Southwest ghost lamp tree carbon glycosyltransferase rsCGT1 gene and application thereof in preparing umbellata
By heterologously expressing the RsCGT1 gene of *Gynostemma pentaphyllum* in *Escherichia coli*, 4-methoxygallic acid was catalyzed to produce bergenin, solving the problem of bergenin resource shortage and achieving efficient biosynthesis and simplified production.
Patent Information
- Application Number
- CN202510121524.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-26
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-01-26
AI Technical Summary
Existing technologies are insufficient for the effective synthesis of Bergenin, leading to increased market demand and resource shortages. Wild resources are endangered and artificial cultivation is difficult. The lack of key enzyme genes also hinders the advancement of biosynthetic pathways.
The RsCGT1 gene of *Gynostemma pentaphyllum* was provided, and heterologous expression of the recombinant plasmid in *E. coli* was carried out to catalyze the glycosylation of 4-methoxygallic acid at the C-2 position to generate Bergenin.
The targeted biosynthesis of Bergenin was achieved, reducing the need for raw material cultivation, simplifying the production process, reducing the complexity and cost of chemical synthesis, and providing key genes for plant breeding research.
Smart Images

Figure CN119955822B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a Rodger siasambucifolia Hemsl carbon glycosyltransferase RsCGT1 gene and application thereof in preparing bergenin. BACKGROUND
[0002] Rodger siasambucifolia Hemsl is a perennial herb of Rodgersia A.Gray in Saxifragaceae, and is also known as Rodgersia pinnata. There are 5 species of Rodgersia A.Gray, which are distributed in East Asia and the Himalayan region. There are 4 species in China, which are produced in Northeast China, Northwest China, Central China and Southwest China, and mainly produced in Southwest China. There are many medicinal ingredients in Rodgersia pinnata, and bergenin is one of the main effective ingredients. Bergenin has been widely concerned due to its various pharmacological activities, such as antitussive, anti-inflammatory, anxiolytic, antioxidant, antimalarial, anticancer, treatment of diabetes, anti-liver toxicity, immunomodulation and neuroprotection. Unlike morphine, bergenin has a selective inhibitory effect on the cough center, and has no inhibitory effect on other neural centers, and has the characteristics of small toxic and side effects, few adverse reactions, no drug resistance after continuous use, etc. Bergenin has been made into various dosage forms and widely used in the treatment of respiratory diseases in China, such as compound bergenin tablets, bergenin capsules, etc.
[0003] The biosynthetic precursor of bergenin is 2-glucose-4-methoxy gallic acid, which is generated by closing the ring after rearrangement after intramolecular dehydration; 2-glucose-4-methoxy gallic acid is generated by connecting glucose at 2 position with UDP-glucose as a sugar donor under the catalysis of carbon glycosyltransferase (CGT, C-glucosyltransferase); 4-methoxy gallic acid is generated by gallic acid oxygen methylation transferase (OMT, O-methyltransferase) with gallic acid as a substrate and S-adenosyl-methionine (SAM, S-adenosyl-methionine) as a methyl donor; gallic acid is generated by shikimate dehydrogenase (SDH, shikimate dehydrogenases) under the catalysis of NADP+ as a proton donor.
[0004] With the increasing of chronic bronchitis disease, the gap of bergenin raw medicinal materials is increasing. At present, the bergenin raw materials on the market mainly rely on extraction, and the annual demand of dry goods medicinal materials for extracting bergenin has reached more than 2000 tons. The extensive mining in recent decades has caused the wild resource reserves to sharply decrease and be close to exhaustion. At the same time, the high altitude, mountainous area and cold climate in the original place make it difficult to artificially cultivate in large area, which further expands the market gap of bergenin raw materials and the price rises year by year. In recent years, with the rapid development of synthetic biology field, the use of synthetic biology technology to produce natural drug monomer can effectively solve the above problems. However, to clarify the biosynthetic pathway of these active ingredients, it is necessary to identify the related key genes in these pathways, and to explore these catalytic enzyme genes become the key link of studying the biosynthetic pathway of plant metabolites. At present, the synthesis path of 4-methoxygallic acid catalyzed by glycosylation reaction at C-2 position to form 2-glucose-4-methoxygallic acid has been clear, but the function of the carbon glycosyltransferase responsible for glycosylation is less verified, which affects the progress of bergenin biosynthesis work. SUMMARY
[0005] In order to solve the above problems, the present application provides a southwest Cephalotaxus fortunei carbon glycosyltransferase RsCGT1 gene, which can be used as a bergenin biosynthesis regulation gene and applied to the preparation of bergenin.
