Loach sex specific SNP (Single Nucleotide Polymorphism) marker and genetic sex identification method

Abstract

The invention discloses a loach sex-specific SNP (Single Nucleotide Polymorphism) marker and a genetic sex identification method, and belongs to the technical field of fish genetic breeding. The loach sex specificity SNP marker disclosed by the invention is obtained through whole genome re-sequencing and GWAS analysis and screening; according to the loach genetic sex identification method, on the basis that specific primers are designed aiming at the SNP marker, loach genome DNA is used as a template, individual SNP types are obtained through PCR amplification and Sanger sequencing, the homozygous type is female, and the heterozygous type is male. According to the method, the genetic sex of the individual can be accurately identified, pseudo male fish, pseudo female fish and the like obtained through artificial induction can be screened out, sex identification can be carried out in the early development stage of the individual, and the method has the advantages that damage of the tested individual is minimized, and survival is not affected. The method has an important application value in parent sex identification in loach sex control breeding.

Description

Technical Field

[0001] The invention relates to the technical field of fish genetic breeding, and more particularly to a sex-specific SNP marker for loach and a genetic sex identification method. Background Art

[0002] Growth performance is the most important economic trait in farmed fish. Growth differences between males and females are common in fish. For economic fish with significant growth differences between males and females, the farming efficiency is closely related to the sex of the group. Loach is a typical sexually dimorphic fish. Compared with males, female loach has significant advantages in growth and body shape. Therefore, cultivating all-female groups and carrying out single-sex farming are of great production significance for improving the farming efficiency of loach.

[0003] Existing studies have found that the physiological sex of loach is easily affected by the environment (such as water temperature, density, hormones, etc.). Therefore, the physiological sex of loach is not exactly the same as its genetic sex; the traditional gonadal characteristic observation method can only identify the physiological sex. Accurately and quickly identifying the genetic sex of an individual is the first step in carrying out sex-controlled breeding of loach, and sex-specific molecular markers are the most accurate and convincing for identifying the genetic sex of an individual. At the same time, sex-specific molecular markers can also be used to screen out artificially induced pseudo-male fish, pseudo-female fish, or super-male fish. Based on this, there is an urgent need for a widely used molecular marker that can accurately identify genetic sex in order to carry out sex-controlled breeding of loach and gender-related research.

[0004] Therefore, providing a sex-specific SNP marker and genetic sex identification method for loach is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a sex-specific SNP marker for loach and a genetic sex identification method.

[0006] The present invention obtains sex-specific SNP markers of loach through whole genome resequencing and GWAS analysis, and develops specific primers for the markers for genetic sex identification. The traditional gonadal feature observation method can only identify physiological sex, while the sex-specific markers and identification methods of the present invention can accurately identify the genetic sex of individuals, and can screen out pseudo-male fish, pseudo-female fish, etc., and can perform sex identification in the early stage of individual development, with the advantages of minimizing damage to the tested individuals and not affecting survival. The present invention has important application value in parent sex identification in sex-controlled breeding of loach.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] The first object of the present invention is to provide a sex-specific SNP marker for loach, the nucleotide sequence of which is shown in SEQ ID NO.1. Specifically:

[0009] 5'- AGAGGGACAACAGCCAAAG CTCTGGAGCCATTGCTGGCCTCAG CATAAAGAGCGCCGGGAACAGGATGCTAGATCCATCAAAAACAGCTC G ATTTTTTATAGCTACAAAATAAAACTGGCTGG G AAAACGCAATGGGGGAGTTTTATATCAGTGCTATCCAACAGACTG TCCTTGGTCTTCGTTCTGA -3'; SEQ ID NO.1.

[0010] There are two sex-specific SNP sites (positions 91 and 124) in the nucleotide sequence, which are obviously different in the Sanger sequencing peaks of female and male individuals: the sequencing peaks at positions 91 and 124 of males are heterozygous peaks, with genotypes of G / A and A / G, respectively, while the sequencing peaks at positions 91 and 124 of females are homozygous single peaks, with genotypes of G and G, respectively.

