Specific DNA fragment for sex determination of pelteobagrus fulvidraco and sex determination method

Abstract

The invention discloses a specific DNA fragment for sex determination of pelteobagrus fulvidraco and a sex determination method, and particularly relates to the technical field of sex determination of pelteobagrus fulvidraco. The identification method comprises the following steps: dissecting five female pelteobagrus fulvidraco and five male pelteobagrus fulvidraco of a full-sib family to determine the physiological gender; the method comprises the following steps: respectively taking muscles of a female sample and a male sample, carrying out DNA extraction, constructing a double-terminal genome DNA library with the insertion fragment size of 300bp, and carrying out high-throughput sequencing; the method comprises the following steps: identifying the sex chromosome of the pelteobagrus fulvidraco as a chromosome 8 based on GWAS and Fst methods, and then carrying out Indel screening in a sex determination region on the chromosome 8; a male specific DNA sequence of 601bp is screened out, and primer design and synthesis are carried out; pCR (polymerase chain reaction) amplification and agarose gel electrophoresis are utilized for detection, and the result shows that the female is the female and the male is the male with a 356bp band without a specific band. The scheme has the advantages that the specificity is high, the primer composition is simple, and the sex of the pelteobagrus fulvidraco can be more intuitively identified.

Description

Technical Field

[0001] The present application relates to the technical field of sex identification of Ussuri yellow catfish, and in particular to a specific DNA fragment used for sex identification of Ussuri yellow catfish and a sex identification method. Background Art

[0002] Yellow catfish ( Pseudobagrus ussuriensis ) is also known as the Ussuri catfish, belongs to the order Siluriformes, family Catfish, genus Pseudocatus, commonly known as the ox tail. It has a long body, a flat head, a wide and thick front part, a laterally flattened back part, and a smooth body surface without scales. It is widely distributed in waters such as the Heilongjiang River, the Ussuri River, and the Pearl River. The Ussuri yellow catfish has tender meat, delicious taste, and no intramuscular spines. It is regarded as a treasure among fish in northern my country and is favored by consumers. At present, research on the Ussuri yellow catfish is mostly focused on artificial breeding, farming, nutrition, and physiology. There has been no breakthrough in key technologies related to monosex breeding.

[0003] Yellow catfish has significant male-female dimorphism, with significant differences in body size between male and female individuals, with male individuals being significantly larger than female individuals. Therefore, it is of great significance to conduct research on all-male seedling breeding of yellow catfish and conduct monosexual breeding to increase its aquaculture yield.

[0004] To this end, Chinese invention patent CN2020111663121 discloses multiplex PCR primers and detection methods for sex detection of Ussuri catfish. In this method, a multiplex PCR system for sex detection of Ussuri catfish is constructed by integrating three sex-specific markers, which is used for sex identification of Ussuri catfish, that is, sex identification of Ussuri yellow catfish.

[0005] However, the above primer design and identification method has the following shortcomings: 1. Sex-specific sequence part: The three sex-specific sequences used in patent CN2020111663121 were BLAST-matched in the NCBI database, and no homologous sequences were matched in the reference genome of Ussuri yellow catfish. This shows that the three sex-specific sequences used in the patent are population-specific. For example, when this method is applied to the Ussuri yellow catfish reference genome sequencing population for sex identification, the identification will fail because the population does not contain the three sequences. 2. Primer part: Multiple primers may interfere with each other, resulting in competition between primers or reduced amplification efficiency, and even non-specific amplification; 3. Identification method part: When the above scheme identifies sex, it is necessary to simultaneously determine whether the individual has amplified bands at 246 bp, 597 bp and 823 bp. Both the primer reaction system and the identification method are very troublesome and cannot be intuitively obtained. Summary of the invention

[0006] The invention provides a specific DNA fragment for sex identification of Ussuri yellow catfish and a sex identification method. The scheme has the advantages of strong specificity, simple primer composition and more intuitive and rapid sex identification of Ussuri yellow catfish.

[0007] The objective of the present invention is achieved through the following technical solutions: A specific DNA fragment for sex identification of yellow catfish, the sequence of which is shown in SEQ ID NO: 1.

[0008] Preferably, the designed sex-specific primers include a forward primer FP and a reverse primer RP; Forward primer FP: 5'-GTAGCTGAGAGGAGTAACTGGTGGA-3'; SEQ ID NO: 2; Reverse primer RP: 5′-ACAGGTGAGCACCTCAGCACCA-3′; SEQ ID NO: 3.