[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is:
[0007] The first aspect of the present application provides a southwest Cephalotaxus fortunei carbon glycosyltransferase RsCGT1 gene, the nucleic acid sequence of the southwest Cephalotaxus fortunei carbon glycosyltransferase RsCGT1 gene is shown in SEQ ID NO. 1, and the sequence full length is 1458 bp.
[0008]
[0009] The second aspect of the present application provides a protein encoded by the above-mentioned carbon glycosyltransferase RsCGT1 gene of Cynanchum southwestcynanchi, the amino acid sequence of which is as follows: SEQ ID NO. 2, encoding 485 amino acid residues.
[0010] MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSMSNSGNQEPRPHIALLPSAGMGHLNPLLRLTATLAARGCHVTVITPIPTFTAAESEHMDEFFSTYPNISRLKFQIVGDEPPSEFDPPIFLQWQSINRSGHILRPLLTALSPPITALFSDFVAGLCICPIADDLKIPNYFVVTSSARFFSLWALLPYINKSHDDEILIPGLSPFHISTIPPPFFNPNHLFTKLATSNAPLLSKAKGILLNTFDYFEPDTITAIRKGTVLSDLPQVFPIGPLKDYKFGKGNYPTWLDDQEEGSVVYVSFGSRTTLSRDQIRELGDGLERSGFPFLWVLKTSKEDEGELRDLLGDTFFEKTGKKGIVVKGWADQEAILAHPAIGGFVSHCGWNSVTETTRFGVPILAWPQHGDQRLNAEVVEKAGMGVWERDWGWQRERLIKGEEIGEKIEKWMTDEKSKTQAKKIRVEAKKALEANGSSEKALSDLITTLKKN; (SEQ ID NO. 2)
[0011] The third aspect of the present application provides a recombinant plasmid containing the above-mentioned carbon glycosyltransferase RsCGT1 gene of Cynanchum southwestcynanchi.
[0012] As a preference, the recombinant plasmid is obtained by homologous recombination of the above-mentioned carbon glycosyltransferase RsCGT1 gene of Cynanchum southwestcynanchi and a pET28a vector, and is named pET28a-RsCGT1.
[0013] The fourth aspect of the present application provides a genetically engineered bacterium containing the above-mentioned recombinant plasmid, or having the above-mentioned carbon glycosyltransferase RsCGT1 gene of Cynanchum southwestcynanchi integrated into the genome of the genetically engineered bacterium.
[0014] As a preference, the genetically engineered bacterium is Escherichia coli BL21 (DE3) strain.
[0015] The fifth aspect of the present application provides an application of the carbon glycosyltransferase RsCGT1 gene of Aruncus sylvester in preparing bergenin.
[0016] As a preference, 4-methoxy gallic acid and a sugar donor, uridine diphosphate glucose (UDP-glucose), are used as raw materials, a glycosylation reaction is carried out at the C-2 position of 4-methoxy gallic acid under the catalysis of the carbon glycosyltransferase RsCGT1 gene of Aruncus sylvester, and bergenin is generated.
[0017] The present application obtains the target protein after in-vitro expression of the recombinant plasmid, and directly generates bergenin after further catalysis of the substrate 4-methoxy gallic acid.
[0018] The carbon glycosyltransferase RsCGT1 gene of Aruncus sylvester is obtained by extracting the RNA of the rhizome of Aruncus sylvester using an RNA reagent, reverse transcribing the cDNA, and then performing PCR amplification.
