A molecular marker for identifying duck weight traits based on FRYL gene and an identification method and application thereof
By using SNP molecular markers based on the FRYL gene, and employing PCR amplification and enzyme digestion to detect duck weight traits, the problem of difficulty in selecting weight traits in meat duck breeding has been solved. This has enabled an early, rapid, and low-cost breeding method, thereby improving breeding efficiency.
Patent Information
- Application Number
- CN202510246514.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-03-04
AI Technical Summary
In the current technology, the selective breeding of weight traits in meat ducks has made slow progress, and there is a lack of effective molecular markers for early identification of weight traits.
We developed SNP molecular markers based on the FRYL gene, and used specific amplification primers for PCR amplification and enzyme digestion detection. The weight trait of ducks was determined based on the number of bands in the enzyme digestion products, and three genotypes (CC, CT, and TT) were provided for identification.
It enables early, rapid, and low-cost selection of duck weight traits, simplifies the breeding process, and improves breeding efficiency.
Smart Images

Figure CN119955949B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular markers, and particularly relates to a molecular marker for identifying duck weight traits based on a FRYL gene, and an identification method and application thereof. BACKGROUND
[0002] Weight is an important indicator for measuring the uniformity of poultry groups, and is also a key factor for determining feed consumption and affecting production costs. With the improvement of people's living standards, the demand for duck meat, eggs and other foods is also increasing, and consumers often prefer to buy products with larger body weight and better meat quality. Therefore, increasing the body weight of meat ducks helps to meet market demand and improve product competitiveness. Selecting poultry with excellent growth performance and body characteristics as a source. By continuously optimizing genetic combinations and breeding new varieties, the stable growth and performance improvement of meat duck weight can be achieved, thereby shortening the feeding cycle, reducing the feeding cost, and improving the production efficiency.
[0003] The FRY-like transcriptional coactivator (FRYL) gene located on chromosome 4 of duck is a paralog of the FRY microtubule binding protein (Fry) in vertebrates. Zhang et al. showed that FRYL is an important candidate gene affecting BW7 (7-week body weight) of Jinling Bai duck by genome-wide association study (GWAS).(ZHANG Y, JIA C, LI S, et al. Comparative genome-wide association study on body weight in Chinese native ducks using four models [J]. Poult Sci, 2024, 103(8): 103899.) In the growth and development of chicken, it was found that both FRYL (FRY-like transcriptional coactivator) and SGCB (sarcoglycan beta) were related to the growth of chicken.(ZHANG G X, FAN Q C, ZHANG T, et al. Genome-wide association study of growth traits in the Jinghai Yellow chicken [J]. Genetics and molecular research: GMR, 2015, 14(4): 15331-8.) Tarsani et al. found that FRYL was a potential candidate gene affecting body weight of broilers by applying functional enrichment analysis, indicating its importance in chicken growth (TARSANI E, KRANIS A, MANIATIS G, et al. Discovery and characterization of functional modules associated with body weight in broilers [J]. Scientific reports, 2019, 9(1): 9125.) Liu et al. identified SNPs and candidate genes associated with body size traits by whole-genome sequencing of 193 sheep from two Tibetan sheep breeds (PT and ZS) and performed GWAS using 4 models to study 8 phenotypes related to body size. Enrichment analysis showed that FRYL was involved in the growth and development related pathways and might help to regulate the body size of Tibetan sheep (LIU D, LI X, WANG L, et al. Genome-wide association studies of body size traits in Tibetan sheep [J]. BMC Genomics, 2024, 25(1): 739.)
[0004] At present, the research on FRYL gene mainly focuses on the growth and development of chicken, and the research on duck is relatively rare. In-depth study of the relationship between FRYL gene variation and expression and duck body weight can help reveal the key role of the gene in the growth and development of meat ducks, and provide a theoretical basis for the precise regulation of the growth and development of meat ducks, and provide a scientific basis for meat duck breeding. Based on the above, a molecular marker for identifying duck body weight traits based on FRYL gene and its identification method and application are proposed. SUMMARY
[0005] The purpose of the present application is to provide a molecular marker for identifying duck body weight traits based on FRYL gene and its identification method and application. The development of SNP (single nucleotide polymorphism) molecular markers related to the body weight traits of ducks (FRYL gene) can solve the problem of slow progress in conventional phenotype breeding and selection, and realize early identification of body weight traits.
