg 2+ , K + .

[0048] According to some embodiments of the present application, the source of Mg 2+ includes at least one of magnesium chloride, magnesium acetate and magnesium sulfate.

[0049] According to some embodiments of the present application, the source of K + includes at least one of potassium chloride, potassium acetate and potassium sulfate.

[0050] According to some embodiments of the present application, the reaction premix solution comprises 10-50 mmol / L Tris-HCl, 0.1-0.2 mmol / L Mg 2+ , 100-150 mmol / L K + . For example, the reaction premix solution can comprise 20 mM Tris-HCl, 0.1 mM MgCl2 and 100 mM KCl. The reaction premix solution is preferably selected so as not to affect the activity of the RNase R mutant or recombinant protein.

[0051] According to some embodiments of the present application, the pH of the reaction premix solution is 7.5-8.5. For example, it can be 8.0.

[0052] According to the method for preparing the RNase R mutant of the first aspect of the present application according to the fifth aspect of the present application, the method comprises:

[0053] The coding gene of the RNase R mutant of the first aspect of the present application or the recombinant protein of the second aspect of the present application is introduced into a biological cell, so that the coding gene is expressed, and the RNase R mutant is obtained.

[0054] According to some embodiments of the present application, the biological cell comprises prokaryotic cells and eukaryotic cells.

[0055] According to some embodiments of the present application, the prokaryotic cell comprises bacteria or algae. The bacteria can be E. coli (such as E. coli BL21).

[0056] According to some embodiments of the present application, the eukaryotic cell comprises fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0057] According to the application of the seventh aspect of the present application.

[0058] According to some embodiments of the present application, the application is the application of the RNase R mutant of the first aspect of the present application, the recombinant protein of the second aspect of the present application or the enzyme preparation of the fourth aspect of the present application in any one of C1) to C3),

[0059] C1), purifying circular RNA;

[0060] C2), degrading linear RNA;

[0061] C3), identifying circular RNA and / or linear RNA.

[0062] According to some embodiments of the present application, the application is any one of D1) to D4) in any one of E1) to E3),

[0063] D1), the RNase R mutant as described in the first aspect of the present application;

[0064] D2), the recombinant protein as described in the second aspect of the present application;

[0065] D3), the biomaterial as described in the third aspect of the present application;

[0066] D4), the enzyme preparation as described in the fourth aspect of the present application;

[0067] E1), a product for preparing purified circular RNA

[0068] E2), a product for preparing degraded linear RNA;

[0069] E3), a product for identifying circular RNA and / or linear RNA.

[0070] A kit according to the eighth aspect of the present application, comprising the RNase R mutant, the recombinant protein or the enzyme preparation as described above.

[0071] A method for degrading linear RNA according to the ninth aspect of the present application, comprising the steps of:

[0072] contacting the linear RNA with the RNase R mutant as described in the first aspect of the present application or the recombinant protein as described in the second aspect of the present application.

[0073] Other features and advantages of the present application will be set forth in the following description, and in part will become apparent from the description, or can be learned by practice of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0074] Figure 1 A three-dimensional modeling structure of the mutation site of the RNase R mutant;

[0075] Figure 2 An electropherogram of each RNase R after expression and purification; M is a protein marker, and lanes 1-4 are enzyme protein samples RNase R-wt, RNase R-w1, RNase R-w2, and RNase R-w3, respectively;

[0076] Figure 3 A statistical graph of the Tm values of different RNase R;

[0077] Figure 4The degradation effect of different RNase Rs on linear RNA after reacting at 37℃ for 10 min is shown in Figure 1. A: RNase R-wt, B: RNase R-w1, C: RNase R-w2, D: RNase R-w3. In each figure, M represents GL DNAMarker 2000, lanes 1-5 are the experimental groups with 10 ng, 20 ng, 30 ng, 40 ng, and 50 ng of enzyme added, respectively, and lane 6 is the negative control group without enzyme added.

[0078] Figure 5 The degradation effect of different RNase Rs on linear RNA after 10 min of reaction at different temperatures is shown in Figure 1. A: RNase R-wt (37℃), B: RNase R-w1 (40℃), C: RNase R-w2 (40℃), D: RNase R-w3 (50℃). In each figure, M represents GL DNAMarker 2000, lane 1 is the negative control group without enzyme addition, and lanes 2-6 are the experimental groups with 10 ng, 20 ng, 30 ng, 40 ng, and 50 ng of enzyme added, respectively.