[0019] 5'F: ATGGGCAGCAGCCATCA; (SEQ ID NO. 3)
[0020] 3'R: CTAATTTTTCTTCAACGTAGTAATTAAATCAGATAAAGC; (SEQ ID NO. 4)
[0021] In addition, when homologous recombination is performed with the vector pET28a, the RsCGT1 gene needs to be amplified and recovered using a primer with a homologous wall, and the primer with a homologous wall is as follows:
[0022] 5'F: ggtggacagcaaatgggtcgcggatccATGGGCAGCAGCCATCA; (SEQ ID NO. 5)
[0023] 3'R: gagctcgaattcggatccCTAATTTTTCTTCAACGTAGTAATTAAATCAGATAAAGC; (SEQ ID NO. 6)
[0024] The carbon glycosyltransferase RsCGT1 gene isolated and identified from Aruncus sylvester can be used as an important marker gene for molecular assisted breeding of Aruncus sylvester, and can also be used as an important candidate gene for the production of bergenin in the construction of a yeast chassis cell.
[0025] Compared with the prior art, the present application has the following beneficial effects:
[0026] (1) The present application provides the carbon glycosyltransferase RsCGT1 gene of Coptis trifolia var. sinensis, which can be used as a biosynthesis regulation gene of berberine and applied to the preparation of berberine.
[0027] (2) With the rapid development of bioinformatics technology, the mining of key enzyme genes of the berberine biosynthesis pathway has been greatly promoted. The carbon glycosyltransferase RsCGT1 gene of Coptis trifolia var. sinensis, which is a biosynthesis regulation gene of berberine, is identified and successfully verified for the first time, opening up a new method for the biosynthesis of berberine. The present application obtains the target product by means of enzyme catalysis in vitro through the heterologous expression of E. coli proteins, and has the advantages of less by-products and the like.
[0028] (3) The present application also provides a recombinant plasmid containing the carbon glycosyltransferase RsCGT1 gene, a genetically engineered bacterium and a recombinant protein, which lays a foundation for the large-scale synthesis of berberine by a biological engineering method and further researches on the construction of a cell factory for producing berberine.
[0029] (4) The in vitro biosynthesis of berberine has strong controllability, can reduce the demand for raw material planting, produces a single product, facilitates the separation and purification of berberine in the later stage, and can also reduce the problems of difficult chemical synthesis and complex synthesis path. The carbon glycosyltransferase RsCGT1 gene of Coptis trifolia var. sinensis as a key gene for the biosynthesis of berberine can also be used for the breeding research of plants rich in berberine such as Ardisia japonica. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 Synthetic path deduced for berberine.
[0031] Figure 2 Construction schematic diagram of the recombinant expression plasmid Pet28a-RsCGT1.
[0032] Figure 3 Electrophoresis detection result of the recombinant carbon glycosyltransferase RsCGT1 gene of Coptis trifolia var. sinensis. Wherein, M is a nucleic acid marker, and 1 and 2 are positive single colony detection results.
[0033] Figure 4 SDS-PAGE protein electrophoresis detection diagram of the carbon glycosyltransferase RsCGT1 of Coptis trifolia var. sinensis. Wherein, M: protein molecular weight standard; lanes 1, 2, 3, 4, in turn are flow-through eluent, precipitated eluent, 20 mmol / L imidazole eluent, 50 mmol / L imidazole eluent; 5-11 are proteins under 250 mmol / L imidazole eluent.
[0034] Figure 5Figure 4 is a HPLC detection of the glycosylation of 4-methoxygallic acid by the carbon glycosyltransferase RsCGTl of C. fortunei. The abscissa is time, in min, and the ordinate is response value, in mAU. CK: the result of the enzyme inactivation reaction of the control group (4-methoxygallic acid + uridine diphosphate glucose + inactivated carbon glycosyltransferase RsCGTl of C. fortunei); standard: the result of the enzyme activity reaction of the experimental group (4-methoxygallic acid + uridine diphosphate glucose + carbon glycosyltransferase RsCGTl of C. fortunei).
[0035] Figure 6 Figure 5 is a mass spectrum analysis (LC / MS / MS) of the standard. A is the retention time of the standard 4-methoxygallic acid, which is 19.46 min; and B is the retention time of the standard bergenin, which is 20.40 min.
[0036] Figure 7 Figure 6 is a mass spectrum analysis (LC / MS / MS) of the reaction product of the enzyme activity verification reaction. A is the retention time of the substrate 4-methoxygallic acid, which is 19.40 min; and B is the retention time of the reaction product bergenin, which is 20.39 min.