[0009] The present invention also provides a method for sex identification of Ussuri yellow catfish, which comprises the following steps: using the PCR primers to perform PCR amplification reaction and agarose gel electrophoresis detection, and the result shows that the 356 bp band is male, and the absence of a specific band is female. The PCR amplification sequence used for sex identification of Ussuri yellow catfish is shown in SEQ ID NO:4.

[0010] Preferably, the PCR amplification conditions are: 94°C, 4 min; 94°C, 30S, 66°C, 30S, 72°C, 30S, 35 cycles; 72°C extension for 7 min.

[0011] Preferably, the PCR amplification reaction system of 20 μL is: 10 μL of 2×Premix Taq, 0.8 μL of each 10 mM primer, 0.8 μL of ddH 2 O 7.4 μL, genomic DNA 1 μL.

[0012] Compared with the prior art, the advantages or beneficial effects of the technical solution of the present application include: 1. In the identification method of the present application, it is only necessary to judge that the result without specific bands is female, and the result with 356bp band is male, which is more intuitive and has a high accuracy rate.

[0013] 2. The sex-specific sequence is derived from the resequencing data of multiple male and female individuals of Ussuri yellow catfish. By designing upstream primers and downstream primers, they bind to both ends of the target DNA sequence respectively, thus ensuring the specificity of amplification and the universality of different geographical groups within the species. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The figure is a gel electrophoresis diagram for identifying the sex of Ussuri yellow catfish in the present invention (wherein: ♂1-52 represents male Ussuri yellow catfish samples; ♀1-52 represents female Ussuri yellow catfish samples). DETAILED DESCRIPTION

[0015] The following will describe the implementation methods of the present application in detail with reference to the accompanying drawings and embodiments, so that the implementation process of how the present application applies technical means to solve technical problems and achieve corresponding technical effects can be fully understood and implemented accordingly. The embodiments of the present application and the various features in the embodiments can be combined with each other without conflict, and the technical solutions formed are all within the protection scope of the present application.

[0016] It should be clear that the embodiments described below are only part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by technicians in the relevant field without making creative work are within the scope of protection of this application.

[0017] Embodiment 1: This embodiment provides a method for sex identification of yellow catfish, comprising the following steps: S01. Thirty full-sib family yellow catfishes were collected from the breeding base and dissected to determine their physiological sex.

[0018] S02. Randomly select 5 female muscle samples and 5 male muscle samples for DNA extraction. According to the Illumina library construction process requirements, construct a double-end genomic DNA library with an insert size of 300 bp.

[0019] S03. The genome was sequenced using the Illumina NovaSeq sequencing platform. The sequencing volume of each sample was 12 Gb, and the sequencing strategy was Pair-End 150 bp.

[0020] S04. Based on high-throughput sequencing, GWAS (genome-wide association study) and Fst (index of genetic differentiation among populations) methods were used to identify the sex chromosome of Ussuri yellow catfish as chromosome 8. Subsequently, the female genome and the male genome were subjected to colinearity analysis, and a 601bp male-specific Indel marker (insertion-deletion marker) was found in the male fish genome sequence. The nucleotide sequence of the Indel marker is shown in SEQ ID NO.1.

[0021] SEQ ID NO: 1 is: GCTGCAGCCCAAATACATACATACAAACATACATATAAACATACATAGATGGACACTTAAAGTAGCTGAGAGGAGTAACTGGTGGAAAATATATGTTTAAAGCACTTTAAAATATAACTGGCAAAAAATATTTTGAAATGCTTTATTTAT TTATTTCTAAACTTTTATTATTGTTTGTTTTAATTCCTTTTACTATTTCACTTAATACTTTGCATGCAGATTTTTTTTTCCCCCAAAAACAAATTTAATGAAGTTCATATACATGTAACTGTCATCCAACGGCCTTGTAGCAGTTGTCCAA TAGTGCAATTCAAATAATGTTATTTCTCTTATTTATCATTTAATTAACTCAGTTTTTATCTTGACTGAAATATCTATCTAGCCACAGTGATGTCATGGTGCTGAGGTGCTCACCTGTTAAATTAAATTAAATTCATTATGGAAAGTTTTA AACATACACAAACACAATTGTGACTTTAATTTCATATGAATTATTTTCAACATTTATTGCTACAATATAAACAAACCCAGGGCCTATGAAATATTTTAATCAATCAATCAATCAAAGGGTATATTTACTCATACATGACCAGTGCATAATC S05. Based on the sex-specific sequences obtained by high-throughput sequencing data analysis and screening, Primer 3 Plus was used to design PCR verification primers. The primer sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3: F: 5'-GTAGCTGAGAGGAGTAACTGGTGGA-3'; SEQ ID NO.2; R: 5'-ACAGGTGAGCACCTCAGCACCA-3'; shown in SEQ ID NO.3.