[0011] The second object of the present invention is to provide primer sequences for amplifying sex-specific SNP markers of loach.

[0012] The nucleotide sequences of the upstream and downstream primers used to amplify the sex-specific SNP markers of loach are shown in SEQ ID NO.2 and SEQ ID NO.3. Specifically:

[0013] Upstream primer: 5'-AGAGGGACAACAGCCAAAG-3'; SEQ ID NO.2;

[0014] Downstream primer: 5'-TCAGAACGAAGACCAAGGA-3'; SEQ ID NO.3.

[0015] The third object of the present invention is to provide the use of the above-mentioned sex-specific SNP marker and primers thereof in sex identification of loach.

[0016] Furthermore, a method for identifying genetic sex of loach comprises the following steps:

[0017] (1) Extracting genomic DNA from the individual to be tested;

[0018] (2) Using genomic DNA as a template, PCR amplification was performed using SEQ ID NO. 2 and SEQ ID NO. 3, and the amplified products were subjected to Sanger sequencing;

[0019] (3) Read the genotypes of positions 91 and 124 in SEQ ID NO.1: If the sequencing peaks of the two SNP sites are both heterozygous peaks and the genotypes are G / A and A / G respectively, it is determined to be a genetic male; if the sequencing peaks of the two SNP sites are both homozygous single peaks and the genotypes are G and G respectively, it is determined to be a genetic female.

[0020] Furthermore, the PCR amplification system in step (2) includes: 1-2 μL (100 ng / μL) of DNA template, 0.4 μL (10 μmol / μL) of upstream and downstream primers, 10 μL of 2×Taq PCR Mix, and RNase-free ddH2O to 20 μL.

[0021] Furthermore, the PCR amplification procedure in step (2) includes: pre-denaturation at 95°C for 3 min; pre-denaturation at 94°C for 25 s, annealing at 52°C for 25 s, extension at 72°C for 10 s, 35 cycles; and extension at 72°C for 5 min.

[0022] Furthermore, in step (3), the Sanger sequencing peak graph is read using Snapgene software.

[0023] Furthermore, a sex-specific SNP marker and genetic sex identification method for loach are applicable to diploid loach.

[0024] It can be seen from the above technical solution that, compared with the prior art, the present invention discloses a loach sex-specific SNP marker and a genetic sex identification method, which has the following beneficial effects:

[0025] (1) Since the physiological sex of loach is easily affected by the living environment, its physiological sex may not be the same as its genetic sex. Existing methods for identifying the sex of loach, such as observing the gonadal characteristics of mature individuals, observing secondary sexual characteristics such as pectoral fins, and observing tissue sections of sexually immature individuals, can only identify the physiological sex of individuals. The sex-specific SNP markers developed by the present invention can accurately identify the genetic sex of individuals, which is very important for accurately screening pseudo-male and pseudo-female fish in sex-controlled breeding.

[0026] (2) In the existing loach sex identification methods, the mature individual gonadal characteristics observation method and the immature individual tissue section observation method both require the killing of the measured object, resulting in the measured individual being unable to be used as a parent to reproduce the next generation; and the secondary sexual characteristics observation method such as pectoral fins cannot be used for sex identification of immature individuals. The sex-specific SNP markers and identification methods provided by the present invention only require a small amount of fin tissue to extract genomic DNA to complete sex identification. Therefore, the method can complete sex identification in the early stage of individual development (e.g., larval stage), with the advantages of minimizing damage to the measured individual and not affecting survival.

[0027] (3) The sex-specific SNP sites of loach of the present invention are obtained based on whole genome resequencing and GWAS analysis. GWAS analysis can accurately identify genomic regions associated with important economic traits. Therefore, the sex-specific SNP markers of the present invention can not only be used for genetic sex identification, but also for analyzing the key genes and sex determination mechanisms of loach sex determination. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0029] Figure 1 It is the Sanger sequencing peak diagram of the specific SNP marker of the present invention;

[0030] Among them, A is the Sanger sequencing peak diagram of the specific SNP marker in female loach; B is the Sanger sequencing peak diagram of the specific SNP marker in male loach. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The reagents required in the embodiments of the present invention are conventional experimental reagents purchased from commercial channels; the experimental methods not mentioned in detail in the embodiments are conventional experimental methods and will not be described in detail here.

