Method for improving efficiency of baculovirus vector expression system

Abstract

The invention discloses a method for improving the efficiency of a baculovirus expression system. According to the invention, actin is overexpressed in insect BmN cells, so that the expression of exogenous genes is improved. The principle is as follows: after overexpression of actin, the recruitment efficiency of virus nucleation and late gene polymerase is improved, so that the replication and transcription of recombinant virus containing exogenous genes are promoted. According to the invention, the problem of low protein expression quantity by using the baculovirus is solved, ultrahigh-level expression of the protein is promoted, and the efficiency of a baculovirus expression system is improved.

Description

Technical Field

[0001] The invention belongs to the fields of DNA recombination technology and protein expression technology, and in particular relates to a method for improving the efficiency of a baculovirus expression system by overexpressing protein. Background Art

[0002] Even though the diversity of applications of baculovirus expression vector systems (BEVS) has developed over the years, the basic design remains unchanged. In the baculovirus expression vector system (BEVS), the promoters of the baculovirus polyhedrin (polh) and p10 genes are usually used to drive the expression of foreign genes. Polh and p10 do not rely on host polymerase II transcription but are encoded by their own RNA polymerases, which is a unique regulatory advantage of baculovirus. Although most foreign proteins can be expressed efficiently in BEVS, and the expression of foreign proteins can reach 20% of the total cellular protein, when multiple proteins are co-expressed, the use of multiple strong late promoters will burden the cells, resulting in poor protein yields, and the expression of most foreign proteins is only 0.1%-10% of polyhedrin. In production, if the efficiency of the baculovirus expression system can be improved, it will promote the expression of more foreign proteins.

[0003] After the virus infects the host insect cells, it can use the host's actin to assist the virus to enter the cell, and actin promotes the recruitment of viral RNA polymerase to the late gene promoter region, which helps transcription. Therefore, before viral infection, overexpression of actin in cells is beneficial to the transcription of exogenous genes controlled by polh and p10, thereby improving the efficiency of the exogenous baculovirus expression system. Summary of the invention

[0004] The purpose of the present invention is to solve the deficiencies of the prior art and provide a method for improving the efficiency of a baculovirus expression vector system.

[0005] To achieve the above object, the technical solution adopted by the present invention is: to provide a method for improving the efficiency of a baculovirus vector expression system, comprising the following steps:

[0006] Extract and clone the actin gene from the host cells, connect it to the overexpression vector, and transfect the cultured host cells to overexpress the actin in the host cells;

[0007] The foreign gene is connected to a vector used in a baculovirus expression system, and then transposed to the Bacmid in Escherichia coli to obtain a recombinant Bacmid, which is then transfected into a host cell to construct a recombinant virus;

[0008] Host cells overexpressing actin are infected with the recombinant virus.

[0009] As one embodiment, the host cell is a BmN cell, and the Escherichia coli is DH10Bac.

[0010] As one embodiment, the actin gene is extracted and cloned from the host cell, specifically: host cell RNA is extracted by Trizol, reverse transcribed into cDNA and used as a template to obtain the actin gene by PCR cloning; the overexpression vector is a pIZ / V5-His plasmid.

[0011] Furthermore, the transfecting the cultured host cells specifically comprises: performing transfection after the cells are cultured until the cell quantity reaches 80%.

[0012] As one embodiment, the recombinant Bacmid is transfected into the host cell using lipoinsect.

[0013] Furthermore, the host cells overexpressing actin are infected with the recombinant virus, specifically, the host cells transfected with the overexpression vector connected with the actin gene are cultured for 12 hours and then infected with the recombinant virus at MOI=10.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention cleverly utilizes the advantage that host actin can promote virus entry into the nucleus to improve infection efficiency and promote the recruitment of virus-encoded polymerase. Before recombinant virus infection, the actin content in the cell is increased by transfection, which promotes the recruitment of polymerase and improves the efficiency of transcriptional expression, thereby promoting the expression of exogenous proteins and improving the efficiency of the baculovirus expression system. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Real-time fluorescence quantitative PCR analysis of actin, polh and p10 in BmN cells overexpressing actin (pIZ-actin) and control group (pIZ / V5) in the examples (n=3);

[0017] Figure 2 This is a diagram showing the effect of overexpressing actin on increasing the expression of luciferase reporter enzyme in the embodiment; wherein, Figure 2 (a) is the relative expression activity of luciferase under the control of polh promoter; Figure 2 (b) is the relative expression activity of luciferase under the control of p10 promoter. DETAILED DESCRIPTION

[0018] The following will describe in detail the embodiments, features and aspects of the present invention with reference to the accompanying drawings, but the present invention is not limited thereto. In order to better illustrate the present invention, numerous specific details are given in the following specific embodiments, and it should be understood by those skilled in the art that the present invention can also be implemented without certain specific details.