[0079] Figure 6 The degradation effect of different RNase Rs on linear RNA after heat treatment at 37℃ for 30 min at the optimal reaction temperature is shown in Figure 1. A: RNase R-wt, B: RNase R-w1, C: RNase R-w2, D: RNase R-w3. In each figure, M represents GL DNAMarker 2000, lane 1 is the negative control group without enzyme addition, and lanes 2-6 are the experimental groups with 10ng, 20ng, 30ng, 40ng, and 50ng of enzyme added, respectively.

[0080] Figure 7 The degradation effect of different RNase Rs on linear RNA after heat treatment at 55℃ for 30 min at the optimal reaction temperature is shown in Figure 1. A: RNase R-wt, B: RNase R-w1, C: RNase R-w2, D: RNase R-w3. In each figure, M represents GL DNAMarker 2000, lane 1 is the negative control group without enzyme addition, and lanes 2-6 are the experimental groups with 10ng, 20ng, 30ng, 40ng, and 50ng of enzyme added, respectively.

[0081] Figure 8The results of the detection of the selective degradation performance of different RNase R on linear RNA at the optimum reaction temperature; A: the substrate template is single-stranded RNA, B: the substrate template is circular RNA, C: the substrate template is a mixture of single-stranded RNA and circular RNA; in each figure, lane 1 is the negative control group without adding enzyme reaction, and lanes 2-5 are the experimental groups added with RNase R-wt, RNase R-w1, RNase R-w2, and RNase R-w3, respectively. DETAILED DESCRIPTION

[0082] The concept and technical effects of the present application will be described below in conjunction with examples for a clear and complete description, so as to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only part of the examples of the present application, but not all examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0083] The specific conditions not specified in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be purchased on the market.

[0084] In the description of the present application, the terms "comprising" and "having" and any variations thereof are intended to cover non-exclusive inclusion, for example, a process, method or product comprising a series of steps or units does not have to be limited to the clearly listed steps or units, but can include other steps or units that are not clearly listed or inherent to these processes, methods or products.

[0085] Unless specifically defined, all scientific or technical terms used in this patent are consistent with the ordinary understanding of most people in the field.

[0086] The following amino acid sequences are in the order from N-terminal to C-terminal; the nucleotide sequences are in the order from 5'-terminal to 3'-terminal.

[0087] In order to obtain RNase R with improved thermal stability, wild-type RNase R (RNase R-wt) was mutated and a large number of screening was carried out, and a plurality of RNase R mutants (RNase R-w1 to w3) were obtained. Among them, the amino acid sequence of RNase R-wt is shown as SEQ ID NO: 1, and the nucleotide sequence of the DNA molecule encoding RNase R-wt is shown as SEQ ID NO: 2.

[0088] MSQDPFQEREAEKYANPIPSREFILEHLTKREKPASRDELAVELHIEGEEQLEGLRRRLRAMERDGQLVFTRRQCYALPERLDLVKGTVIGHRDGYGFLRVEGRKDDLYLSSEQMKTCIHGDQVLAQPLGADRKGRREARIVRVLVPKTSQIVGRYFTEAGVGFVVPDDSRLSFDILIPPDQIMGARMGFVVVVELTQRPTRRTKAVGKIVEVLGDNMGTGMAVDIALRTHEIPYIWPQAVEQQVAGLKEEVPEEAKAGRVDLRDLPLVTIDGEDARDFDDAVYCEKKRGGGWRLWVAIADVSYYVRPSTPLDREARNRGTSVYFPSQVIPMLPEVLSNGLCSLNPQVDRLCMVCEMTVSSKGRLTGYKFYEAVMSSHARLTYTKVWHILQGDQDLREQYAPLVKHLEELHNLYKVLDKAREERGGISFESEEAKFIFNAERRIERIEQTQRNDAHKLIEECMILANISAARFVEKAKEPALFRIHDKPSTEAITSFRSVLAELGLELPGGNKPEPRDYAELLESVADRPDAEMLQTMLLRSMKQAIYDPENRGHFGLALQSYAHFTSPIRRYPDLTLHRAIKYLLAKEQGHQGNTTETGGYHYSMEEMLQLGQHCSMAERRADEATRDVADWLKCDFMLDQVGNVFKGVISSVTGFGFFVRLDDLFIDGLVHVSSLDNDYYRFDQVGQRLMGESSGQTYRLGDRVEVRVEAVNMDERKIDFSLISSERAPRNVGKTAREKAKKGDAGKKGGKRRQVGKKVNFEPDSAFRGEKKTKPKAAKKDARKAKKPSAKTQKIAAATKAKRAAKKKVAE (SEQ ID NO: 1).