[0033] Example 1

[0034] 1) Extraction of loach genomic DNA

[0035] Thirty male and female loaches were selected, and fin ray tissues were taken for extraction of genomic DNA using the ammonium acetate / isopropanol method.

[0036] 2) Screening of SNP loci significantly associated with sex in loach

[0037] ① Perform whole genome resequencing on the genomic DNA of each individual, use the Bayesian model to detect polymorphic sites in the population, and obtain high-quality SNPs;

[0038] ②Through GWAS (based on FarmCPU model) analysis, SNP sites significantly associated with the sex of loach were discovered.

[0039] 3) Screening of sex-specific SNP markers

[0040] (1) Primer design for amplifying sex-significantly associated SNP sites

[0041] Extract 300 bp flanking sequences upstream and downstream of the SNP sites with significant gender association, and use Primer 5 to design PCR primers for amplifying each SNP site;

[0042] (2) Amplification of SNP sites with significant gender association

[0043] The PCR amplification system included: 1-2 μL DNA template (100 ng / μL), 0.4 μL upstream and downstream primers (10 μmol / μL), 10 μL 2× Taq PCR Mix, and RNase-free ddH2O to 20 μL. The PCR amplification program included: 95°C pre-denaturation for 3 min; 94°C pre-denaturation for 25 s, 52°C annealing for 25 s, 72°C extension for 10 s, a total of 35 cycles; 72°C final extension for 5 min.

[0044] (3) Sanger sequencing and genotyping reading

[0045] The PCR amplification product was subjected to Sanger sequencing, and the sequencing peak graph was read using Snapgene software. By comparing the sequencing peak graph with the actual gender, two gender-specific SNP markers located on chromosome 6 were finally obtained. Further analysis revealed that the two sites were located at positions 91 and 124 of the nucleotide sequence SEQ ID NO.1, respectively. The PCR primers SEQ ID NO.2 and SEQ ID NO.3 designed by Primer 5 to amplify the SNP marker were used. The flanking nucleotide sequence used in the designed primers was SEQ ID NO.4. The specific sequences are as follows:

[0046] 5'- AGAGGGACAACAGCCAAAG CTCTGGAGCCATTGCTGGCCTCAG CATAAAGAGCGCCGGGAACAGGATGCTAGATCCATCAAAAACAGCTC G ATTTTTTATAGCTACAAAATAAAACTGGCTGG G AAAACGCAATGGGGGAGTTTTATATCAGTGCTATCCAACAGACTG TCCTTGGTCTTCGTTCTGA -3'; SEQ ID NO.1;

[0047] 5'-AGAGGGACAACAGCCAAAG-3'; SEQ ID NO.2;

[0048] 5'-TCAGAACGAAGACCAAGGA-3'; SEQ ID NO.3;

[0049] 5'-TAAGTCAAATCAGACAATACTTTCGATTATTCTGTACAATAATTT GCAATCATTAAATCATATTATATATATTAATTTCCGACATGCATTCAGTTCAAATACTGCTGAATTTACCACATGAAAGTCAACAGTACTGTGAATTGGAAGAGATCGTCAGTCTTACAAAACGTCTCTTATCTCACGCAAAGCCCATTTGTTTGCCTTCCACAAGAGGGACAACAGCCAAAGCTCTGGAGCCATTGCTGGCCTCAGCATAAAGAGCGCCGGGAACAGGATGCTAGATCCATCAAAAACAGCTC G ATTTTTTATAGCTACAAAATAAAACTGGCTGG G AAAACGCAATGGGGGAGTTTTATATCAGTGCTATCCAACAGACTGTCCTTGGTCTTCGTTCTGAAGATGATATCCATGCCTTTCTGAGATAAGGGTGGACACATTGTGATATCTCAAGAACGCAAGCGTCTGAAACATTGGCACGGCGGCAAG GTCAAAACTCGTAAACGCTACTTCTGCCGAAATGGTTTAAAGGGGACATAACACCGAAAGCATGATTTTTCAAGGTTTTACGTAATAAAAGAGTTTAACGTACTATGTGGGTATACTAAAACATTAAAATCGCCAACCAACTGTCTG-3'; SEQ ID NO.4.