[0037] Figure 8 Figure 7 is a fragment ion spectrum (theoretical molecular weight 328) of the standard bergenin (LC / MS / MS).
[0038] Figure 9 Figure 8 is a fragment ion spectrum (theoretical molecular weight 328) of the reaction product bergenin (LC / MS / MS). DETAILED DESCRIPTION
[0039] The present application will be further described in conjunction with the following examples.
[0040] Those skilled in the art will appreciate that the following examples are included for illustrative purposes only and should not be viewed as limiting on the scope of the present application. If a specific technique or condition is not described in the examples, it will be understood that the technique or condition described in the literature or according to the product manual was used. If the manufacturer of a particular product is not indicated, it will be understood that a conventional product available from a commercial vendor was used.
[0041] Example 1
[0042] After a series of work such as the preparation of cDNA of C. fortunei, the amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate carbon glycosyltransferase RsCGTl gene (RsCGTl) that can catalyze the glycosylation of 4-methoxygallic acid to generate bergenin was finally identified. Figure 1). The operation steps of each stage of the synthesis of rock white sage element are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are commercially available):
[0043] (1) Preparation of cDNA template
[0044] Fresh samples of Cephalotaxus fortunei were taken, sliced, and then quickly frozen in liquid nitrogen for RNA extraction. Total RNA extraction was performed using Magen (Guangzhou Meiji Biological Technology Co., Ltd.) HiPure Plant RNA Mini Kit. After the RNA was detected to be qualified, the TAKARA reverse transcription kit was used to reverse transcribe the RNA into cDNA, which was stored at -20℃ for standby use.
[0045] (2) Gene amplification and recovery
[0046] The primer design software (CE Design) v1.04 was used to design primers for amplifying the carbon glycosyltransferase RsCGT1 gene of Cephalotaxus fortunei, which consisted of primer F (SEQ ID NO. 3) and primer R (SEQ ID NO. 4). According to the operation manual of high-fidelity KOD enzyme, KOD high-fidelity enzyme was used to amplify the gene with rock white sage cDNA as the template. The PCR reaction program was as follows: 94℃, 5min; 94℃, 30S, 58℃, 90S, 72℃, 1min, 35 cycles; 72℃, 7min. After the PCR was completed, gel running was performed to confirm the success of amplification, and then the target band was recovered. The EasyPure Quick Gel Extraction Kit of Beijing Quanshi Gold Biological Technology Co., Ltd. was used for gene gel cutting and recovery. After recovery, the recovery concentration was determined on a NanoReady ultramicro UV-visible spectrophotometer, and finally stored at -20℃ in a refrigerator for standby use. The carbon glycosyltransferase RsCGT1 gene fragment of Cephalotaxus fortunei was obtained, and the nucleic acid sequence thereof was as shown in SEQ ID NO. 1, and the amino acid sequence of the protein was as shown in SEQ ID NO. 2.
[0047] 5'F: ATGGGCAGCAGCCATCA; (SEQ ID NO. 3)
[0048] 3'R: CTAATTTTTCTTCAACGTAGTAATTAAATCAGATAAAGC; (SEQ ID NO. 4)
[0049] In addition, when the southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene fragment with carrier homologous arm is homologously recombined with the carrier pET28a (the homologous arm is E. coli pET28a), the southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene needs to be amplified and recovered using a homologous arm primer (i.e. a homologous arm primer) composed of an upstream homologous arm primer (SEQ ID NO. 5 in the sequence listing) and a downstream homologous arm primer (SEQ ID NO. 6 in the sequence listing), using the southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene as a template, and performing PCR amplification again according to the operation manual of the high-fidelity KOD enzyme to obtain the southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene fragment with the carrier homologous arm.
[0050] Upstream homologous arm primer:
[0051] 5'F: ggtggacagcaaatgggtcgcggatccATGGGCAGCAGCCATCA. (SEQ ID NO. 5)
[0052] Downstream homologous arm primer:
[0053] 3'R: gagctcgaattcggatccCTAATTTTTCTTCAACGTAGTAATTAAATCAGATAAAGC. (SEQ ID NO. 6)
[0054] In the above upstream homologous arm primer (SEQ ID NO. 5) and downstream homologous arm primer (SEQ ID NO. 6), the lowercase letters represent the pET28a homologous arm, and the uppercase letters represent the primer sequence for amplifying the southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene.
