Animal genetic engineering vaccine and preparation method thereof

Abstract

The invention belongs to the technical field of immunology, and particularly relates to an animal gene engineering vaccine which is characterized in that a gene vaccine, namely, a megalocytovirus RBIV-Cl, is taken as a template, the gene engineering vaccine Ml / NI or M2 / N2 is taken as a primer, the gene engineering vaccine is respectively connected to plasmids of an expression vector, the primer M1 is ATGCATGCTAGCTAGCTACTAGCCCC, the primer N1 is GGGGGCTAGCTACACTAGCCCC TGATCATGCTAGTGGGGGGG-3, and the primer N2 is CGTTTTAAA AAATTATCCCT-3, the beneficial effects of the animal gene engineering vaccine are that: the gene engineering vaccine can be used for detecting the megalocytovirus RBIV-Cl and the gene engineering vaccine According to the animal genetic engineering vaccine and the preparation method thereof, by setting a target pathogen determination step, the aiming accuracy and flexibility can be guaranteed, by setting and constructing an expression vector, a target gene can be conveniently and flexibly controlled, follow-up introduction can be assisted, and by setting protein extraction and purification, the purity effect of the vaccine can be guaranteed; the subsequent vaccine efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of immunology, and specifically relates to an animal genetic engineering vaccine and a preparation method thereof. Background Art

[0002] Gene vaccine refers to a DNA vaccine, which is a process in which the gene encoding the exogenous antigen is inserted into a plasmid containing a eukaryotic expression system, and the plasmid is then directly introduced into the human or animal body to allow it to express the antigen protein in the host cells and induce the body to produce an immune response.

[0003] However, some animal genetic engineering vaccines have problems such as poor preparation flexibility, poor targeting accuracy, poor control flexibility and poor vaccine use efficiency. Summary of the invention

[0004] In order to solve the problems raised in the above background technology, the present invention provides an animal genetic engineering vaccine and a preparation method thereof, which has the characteristics of better preparation flexibility, better accuracy and better vaccine use effect.

[0005] To achieve the above objectives, the present invention provides the following technical solutions: an animal genetic engineering vaccine, comprising a genetic vaccine with tumour cell virus RBIV-Cl as a template, the genetic engineering vaccine Ml / NI or M2 / N2 as primers, which are respectively connected to the plasmid of the expression vector.

[0006] Preferably, the primer M1 is ATGCATGCTAGCTAGAACGCT-3, the primer N1 is GGGGGG CTAGCTACTAGCATGATCAGGGGGTAGTCAGCGT-3, the primer M2 is ACGCTGACTACCCCCTGATCATGCTAGTAGCTAGGGGGGG-3, and the primer N2 is CGTTTTAAAAAATTATCCCCT-3.

[0007] Preferably, a method for preparing an animal genetic engineering vaccine comprises the following steps:

[0008] Step 1: Determine the target pathogen: By observing the symptoms, signs and course of the animal, the possible pathogen can be preliminarily determined (for example, if the animal has symptoms such as fever, cough, and difficulty breathing, it may indicate the presence of respiratory diseases), and then specific testing is carried out through microscopic examination, isolation culture, PCR detection and other methods;

[0009] Step 2: Constructing an expression vector: After detection, select appropriate expression elements (such as promoters, terminators, replication origins, etc.) according to the characteristics of the target gene and the type of host cells, and insert the target gene into the vector. Then, introducing the constructed expression vector into the host cell is an important part of the expression process. According to the type of host cells and the characteristics of the expression vector, select an appropriate transformation or transduction method (such as electroporation, chemical transformation, infection, etc.), and introduce the expression vector into the host cell;

[0010] Step 3: Protein extraction and purification: The protein can be extracted and purified by salting out, ion exchange chromatography or affinity chromatography;

[0011] Step 4: Animal immunization test: Finally, the immunogen is inoculated into the animal to stimulate its immune system to produce an immune response, and immune serological testing is performed: by detecting components such as antibodies and complement in the animal serum, the degree and type of response of the animal's immune system can be understood, and by detecting the proliferation of lymphocytes, the activity and function of immune cells can be understood, so as to specifically select a suitable vaccine.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] 1. The present invention can ensure targeting accuracy and flexibility by setting up a target pathogen determination step, can facilitate flexible control of the target gene by setting up the construction of an expression vector, can assist in subsequent introduction, and can ensure the purity of the vaccine and improve the efficiency of subsequent vaccines by setting up protein extraction and purification. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0015] Figure 1 It is a schematic diagram of the process of the present invention;

[0016] Figure 2 A schematic diagram of the process for determining the target pathogen in the present invention;

[0017] Figure 3 The figure is a schematic diagram of the process of constructing the expression vector in the present invention;

[0018] Figure 4 It is a schematic diagram of the process of protein extraction and purification in the present invention;

[0019] Figure 5 It is a schematic diagram of the process of animal immunization test in the present invention. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Example 1

[0022] See also Figure 1-5 The present invention provides the following technical solutions: an animal genetic engineering vaccine, comprising a genetic vaccine with tumour cell virus RBIV-Cl as a template, the genetic engineering vaccine Ml / NI or M2 / N2 as primers, which are respectively connected to the plasmid of the expression vector.