[0089]

[0090] The RNase R mutant (RNase R-w1) is formed based on the amino acid sequence of RNase R-wt, and the specific amino acid mutation is H486Q. The amino acid sequence is specifically shown in SEQ ID NO: 3, and the corresponding nucleotide sequence is shown in SEQ ID NO: 4.

[0091] MSQDPFQEREAEKYANPIPSREFILEHLTKREKPASRDELAVELHIEGEEQLEGLRRRLRAMERDGQLVFTRRQCYALPERLDLVKGTVIGHRDGYGFLRVEGRKDDLYLSSEQMKTCIHGDQVLAQPLGADRKGRREARIVRVLVPKTSQIVGRYFTEAGVGFVVPDDSRLSFDILIPPDQIMGARMGFVVVVELTQRPTRRTKAVGKIVEVLGDNMGTGMAVDIALRTHEIPYIWPQAVEQQVAGLKEEVPEEAKAGRVDLRDLPLVTIDGEDARDFDDAVYCEKKRGGGWRLWVAIADVSYYVRPSTPLDREARNRGTSVYFPSQVIPMLPEVLSNGLCSLNPQVDRLCMVCEMTVSSKGRLTGYKFYEAVMSSHARLTYTKVWHILQGDQDLREQYAPLVKHLEELHNLYKVLDKAREERGGISFESEEAKFIFNAERRIERIEQTQRNDAHKLIEECMILANISAARFVEKAKEPALFRIQDKPSTEAITSFRSVLAELGLELPGGNKPEPRDYAELLESVADRPDAEMLQTMLLRSMKQAIYDPENRGHFGLALQSYAHFTSPIRRYPDLTLHRAIKYLLAKEQGHQGNTTETGGYHYSMEEMLQLGQHCSMAERRADEATRDVADWLKCDFMLDQVGNVFKGVISSVTGFGFFVRLDDLFIDGLVHVSSLDNDYYRFDQVGQRLMGESSGQTYRLGDRVEVRVEAVNMDERKIDFSLISSERAPRNVGKTAREKAKKGDAGKKGGKRRQVGKKVNFEPDSAFRGEKKTKPKAAKKDARKAKKPSAKTQKIAAATKAKRAAKKKVAE (SEQ ID NO: 3).

[0092]

[0093] The RNase R mutant (RNase R-w2) is formed based on the amino acid sequence of RNase R-wt, and the specific amino acid mutations are K385Q and H486Q. The amino acid sequence is specifically shown in SEQ ID NO: 5, and the corresponding nucleotide sequence is shown in SEQ ID NO: 6.

[0094] MSQDPFQEREAEKYANPIPSREFILEHLTKREKPASRDELAVELHIEGEEQLEGLRRRLRAMERDGQLVFTRRQCYALPERLDLVKGTVIGHRDGYGFLRVEGRKDDLYLSSEQMKTCIHGDQVLAQPLGADRKGRREARIVRVLVPKTSQIVGRYFTEAGVGFVVPDDSRLSFDILIPPDQIMGARMGFVVVVELTQRPTRRTKAVGKIVEVLGDNMGTGMAVDIALRTHEIPYIWPQAVEQQVAGLKEEVPEEAKAGRVDLRDLPLVTIDGEDARDFDDAVYCEKKRGGGWRLWVAIADVSYYVRPSTPLDREARNRGTSVYFPSQVIPMLPEVLSNGLCSLNPQVDRLCMVCEMTVSSKGRLTGYKFYEAVMSSHARLTYTQVWHILQGDQDLREQYAPLVKHLEELHNLYKVLDKAREERGGISFESEEAKFIFNAERRIERIEQTQRNDAHKLIEECMILANISAARFVEKAKEPALFRIQDKPSTEAITSFRSVLAELGLELPGGNKPEPRDYAELLESVADRPDAEMLQTMLLRSMKQAIYDPENRGHFGLALQSYAHFTSPIRRYPDLTLHRAIKYLLAKEQGHQGNTTETGGYHYSMEEMLQLGQHCSMAERRADEATRDVADWLKCDFMLDQVGNVFKGVISSVTGFGFFVRLDDLFIDGLVHVSSLDNDYYRFDQVGQRLMGESSGQTYRLGDRVEVRVEAVNMDERKIDFSLISSERAPRNVGKTAREKAKKGDAGKKGGKRRQVGKKVNFEPDSAFRGEKKTKPKAAKKDARKAKKPSAKTQKIAAATKAKRAAKKKVAE (SEQ ID NO: 5).