[0006] The present application realizes the above-mentioned purpose through the following technical solutions:
[0007] As a first aspect of the present application, a molecular marker for identifying duck body weight traits based on FRYL gene is provided, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein the 197th base of the nucleotide sequence is C or T.
[0008] As a second aspect of the present application, the application of the above-mentioned molecular marker in identifying duck body weight traits is also provided.
[0009] As a further optimization scheme of the present application, if the molecular marker type of the duck to be tested is CC type, the duck body weight trait is best;
[0010] If the molecular marker type of the duck to be tested is CT type, the duck body weight trait is medium;
[0011] If the molecular marker type of the duck to be tested is TT type, the duck body weight trait is poor.
[0012] As a third aspect of the present application, a method for identifying duck body weight traits using the above-mentioned molecular marker is also provided, comprising the following steps:
[0013] (1) Extracting total DNA of duck wing vein blood;
[0014] (2) Designing specific amplification primers with the sequence composed of the site of the molecular marker and the upstream and downstream bases thereof as the target sequence, using the total DNA as the template, and performing PCR amplification using the specific amplification primers to obtain the amplification product;
[0015] (3) Performing genotyping detection and sequencing on the amplification product to obtain the molecular marker type of the duck to be tested;
[0016] (4) According to the type of molecular marker, the body weight trait of the duck is judged.
[0017] As a further optimization scheme of the present application, the method for genotyping detection is that the amplified product is digested to obtain a digested product, the digested product is detected by agarose gel electrophoresis, and genotyping is performed according to the image, if the digested product:
[0018] contains 1 band, it is CC type;
[0019] contains 2 bands, it is TT type;
[0020] contains 3 bands, it is CT type.
[0021] As a further optimization scheme of the present application, XCMI restriction endonuclease is used to digest the amplified product.
[0022] The present application has the beneficial effects that based on the research on the relationship between FRYL gene and body weight trait of the duck, a molecular marker is developed, by identifying the type of the molecular marker existing in the duck genome, the body weight trait of the duck can be selected according to the genotype, and a breeding method for early selection of poultry weight rate is established, which is simple, fast, low cost, does not require special instruments, and is suitable for the needs of molecular marker assisted breeding experiments. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 Part of the agarose gel electrophoresis diagram of the PCR amplified product of the sample provided by the present application is provided;
[0024] Figure 2 Part of the agarose gel electrophoresis diagram of the digested product obtained by enzyme digestion of the sample provided by the present application is provided;
[0025] Figure 3 The genotype verification sequencing result of C183627302T site (the 197th site in SEQ ID NO. 1) in duck FRYL gene provided by the present application. DETAILED DESCRIPTION
[0026] The following detailed description of the present application will be further described in conjunction with the drawings, and it is necessary to point out here that the following detailed description is only used to further illustrate the present application, and cannot be understood as limiting the scope of protection of the present application, and those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.
[0027] 1. Materials
[0028] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.
[0029] 2. Method
[0030] 2.1 Primer design
[0031] The DNA sequence corresponding to the FRYL gene shown as SEQ ID NO. 1 was found from the duck genome database, and a specific amplification primer was designed with the partial DNA sequence of the FRYL gene (the sequence composed of the site of the molecular marker and the upstream and downstream bases) as a template. The specific amplification primer sequence information is as follows:
[0032] SEQ ID NO. 2: Forward primer: TGTTCCTCTTGTGTTTTAGT;
[0033] SEQ ID NO. 3: Reverse primer: TGAAAGGTGCTCAATAATAG.
[0034] The length of the amplifiable region of the primer is 433 bp, and the sequence information is shown as SEQ ID NO. 4, which contains a molecular marker of C49474125T site (corresponding to the 197th site in SEQ ID NO. 1) T / C site mutation.
[0035] 2.2 Extraction of total DNA from blood
[0036] 420 Qiangying ducks were selected, and blood was collected from the wing vein to extract total DNA. The total DNA in the duck wing vein blood sample was extracted using the blood DNA extraction kit produced by Tiangeng Biological Technology Co., Ltd. The extraction steps were performed according to the kit instructions.
[0037] 2.3 PCR amplification
[0038] The Mix produced by Shanghai Yisheng Biological Company was used to perform PCR amplification reaction on the target fragment of the FRYL gene by using the synthesized specific amplification primer. The PCR amplification system is shown in Table 1:
[0039] Table 1. PCR amplification system
[0040]
[0041] The PCR reaction conditions are as follows: 95℃ pre-denaturation for 5 min; first step 95℃ denaturation for 45 s; second step 64.8℃ annealing for 45 s (the annealing temperature is set according to the primer); third step 72℃ extension for 30 s, wherein the second step to the third step is cycled for 31 times, a total of 32 cycles; 72℃ extension for 10 min.