[0019] The present invention provides a method for improving the efficiency of a baculovirus expression vector system. After infection by baculovirus, the host's actin can be used to promote the recruitment of viral RNA polymerase. The present invention utilizes overexpression of actin in insect BmN cells to increase the expression of exogenous genes. The principle is that overexpression of actin increases the efficiency of viral nuclear entry and late gene polymerase recruitment, thereby promoting the replication and transcription of recombinant viruses containing exogenous genes. The embodiments of the present invention are as follows:

[0020] Material: TRIzol TM Reagents (Invitrogen), reverse transcription kit purchased from TransScript, baculovirus genomic DNA extraction kit purchased from Qiagene, Bombyx mori nuclear polyhedrosis virus BmNPV and Bombyx mori cultured cells BmN were stored in our laboratory. Fetal bovine serum and its culture medium TC-100 were all Gibco products. Bombyx mori BmN cells were supplemented with 10% fetal bovine serum. TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix was purchased from Quanshijin, qPCR SYBR Green Master Mix was purchased from Yeasen. Luciferase reporter gene activity detection kit was purchased from Promega. T4 DNA ligase, BamHI, EcoRI, XhoII and KpnI enzymes were purchased from TaKaRa. Transfection reagents LipoInsect and Lipo8000 were purchased from Bio-Tech.

[0021] (1) Cloning of the silkworm actin gene: RNA from BmN cells was extracted using Trizol, reverse transcribed into cDNA and used as a template; the actin gene was cloned using PCR, actin-F primers were used to amplify actin, and then actin was cut with BamHI and EcoRI and ligated into the pIZ / V5-His plasmid to generate pIZ-actin-Flag.

[0022] (2) Construction of recombinant virus containing exogenous luciferase reporter gene: Recombinant virus was constructed using baculovirus expression system. The luciferase gene was amplified by PCR cloning in PGL4.11 vector using Luc-F-1 and Luc-R-1 primers, and then ligated into pFastBacHTB vector by digestion with BamHI and EcoRI to generate pFast-polh-Luc. Luciferase was amplified from PGL4.11 using Luc-F-2 and Luc-R-2 primers, and then ligated into pFastBacDual vector by digestion with XhoII and KpnI to generate pFast-p10-Luc vector. The constructed recombinant pFast-polh-Luc and pFast-p10-Luc transfer vectors were transposed onto the bacmid in DH10Bac, and the recombinant bacmid was transfected into BmN cells by lipoinsect, thus completing the construction of recombinant viruses vBm-polh-luc and vBm-p10-luc.

[0023] (3) Overexpression of actin: Bombyx mori cells BmN were cultured at 27°C. When the cell mass reached 80%, the cells were transfected with 20 μg of the constructed pIZ-actin-Flag plasmid. The transfection efficiency was determined after the culture was continued for 12 hours.

[0024] (4) Determination of exogenous protein expression: 12 hours after transfection of the pIZ-actin-Flag plasmid, the cells were infected with the above two recombinant viruses at an MOI of 10. 48 hours after infection, the virus-infected cells were fully lysed in a lysis buffer, and the luciferase reporter gene activity was measured using a luciferase reporter gene activity detection kit.

[0025] In the step (1), the number of cycles, temperature and time of the PCR reaction are designed as follows: 94°C template denaturation for 3 minutes; 30 cycles of denaturation at 94°C for 30 seconds, annealing at 57°C for 50 seconds, and extension at 68°C for 1 minute; and the last cycle of extension at 68°C for 7 minutes.

[0026] In the step (1), the primers are designed as follows:

[0027] Forward primer (SEQ ID NO.1):

[0028] 5'- GGATCC ATGTGCGACGAAGAAGTTGCC-3', the underline indicates the BamHI restriction site.