[0095]

[0096] The RNase R mutant (RNase R-w3) is formed based on the amino acid sequence of RNase R-wt, and the specific amino acid mutations are M188E, K385Q, H486Q. The amino acid sequence is specifically shown in SEQ ID NO: 7, and the corresponding nucleotide sequence is shown in SEQ ID NO 8.

[0097] MSQDPFQEREAEKYANPIPSREFILEHLTKREKPASRDELAVELHIEGEEQLEGLRRRLRAMERDGQLVFTRRQCYALPERLDLVKGTVIGHRDGYGFLRVEGRKDDLYLSSEQMKTCIHGDQVLAQPLGADRKGRREARIVRVLVPKTSQIVGRYFTEAGVGFVVPDDSRLSFDILIPPDQIMGAREGFVVVVELTQRPTRRTKAVGKIVEVLGDNMGTGMAVDIALRTHEIPYIWPQAVEQQVAGLKEEVPEEAKAGRVDLRDLPLVTIDGEDARDFDDAVYCEKKRGGGWRLWVAIADVSYYVRPSTPLDREARNRGTSVYFPSQVIPMLPEVLSNGLCSLNPQVDRLCMVCEMTVSSKGRLTGYKFYEAVMSSHARLTYTQVWHILQGDQDLREQYAPLVKHLEELHNLYKVLDKAREERGGISFESEEAKFIFNAERRIERIEQTQRNDAHKLIEECMILANISAARFVEKAKEPALFRIQDKPSTEAITSFRSVLAELGLELPGGNKPEPRDYAELLESVADRPDAEMLQTMLLRSMKQAIYDPENRGHFGLALQSYAHFTSPIRRYPDLTLHRAIKYLLAKEQGHQGNTTETGGYHYSMEEMLQLGQHCSMAERRADEATRDVADWLKCDFMLDQVGNVFKGVISSVTGFGFFVRLDDLFIDGLVHVSSLDNDYYRFDQVGQRLMGESSGQTYRLGDRVEVRVEAVNMDERKIDFSLISSERAPRNVGKTAREKAKKGDAGKKGGKRRQVGKKVNFEPDSAFRGEKKTKPKAAKKDARKAKKPSAKTQKIAAATKAKRAAKKKVAE (SEQ ID NO: 7).

[0098]

[0099] Example 1

[0100] 1. Construction of expression vector:

[0101] Based on the nucleotide sequence information of RNase R-wt, RNase R-wl to RNase R-w3, Hunan Aikuer Biological Engineering Co., Ltd. designed a nucleotide sequence containing coding histidine tag (HHHHHHHHH) and connecting peptide (GS) at the 3' end, i.e. ATGCATCACCACCATCACCATCACCACGGTAGC (SEQ ID NO: 9), and synthesized the corresponding DNA molecule, then the DNA molecule was connected with PET-28a vector by overlap PCR, to obtain recombinant expression vectors PET-28a / RNase R-wt, PET-28a / RNase R-wl, PET-28a / RNase R-w2 and PET-28a / RNase R-w3.

[0102] Further, the above-mentioned recombinant expression vectors were used as templates for PCR amplification, then the recovered PCR products were purified using SteadyPure PCR reaction liquid purification kit (Hunan Aikuer Biological Engineering Co., Ltd., item number AG21003), and the recovered products were transformed into DH5a competent cells, and positive monoclonal cells were screened and sequenced for verification. After verification, the results were consistent with the expected results.