[0055] (3) Construction and identification of the gene recombination vector
[0056] The schematic diagram of homologous recombination is shown in detail in Figure 2 . First, the carrier pET28a is linearized by single enzyme digestion using BamH I enzyme to obtain the linearized carrier. When homologous recombination is performed, the components are assembled according to the operation manual of the homologous recombination enzyme, and the concentrations of the pET28a homologous arm represented by the lowercase letters and the amplified southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene fragment and pET28a carrier represented by the uppercase letters are calculated according to the recombination instructions. Finally, the components are added to the PCR reaction tube on ice, and the pET28a homologous arm represented by the lowercase letters and the amplified southwest Cephalotaxus carbon glycosyltransferase RsCGT1 gene are homologously recombined with the pET28a carrier to obtain the recombination plasmid, which is named pET28a-AcCGT64. The results after assembly are detected and sent to the company for sequencing, and the electrophoretic detection results after assembly are shown inFigure 3 , indicating that the assembly is successful. The recombination operation is as follows:
[0057] Table 1 Candidate gene recombination reaction system
[0058]
[0059] wherein, X = (0.02 x pET28a base pair number) ng / linearized pET28a concentration ng / μL; Y = (0.02 x pET28a base pair number) ng / southwest ghost carbon glycosyltransferase RsCGT1 recovery concentration ng / μL, and the inserted gene fragment is the southwest ghost carbon glycosyltransferase RsCGT1 gene fragment inserted with a carrier homologous arm.
[0060] (4) SDS-PAGE protein electrophoresis detection
[0061] After the protein expression pilot test, the protein induction conditions of RsCGT1 are determined as follows: 18℃, 0.1mM IPTG, 220r / min, induction for 12h; then, the bacteria are shaken vigorously, the wall is broken, and the protein supernatant is obtained after high-speed centrifugation (12000r / min). Then, SDS-PAGE protein electrophoresis and detection are performed. The detection results are shown in Figure 4 , Figure 4 which indicates that the RsCGT1 protein can be eluted and purified under the elution of 250mmol / L imidazole.
[0062] (5) Enzyme activity reaction
[0063] The enzyme activity of the southwest ghost carbon glycosyltransferase RsCGT1 gene is determined by the synthesis of berberine through glycosylation reaction, which is carried out in a 1.5mL centrifuge tube. The mixture in the experimental sample reaction system contains: 100mM uridine diphosphate glucose 2 microliters, 100mM 4-methoxy gallic acid 2 microliters, 40μg purified southwest ghost carbon glycosyltransferase RsCGT1 protein, 50mM Tris-HCl buffer (pH 8.0) is added to a total volume of 100μL, and the total volume of the reaction system is 100μL. After incubation at 32℃ for 2 hours, an equal volume of 1M hydrochloric acid is added to terminate the reaction, and the mixture is centrifuged briefly (12000r / min). The supernatant is taken. Finally, the reaction product is detected by HPLC and LC-MS / MS analysis.
[0064] The control group (CK) reaction system: 100mM 4-methoxy gallic acid 2 microliters, 100mM uridine diphosphate glucose 2 microliters, 40μg inactivated purified southwest ghost carbon glycosyltransferase RsCGT1 protein, 50mM Tris-HCl buffer (pH 8.0) is added to a total volume of 100μL, and the total volume of the reaction system is 100μL.
[0065] Standard: 10 mM 4-methoxygallic acid 50 μL, 10 mM bergenin 50 μL.