[0023] Specifically, the primer M1 is ATGCATGCTAGCTAGAACGCT-3, the primer N1 is GGG GGGCTAGCTACTAGCATGATCAGGGGGTAGTCAGCGT-3, the primer M2 is ACGCTGACTACCCCCTGATCATGCTAGTAGCTAGGGGGGG-3, and the primer N2 is CGTTTTAAAAAATTATCCCCT-3.

[0024] Specifically, a method for preparing an animal genetic engineering vaccine comprises the following steps:

[0025] Step 1: Determine the target pathogen: By observing the symptoms, signs and course of the animal, the possible pathogen can be preliminarily determined (for example, if the animal has symptoms such as fever, cough, and difficulty breathing, it may indicate the presence of respiratory diseases), and then specific testing is carried out through microscopic examination, isolation culture, PCR detection and other methods;

[0026] Step 2: Constructing an expression vector: After detection, select appropriate expression elements (such as promoters, terminators, replication origins, etc.) according to the characteristics of the target gene and the type of host cells, and insert the target gene into the vector. Then, introducing the constructed expression vector into the host cell is an important part of the expression process. According to the type of host cells and the characteristics of the expression vector, select an appropriate transformation or transduction method (such as electroporation, chemical transformation, infection, etc.), and introduce the expression vector into the host cell;

[0027] Step 3: Protein extraction and purification: The protein can be extracted and purified by salting out, ion exchange chromatography or affinity chromatography;

[0028] Step 4: Animal immunization test: Finally, the immunogen is inoculated into the animal to stimulate its immune system to produce an immune response, and immune serological tests are performed: by testing the antibodies and complement components in the animal serum, the degree and type of the animal's immune system response are understood, and by testing the proliferation of lymphocytes, the activity and function of immune cells are understood, so as to select the appropriate vaccine.

[0029] The working principle and use process of the present invention:

[0030] Step 1: Determine the target pathogen: By observing the symptoms, signs and course of the animal, the possible pathogen can be preliminarily determined (for example, if the animal has symptoms such as fever, cough, and difficulty breathing, it may indicate the presence of respiratory diseases), and then specific testing is carried out through microscopic examination, isolation culture, PCR detection and other methods;

[0031] Step 2: Constructing an expression vector: After detection, select appropriate expression elements (such as promoters, terminators, replication origins, etc.) according to the characteristics of the target gene and the type of host cells, and insert the target gene into the vector. Then, introducing the constructed expression vector into the host cell is an important part of the expression process. According to the type of host cells and the characteristics of the expression vector, select an appropriate transformation or transduction method (such as electroporation, chemical transformation, infection, etc.), and introduce the expression vector into the host cell;

[0032] Step 3: Protein extraction and purification: The protein can be extracted and purified by salting out, ion exchange chromatography or affinity chromatography;

[0033] Step 4: Animal immunization test: Finally, the immunogen is inoculated into the animal to stimulate its immune system to produce an immune response, and immune serological testing is performed: by detecting components such as antibodies and complement in the animal serum, the degree and type of response of the animal's immune system can be understood, and by detecting the proliferation of lymphocytes, the activity and function of immune cells can be understood, so as to specifically select a suitable vaccine.

[0034] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An animal genetic engineering vaccine, comprising a gene vaccine with RBIV-Cl as a template, characterized in that: The genetically engineered vaccine M1 / NI or M2 / N2 is a primer, which is connected to the plasmid of the expression vector respectively.

2. The animal genetic engineering vaccine according to claim 1, characterized in that: The primer M1 is ATGCATGCTAGCTAGAACGCT-3, the primer N1 is GGGGGGCTAGCTACTAGCATGATCAGGGGGTAGTCAGCGT-3, the primer M2 is ACGCTGACTACCCCCTGATCATGCTAGTAG CTAGGGGGGG-3, and the primer N2 is CGTTTTAAAAAATTATCCCCT-3.

3. A method for preparing an animal genetic engineering vaccine, according to claim 1-2, comprising the following steps, characterized in that: Step 1: Determine the target pathogen: By observing the symptoms, signs and course of the animal, the possible pathogen can be preliminarily determined (for example, if the animal has symptoms such as fever, cough, and difficulty breathing, it may indicate the presence of respiratory diseases), and then specific testing is carried out through microscopic examination, isolation culture, PCR detection and other methods; Step 2: Constructing an expression vector: After detection, select appropriate expression elements (such as promoters, terminators, replication origins, etc.) according to the characteristics of the target gene and the type of host cells, and insert the target gene into the vector. Then, introducing the constructed expression vector into the host cell is an important part of the expression process. According to the type of host cells and the characteristics of the expression vector, select an appropriate transformation or transduction method (such as electroporation, chemical transformation, infection, etc.), and introduce the expression vector into the host cell; Step 3: Protein extraction and purification: The protein can be extracted and purified by salting out, ion exchange chromatography or affinity chromatography; Step 4: Animal immunization test: Finally, the immunogen is inoculated into the animal to stimulate its immune system to produce an immune response, and immune serological testing is performed: by detecting components such as antibodies and complement in the animal serum, the degree and type of response of the animal's immune system can be understood, and by detecting the proliferation of lymphocytes, the activity and function of immune cells can be understood, so as to specifically select a suitable vaccine.

Images