[0103] 2. Expression:

[0104] The recombinant expression vectors capable of expressing wild-type RNase R or RNase R mutants were transformed into host cells E. coli BL21 (DE3), respectively, single colonies were picked and inoculated into 10 mL LB medium containing 50 μg / mL ampicillin, and placed in a 37°C shaker for overnight culture. Then, 200 mL of LB medium containing 50 μg / mL ampicillin was inoculated at a volume ratio of 1:100, and cultured in a 37°C shaker until the OD 600 was 0.6-0.8. IPTG was added to a final concentration of 1.0 mmol / L, the temperature was reduced to 25°C, and the induction was continued for 12-16 h. The induced bacteria were collected by centrifugation and weighed, and the wet weight of the bacteria was recorded and stored at -80°C.

[0105] 3. Purification:

[0106] Take the induced expression of -80 ℃ frozen bacteria, according to the wet weight of each gram of bacteria to add 5 mL lysis buffer (25 mM Tris-HCl, 150 mM NaCl, 20 mM imidazol, pH 7.5) resuspended bacteria, bacteria were lysed with high pressure disruptor, high pressure crushing conditions for 650 bar, three cycles of crushing, the lysed bacteria were centrifuged at 4 ℃, 12000 rpm for 30 min, and the supernatant A was taken into a 200 mL sterilized beaker, and the precipitate A was discarded.

[0107] After equilibrating the chromatography column Ni-NTA Purose 6Fast Flow (purchased from Jiaxing Qianpure Biotechnology Co., Ltd.) with buffer A (25 mM Tris-HCl, 150 mM NaCl, 20 mM imidazol, pH 7.5), the supernatant A was loaded into the chromatography column. After loading, the column was first washed with buffer A, and then eluted with buffer B (25 mM Tris-HCl, 150 mM NaCl, 700 mM imidazol, pH 7.5) at a gradient of 0% to 100%. The elution fractions were detected by SDS-PAGE protein electrophoresis, and the eluate A containing the target protein was collected according to the detection results. The eluate A was dialyzed into enzyme storage solution (50 mM Tris-HCl, 0.1 mM EDTA, 150 mM NaCl, 0.1% (v / v) Triton X-100, 1 mM DTT, 50% (v / v) glycerol, pH 7.5), and the dialysate A was collected.

[0108] 30 μL of each protein dialysate A obtained was analyzed by SDS-PAGE electrophoresis to analyze the purification results. The results are shown in Figure 2

[0109] Detection Example 1

[0110] In this detection example, the melting temperature (Tm value) of RNase R was detected by differential scanning fluorimetry (DSF). There are fluorescent dye binding sites in proteins that are sensitive to the environment. In the natural state, the dye binds weakly, and when the temperature rises, the protein denatures and the hydrophobic region is exposed, the dye binding is enhanced, and the fluorescence intensity changes significantly. By monitoring the curve of the change of fluorescence signal intensity with temperature, the temperature corresponding to the midpoint of the sharp change of fluorescence intensity in the curve is the melting point (Tm), which can reflect the thermal stability of the protein and the protein-ligand interaction. The higher the measured Tm value, the stronger the thermal stability of the protein.

[0111] (1) RNase R-wt, RNase R-w1 to RNase R-w3 were diluted with enzyme storage solution, and Micro BCA Protein Assay Kit (purchased from Thermo Fisher Scientific) was used to determine the protein concentration. TM ​Protein Assay Kit (purchased from Thermo Fisher Scientific, item number 23235) was used to determine the protein concentration, and the specific concentration determination method was referred to the kit instruction.

[0112] (2) 20 μL reaction system (20 mmol / L HEPES-KOH, 150 mmol / L KCl, 1 mg enzyme, 20 × SYPRO Orange fluorescent dye (purchased from Hunan Aikuo Rui Biological Engineering Co., Ltd., item number AG31002), pH 8.0) was placed in a fluorescence quantitative PCR instrument, the excitation and emission wavelengths were adjusted to the corresponding wavelengths of the fluorescent dye, the temperature rise rate was set to 1 ℃ / 10 s, and the temperature change range was from 25 ℃ to 99 ℃, and the fluorescence intensity was determined every 1-3 ℃. After the reaction was completed, the fluorescence intensity-temperature change curve was drawn by the data processing software Protein Thermal Shift Software, and the Tm value and related parameters of the protein sample were calculated.

[0113] The results are shown in Figure 3 .