[0066] (6) Product detection
[0067] The HPLC detection conditions are as follows:
[0068] The instrument used for HPLC detection is Agilent 1290 UPLC. The chromatographic column is XBridge Shield RP18 (4.6 mm x 250 mm, 5 μm), the column temperature is 30°C, the mobile phase for determining bergenin is 0.01% v / v formic acid aqueous solution (A) - acetonitrile (B), gradient elution: 0-8 min, 1%-5% B; 8-13 min, 5%-10% B; 13-20 min, 10%-20% B; 20-25 min, 20%-45% B; 25-35 min, 45%-90% B; 35-38 min, 90%-90% B; 38-45 min, 90%-100% B; elution time: 45 min; injection volume: 10 μL; flow rate: 0.6 ml / min; detection wavelength 270 nm. The detection results are shown in Table 1, indicating that the experimental sample has the production of bergenin under the catalysis of Rhizoma Coptidis glycosyltransferase RsCGT1. Figure 5
[0069] LC-MS / MS detection conditions are as follows:
[0070] In order to further confirm the reaction product detected by HPLC, Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography mass spectrometry (LC / MS / MS) was used for detection: the ion source was in negative ion mode, the voltage was 3500V, the fragmentation voltage was 135V, the cone hole voltage was 60V, the radio frequency voltage was 750V, the scanning range was 100-1000 m / z, and the scanning mode was SRM. The chromatographic conditions are as follows: the chromatographic column is XBridge Shield RP18 (4.6 mm x 250 mm, 5 μm), the column temperature is 32°C, the mobile phase for determining bergenin is 0.01% v / v formic acid aqueous solution (A) - acetonitrile (B), gradient elution: 0-8 min, 1%-5% B; 8-13 min, 5%-10% B; 13-20 min, 10%-20% B; 20-25 min, 20%-45% B; 25-35 min, 45%-90% B; 35-38 min, 90%-90% B; 38-45 min, 90%-100% B elution time: 45 min; injection volume: 10 μL; flow rate: 0.6 ml / min; detection wavelength 270 nm, and the detector is a diode array detector.
[0071] The detection results are shown in Table 2.Figures 6-9 From the results, it can be seen that the product has the same peak time and characteristic fragment ions as the standard bergenin, confirming that the reaction product is bergenin. It is finally concluded that the southwest ghost lamp carbon glycosyltransferase RsCGT1 gene has the ability to catalyze the glycosylation of 4-oxymethyl gallate to generate bergenin.
[0072] The above shows and describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.
Claims
1. A gene of a carbon glycosyltransferase RsCGTl from a southwest China ghostplant, characterized in that, The southwest ghost lamp carbon glycosyltransferase RsCGT1 The nucleic acid sequence of the gene is shown as SEQ ID NO.
1.
2. The CCarbon glycosyltransferase RsCGTl gene- encoded protein of claim 1, characterized in that, The amino acid sequence of the encoded protein is shown as SEQ ID NO.
2.
3. A recombinant plasmid containing the RsCGT1 gene of the carbon glycosyltransferase of Cynanchum thesioides as claimed in claim 1.
4. The recombinant plasmid containing the RsCGT1 gene of *Lysimachia christinae* according to claim 3, characterized in that, The RsCGT1 gene of the carbon glycosyltransferase of Cynanchum thesioides is obtained by homologous recombination with a pET28a vector to obtain a pET28a-RsCGT1 recombinant plasmid.
5. A genetically engineered bacterium, characterized by comprising a polynucleotide encoding a polypeptide having an amino acid sequence of SEQ ID NO:
1. The recombinant plasmid as claimed in claim 3 or 4, or the exogenous RsCGT1 gene of the carbon glycosyltransferase of Cynanchum thesioides as claimed in claim 1 is integrated into the genome of the genetically engineered bacteria.
6. The genetically engineered bacteria of claim 5, wherein, The genetically engineered bacteria are Escherichia coli BL21 (DE3) strains.
7. The use of the RsCGT1 gene of the carbon glycosyltransferase of Cynanchum thesioides as claimed in claim 1 in the preparation of the bergenin.
8. The use of the gene of the carbon glycosyltransferase RsCGT1 of Pyrrosia lingae Ching according to claim 7 for the preparation of pyrrosol, characterized in that, The 4-methoxygallic acid is used as a substrate, and the uridine diphosphate glucose (UDP-glucose) is used as a glycosyl donor, and the glycosylation reaction is carried out at the C-2 position of the 4-methoxygallic acid under the catalysis of the carbon glycosyltransferase of Cynanchum thesioides encoded by the RsCGT1 gene of the carbon glycosyltransferase of Cynanchum thesioides to generate the bergenin.
Citation Information
Patent Citations
Bergenin conjugates, a preparing method thereof and applications thereof
CN108164598A
Ardisia japonica carbon glycosyl transferase AjCGT1 gene and application thereof in preparation of bergenin
CN115873873A