[0022] The primers are designed within the specific sequence region. Theoretically, the primers can only amplify the sequence within the specific region. The amplified sequence is shown in SEQ ID NO: 4: SEQ ID NO:4 is: GTAGCTGAGAGGAGTAACTGGTGGAAAATATATGTTTAAAGCACTTTAAAATATAACTGGCAAAAAATATTTTGAAATGCTTTATTTATTTATTTCTAAACTTTTATTATTGTTTGTTTTAATTCCTTTTACTATTTCACTTAATACTTTGCATGCAGATTTTTTTTTCCCCAAAAAC AAATTTAATGAAGTTCATATACATGTAACTGTCATCCAACGGCCTTGTAGCAGTTGTCCAATAGTGCAATTCAAATAATGTTATTTCTCTTATTTATCATTTAATTAACTCAGTTTTTATCTTGACTGAAATATCTATCCAGCCACAGTGATGTCATGGTGCTGAGGTGCTCACCTGT Embodiment 2: This embodiment verifies the accuracy of the method for sex identification of Ussuri yellow catfish in Embodiment 1: 1. Verify sample DNA extraction 52 female and 52 male fish were randomly selected from the cultured population of Ussuri yellow catfish, and a small amount of fin rays were cut. Genomic DNA was extracted using the DNA extraction kit (Cat. No.: DP304) of Tiangen Biochemical Technology (Beijing) Co., Ltd. The extraction method is shown in the kit manual.

[0023] DNA polymerase: 2×Hieff Canace® Plus PCR Master Mix (With Dye) (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 10154ES08) The PCR reaction conditions were as follows: 94°C, 4 min; 94°C, 30 s, 66°C, 30 s, 72°C, 30 s, 35 cycles; and 72°C extension for 7 min.

[0024] The PCR reaction system was 20 μL: 2×Premix Taq 10 μL; 10 mM primers 0.8 μL each; ddH 2 O 7.4μL; genomic DNA 1μL.

[0025] 2. Agarose gel electrophoresis Agarose gel: gel concentration 2%, voltage 130V, 40min; sample volume 2μL.

[0026] DNA polymerase: Gold Band DL 2,000 DNA Marker (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 10501ES80), consisting of 6 DNA fragments: 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp and 100 bp.

[0027] The results of PCR product electrophoresis are shown in Figure 1 .

[0028] 52 male fish amplified a single band of 356 bp, while 52 female fish had no amplified band, which was consistent with the results of gonad identification by dissection, and the identification accuracy was 100%, indicating that the pair of male-specific primers screened by the present invention can achieve the purpose of identifying the male and female sex of Ussuri yellow catfish.

Claims

1. A specific DNA fragment for sex identification of yellow catfish, characterized in that: The sequence of the male-specific DNA fragment is SEQ ID NO:

1.

2. A primer for sex identification of yellow catfish, characterized in that: Designed from the specific DNA fragment SEQ ID NO: 1, the primer sequence is: Forward primer FP: 5′-GTAGCTGAGAGGAGTAACTGGTGGA-3′; Reverse primer RP: 5′-ACAGGTGAGCACCTCAGCACCA-3′.

3. A method for identifying sex of yellow catfish, characterized in that: The following steps are involved: PCR amplification and agarose gel electrophoresis detection were performed using the primers, and the individual with a 356 bp single band was a male Ussuri yellow catfish, and the individual without a specific band was a female Ussuri yellow catfish; wherein the PCR amplification sequence is shown in SEQ ID NO:

4.

4. A method for sex identification of yellow catfish according to claim 3, characterized in that: PCR amplification conditions were: 94°C, 4 min; 94°C, 30 s, 66°C, 30 s, 72°C, 30 s, 35 cycles; 72°C extension for 7 min.

5. According to the method for sex identification of yellow catfish in Ussuri according to claim 3, the PCR amplification reaction system (20 μL) is as follows: 10 μL of 2×Premix Taq, 0.8 μL of each of 10 mM forward and reverse primers, 7.4 μL of ddH2O, and 1 μL of genomic DNA.

Images