[0114] The Tm value of RNase R-wt was 51.12 ℃, the Tm value of RNase R-w1 was 53.48 ℃, the Tm value of RNase R-w2 was 53.11 ℃, and the Tm value of RNase R-w3 was 55.29 ℃. The Tm values of RNase R mutants RNase R-w1 to RNase R-w3 were all improved relative to RNase R-wt, which indicated that the thermal stability of RNase R mutants RNase R-w1 to RNase R-w3 was higher than that of RNase R-wt.

[0115] Detection Example 2

[0116] The optimal reaction temperature at which the wild-type RNase R exerts its degradation performance is 37 ℃. The optimal reaction temperature at which the RNase R mutants degrade linear RNA was detected in this detection example.

[0117] (1) The total RNA of E. coli JM109 was extracted using SteadyPure Universal RNA Extraction Kit (purchased from Hunan Aikuo Rui Biological Engineering Co., Ltd., item number AG21017), and the same gradient of protein amount of RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) was added to the template, and the performance was determined by the degradation degree of the electrophoresis band of the reaction product. The specific steps are as follows:

[0118] RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) were diluted to about 10 ng / μL using enzyme storage solution, respectively. 50 μL reaction system containing 500 ng template was prepared for reaction, and the specific reaction system is shown in Table 1:

[0119] Table 1:

[0120]

[0121]

[0122] wherein 1x reaction buffer contains 20 mM Tris-HCl, 0.1 mM MgCl2 and 100 mM KCl, pH 8.0. The reaction conditions are: 37℃ for 10 min, 70℃ for 10 min. The reaction system without adding enzyme was used as negative control group. After the reaction, 2% agarose gel was used for electrophoretic detection of the reaction product.

[0123] The results are shown in Table 2. Figure 4

[0124] RNase R-wt, RNase R-w1 to RNase R-w3 can all degrade linear RNA at 37℃. Among them, RNase R-wt is more suitable for linear RNA degradation at 37℃.

[0125] (2) According to the steps and results in (1), the reaction conditions were adjusted as follows: RNase R-wt: 37℃ for 10 min, 70℃ for 10 min; RNase R-w1: 40℃ for 10 min, 70℃ for 10 min; RNase R-w2: 40℃ for 10 min, 70℃ for 10 min; RNase R-w3: 50℃ for 10 min, 70℃ for 10 min. The reaction system without adding enzyme was used as negative control group. After the reaction, 2% agarose gel was used for electrophoretic detection of the reaction product.

[0126] The results are shown in Table 3. Figure 5

[0127] After adjusting to the corresponding reaction temperature, the degradation degree of linear RNA by each RNase R mutant is basically consistent with that of RNase R-wt, indicating that the optimal reaction temperature of each RNase R mutant is relatively improved compared with RNase R-wt. Among them, the optimal reaction temperature of RNase R-w1 and RNase R-w2 is improved to 40℃, and the optimal reaction temperature of RNase R-w3 is improved to 50℃.

[0128] Detection Example 3 ​​

[0129] The thermal stability of the RNase R mutants was detected and verified.

[0130] RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) obtained in Example 1 were each diluted to about 10 ng / μL using an enzyme preservation solution, and each sample was subjected to a change detection experiment of linear RNA degradation after being simultaneously heat-treated at 37°C and 55°C for 30 min. The method was consistent with the experiment (2) in Detection Example 2, and after the reaction was completed, the reaction products were subjected to electrophoresis detection using 2% agarose gel.

[0131] The results are shown in Figure 6 and Figure 7 .

[0132] The results show that after being heat-treated at 37°C for 30 min, the degradation degree of linear RNA by RNase R-wt and RNase R mutants is basically consistent, and both have good degradation performance. After being heat-treated at 55°C for 30 min, the degradation degree of linear RNA by RNase R-wt is significantly decreased, and there is still a relatively obvious RNA band under the highest enzyme addition amount; the degradation degree of linear RNA by RNase R-w1 and RNase R-w2 is partially decreased, but the performance is better than that of RNase R-wt; and RNase R-w3 has basically no change, and the degradation performance is roughly equivalent to that after being heat-treated at 37°C for 30 min, and the performance is significantly better than that of RNase R-wt. This indicates that RNase R mutants (RNase R-w1 to RNase R-w3) all have good thermal stability, and RNase R-w3 in particular.