[0029] Reverse primer (SEQ ID NO.2):

[0030] 5'- GAATTCTTACTTATCGTCGTCATCCTTGTAATCGAAGCACTTCCTGTGTAC-3', the underline indicates the EcoRI restriction site.

[0031] In the step (2), the primers are designed as follows:

[0032] Luc-F-1 (SEQ ID NO. 3):

[0033] 5'- GGATCC GGCAATCCGGTACTGTTGGTAAAGC-3'

[0034] Luc-R-1 (SEQ ID NO.4):

[0035] 5'- GAATTC ACGGCGATCTTGCCGCCCTTCTTGGCCTTAAT-3'

[0036] Luc-F-2 (SEQ ID NO.5):

[0037] 5'- CTCGAG GGCAATCCGGTACTGTTGGTAAAGC-3'

[0038] Luc-R-2 (SEQ ID NO.6):

[0039] 5'- GGTACC ACGGCGATCTTGCCGCCCTTCTTGGCCTTAAT-3'

[0040] The underlines from top to bottom represent the restriction sites of BamHI, EcoRI, XhoII and KpnI, respectively.

[0041] In step (3), after transfection, TRIzol TM Total RNA was extracted using PCR reagent (Invitrogen), and cDNA was synthesized from 5 μg of total RNA using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix; forward and reverse primers were used: GCCTCCCTCTCTACCTTCCA (SEQ ID NO.7), CAAGCCTGAATTGAGCAGCC (SEQ ID NO.8) and RT-qPCR assay was performed using qPCR SYBR Green Master Mix, and the empty vector pIZ / V5-His plasmid without actin was used as a blank control. The relative expression level of the selected gene was calculated using the 2-ΔΔCt method. The reaction procedure was 95°C for 5 min, 95°C for 5 s, 60°C for 31 s, and 40 cycles. Each sample was repeated three times. Figure 2 As shown, the expression of luciferase reporter enzyme in the pIZ-actin group (transfected with pIZ-actin-Flag plasmid) was significantly higher than that in the pIZ / V5 group (transfected with the empty vector pIZ / V5-His plasmid without actin).

[0042] In step (4), the Student's t test was used for analysis using GraphPad Prism 7.0 software (Harvey Motulsky, Los Angeles, CA, USA). Figure 1 As shown in the figure, the transcription levels of polh and p10 were significantly increased after overexpression of actin. When P value ≥ 0.05, the difference was considered not significant (ns). When P value < 0.05, the difference was considered significant. When P value < 0.01, the difference was considered highly significant. *P < 0.05; **P < 0.01; ***P < 0.001.

[0043] It should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Without making creative work, any modification, equivalent replacement, improvement, etc., shall be included in the protection scope of the present invention.

Claims

1. A method for improving the efficiency of a baculovirus vector expression system, characterized in that: The following steps are involved: Extract and clone the actin gene from the host cells, connect it to the overexpression vector, and transfect the cultured host cells to overexpress the actin in the host cells; The foreign gene is connected to a vector used in a baculovirus expression system, and then transposed to the Bacmid in Escherichia coli to obtain a recombinant Bacmid, which is then transfected into a host cell to construct a recombinant virus; Host cells overexpressing actin are infected with the recombinant virus.

2. The method according to claim 1, characterized in that The host cell is a BmN cell, and the Escherichia coli is DH10Bac.

3. The method according to claim 1, characterized in that The actin gene is extracted and cloned from the host cell, specifically: host cell RNA is extracted by Trizol, reverse transcribed into cDNA and used as a template to obtain the actin gene by PCR cloning; the overexpression vector is a pIZ / V5-His plasmid.

4. The method according to claim 1, characterized in that: The transfecting the cultured host cells specifically includes: performing the transfection after the cells have been cultured until the cell quantity reaches 80%.

5. The method according to claim 1, characterized in that The recombinant Bacmid is transfected into the host cells and lipoinsect is used.

6. The method according to claim 1, characterized in that The infecting the host cells overexpressing actin with the recombinant virus specifically comprises: culturing the host cells transfected with the overexpression vector connected with the actin gene for 12 hours and then infecting the recombinant virus at an MOI of 10.

Images