[0050] 4) Validation of sex-specific SNP markers in loach

[0051] Another 141 loaches from Huanggang, Hubei were taken, and genomic DNA was extracted from fin tissues. PCR amplification was performed using primers SEQ ID NO.2 and SEQ ID NO.3, and the genotypes at positions 91 and 124 in the sequence SEQ ID NO.1 were analyzed. The actual sex was used as a control to verify the accuracy of the SNP marker of the present invention.

[0052] The results showed that the 91st and 124th positions of all tested female individuals were homozygous single peaks, with genotypes of G and G ( Figure 1 A), the 91st and 124th sequencing peaks of all tested male individuals were heterozygous peaks, and the genotypes were G / A and A / G respectively ( Figure 1 B). Therefore, the SNP markers of the present invention can accurately identify the genetic sex of Hubei Huanggang loach (Table 1).

[0053] Table 1 Sex identification results of loach population in Huanggang, Hubei Province based on sex-specific SNP markers

[0054]

[0055] Example 2

[0056] 124 loaches from Kaifeng, Henan were taken to verify the accuracy of the SNP markers of the present invention, and the specific steps were the same as step 4) of Example 1.

[0057] The analysis results showed that the SNP markers of the present invention can accurately identify the genetic sex of loaches in Kaifeng, Henan Province with 100% accuracy (Table 2).

[0058] Table 2 Sex identification results of the Henan Kaifeng loach population based on sex-specific SNP markers

[0059]

[0060] Example 3

[0061] 139 loaches from Linyi, Shandong were taken to verify the accuracy of the SNP markers of the present invention, and the specific steps were the same as step 4) of Example 1.

[0062] The analysis results showed that the SNP markers of the present invention can accurately identify the genetic sex of loaches in Linyi, Shandong with 100% accuracy (Table 3).

[0063] Table 3 Sex identification results of Shandong Linyi loach population based on sex-specific SNP markers

[0064]

[0065] The loach sex-specific SNP marker and genetic sex identification method provided by the present invention can accurately identify the sex of the loach while breaking through the limitations of existing sex identification technologies for loach, and has the advantages of minimizing damage to the tested individuals and not affecting survival, etc., and has important application value in parent sex identification in sex-controlled breeding of loach.

[0066] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A sex-specific SNP marker for loach, characterized in that: In the nucleotide sequence shown in SEQ ID NO.1, the Sanger sequencing peaks at positions 91 and 124 of male individuals are heterozygous peaks, with genotypes of G / A and A / G, respectively; while the Sanger sequencing peaks at positions 91 and 124 of female individuals are homozygous single peaks, with genotypes of G and G, respectively.

2. The upstream and downstream primers used to amplify the sex-specific SNP marker of loach according to claim 1 are characterized in that: The nucleotide sequences of the primers are SEQ ID NO.2 and SEQ ID NO.

3.

3. Use of the SNP marker described in claim 1 or the primer described in claim 2 in genetic sex identification of loach.

4. A method for identifying genetic sex of loach, characterized in that: The steps include: (1) extracting genomic DNA from the individual to be tested; (2) using genomic DNA as a template, performing PCR amplification using the primers described in claim 2, and performing Sanger sequencing on the amplified product; (3) Read the genotype of the sex-specific SNP site of loach described in claim 1 to identify the genetic sex of the individual to be tested: if the sequencing peaks at positions 91 and 124 are heterozygous peaks and the genotypes are G / A and A / G, respectively, the individual is determined to be genetically male; if the sequencing peaks at positions 91 and 124 are homozygous single peaks and the genotypes are G and G, respectively, the individual is determined to be genetically female.

Images