[0133] Detection Example 4

[0134] In this detection example, the selective degradation performance of RNase R mutants on linear RNA was detected. The specific experimental operation process is as follows:

[0135] The single-stranded RNA (AUGCCGUUCAAGUUAAACCUUG (SEQ ID NO: 10)) was synthesized by Hunan Aikore Biological Engineering Co., Ltd., and the circular RNA was prepared using the RNA. The RNase R-wt and RNase R mutants (RNase R-w1 to RNase R-w3) obtained in Example 1 were diluted to about 100 ng / μL using an enzyme preservation solution, and the degradation of linear RNA by each mutant was detected using the same concentration of single-stranded RNA, circular RNA, and a mixture of single-stranded RNA and circular RNA as a substrate template. The method was basically the same as the experiment (2) in Detection Example 2 (the only difference was that the final concentration of the template was 5 μM, and the final content of the enzyme was 100 ng), and after the reaction was completed, the products were detected by electrophoresis using 15% 7M urea gel.

[0136] The results are shown in Table 1. Figure 8

[0137] The results show that after adding each RNase R mutant, the linear single-stranded RNA is completely degraded, while the circular RNA band remains basically unchanged and is not degraded, and part of the by-products can be well removed. This indicates that RNase R-w1 to RNase R-w3 still retain the property of not degrading circular RNA after mutation, laying an experimental foundation for subsequent practical application.

[0138] The embodiments of the application are described in detail above with reference to the accompanying drawings, but the application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application.​

Claims

1. A RNase R mutant, characterized in that, The mutation site of the RNase R mutant is any one of A1) to A3) compared to the wild-type RNase R: A1), H486Q; A2), K385Q, H486Q; A3), M188E, K385Q, H486Q; The amino acid sequence of the wild-type RNase R is shown in SEQ ID NO:

1.

2. A recombinant protein, characterized in that, The RNase R mutant of claim 1 and the tag.

3. Biomaterials associated with the RNase R mutant of claim 1 or the recombinant protein of claim 2, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the RNase R mutant of claim 1 or the recombinant protein of claim 2; B2), an expression cassette containing the nucleic acid molecule of B1); B3), a recombinant vector containing the nucleic acid molecule of B1) or the expression cassette of B2); B4), a recombinant biological cell containing the nucleic acid molecule of B1), the expression cassette of B2), or the recombinant vector of B3).

4. The biomaterial of claim 3, wherein, The nucleic acid molecule is any one of B11) to B14): B11), a DNA molecule of the nucleotide sequence shown in SEQ ID NO: 4; B12), a DNA molecule of the nucleotide sequence shown in SEQ ID NO: 6; B13), a DNA molecule of the nucleotide sequence shown in SEQ ID NO: 8; B14), a DNA molecule having 80%, 85%, or 90% or more homology with the nucleotide sequence shown in B11), B12), or B13), and encoding the RNase R mutant; B15), a DNA molecule hybridizing to the nucleotide sequence defined in any one of B11) to B13) under stringent conditions, and encoding the RNase R mutant.

5. An enzyme preparation, characterized in that, The RNase R mutant of claim 1 or the recombinant protein of claim 2.

6. A method for preparing the RNase R mutant of claim 1 or the recombinant protein of claim 2, comprising the steps of: (a) introducing a mutation into a nucleotide sequence encoding RNase R; (b) expressing the mutated nucleotide sequence; and (c) purifying the RNase R mutant. The RNase R mutant of claim 1 or the recombinant protein of claim 2. The RNase R mutant of claim 1 or the recombinant protein of claim 2.

7. The RNase R mutant of claim 1, the recombinant protein of claim 2, or the enzyme preparation of claim 5 for use in any one of C1) to C3), C1), purifying circular RNA; C2), degrading linear RNA; C3), identifying circular RNA and / or linear RNA.

8. The use of any one of D1) to D4) in any one of E1) to E3), D1), the RNase R mutant of claim 1; D2), the recombinant protein of claim 2; D3), the biological material of claim 3 or 4; D4), the enzyme preparation of claim 5; E1), a product for purifying circular RNA E2), a product for degrading linear RNA; E3), a product for identifying circular RNA and / or linear RNA.

9. A kit characterized in that, The RNase R mutant of claim 1, the recombinant protein of claim 2, or the enzyme preparation of claim 5.

Images