[0042] 2.4 Detection and sequencing of PCR amplification product
[0043] PCR amplification products were detected by 2% agarose gel electrophoresis, and a band with a length of approximately 433 bp was obtained after imaging in a gel imaging instrument, which was consistent with the predicted length, indicating that the target fragment was obtained. The PCR product was sent to Beijing Genesee Biotechnology Co., Ltd. (Nanjing) for sequencing, and the sequence is shown as SEQ ID NO. 4, which is consistent with the predicted result. Figure 1
[0044] 2.5, Genotyping
[0045] First, the enzyme digestion system shown in Table 2 was configured, and the enzyme digestion conditions were 37°C water bath for 1 hour. The PCR amplification product was digested with XCMI restriction endonuclease purchased from NEB (Beijing) Co., Ltd.
[0046] Table 2, Enzyme digestion system
[0047]
[0048]
[0049] Subsequently, 1.5% low-voltage agarose gel electrophoresis was used for detection, and the results (part of the results) shown in Figure 2 were obtained; wherein, if the enzyme digestion product contains 1 band, it is CC type; contains 2 bands, it is TT type; contains 3 bands, it is CT type.
[0050] 2.6, Sequencing verification of enzyme digestion
[0051] The gene enzyme digestion electrophoresis map was counted to obtain CC, TT, and CT three types, and one individual of each type was selected for sequencing alignment, and the sequencing alignment map is shown in Figure 3 , in which T is mutated to C, and the mutation position is indicated by an arrow, which is consistent with the enzyme digestion typing result.
[0052] 2.7, Effect verification
[0053] To determine the association between the T / C polymorphism of duck FRYL gene C49474125T site and important phenotypic traits of ducks, 420 Qiangying ducks in step 2.2 were used as test materials, and 1-day-old body weight (BW1), 21-day-old body weight (BW 21 ), 42-day-old body weight (BW 42 ), 21-day-old average daily gain (ADG 21 ), and 42-day-old average daily gain (ADG 42 ) were counted from 1 to 42 days of age. The genotyping method shown in step 2.5 was used to genotype the 420 Qiangying ducks, and the results are shown in Table 3.
[0054] Table 3, genotype detection results of different phenotypic individuals
[0055]
[0056] Experimental conclusion: The chi-square test results show that the genotype of the duck population is in Hardy-Weinberg equilibrium (P>0.05).
[0057] 2.8, statistical analysis
[0058] The association between the three genotypes and the body weight traits of the duck was analyzed by the least square analysis method in the SAS9.4 software, and the association analysis results between different genotypes and each trait are shown in Table 4.
[0059] Table 4, association analysis of duck FRYL genotype and duck body weight traits
[0060]
[0061] Note: The same row and different lowercase letters represent significant differences (P<0.05), and the same row and different capital letters represent extremely significant differences (P<0.01).
[0062] Experimental conclusion: As can be seen from Table 4, for the C49474125T site of the FRYL gene, the 21-day-old body weight (BW 21 ), 42-day-old body weight (BW 42 ) and 21-day-old daily weight gain (ADG 21 ) of the CC type individual and the CT type individual are significantly higher than those of the TT type individual, and the 42-day-old daily weight gain (ADG 42 ) of the CC type individual is significantly higher than that of the TT type individual. There is no significant difference in the 1-day-old body weight (BW1) of the three genotypes, so it can be concluded that the body weight traits of the CC genotype individual are the best, the body weight traits of the CT genotype individual are moderate, and the body weight traits of the TT genotype individual are poor.
[0063] The above-described examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the protection scope of the present application.
Claims
1. The application of a molecular marker based on the FRYL gene in identifying the body weight trait of a strong English duck, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein the base at position 197 of the nucleotide sequence is C or T.
2. Use according to claim 1, characterized in that, If the type of the molecular marker of the to-be-tested duck is CC type, the duck has the best body weight trait; If the type of the molecular marker of the to-be-tested duck is CT type, the duck has a medium body weight trait; If the type of the molecular marker of the to-be-tested duck is TT type, the duck has a poor body weight trait.
3. A method for identifying the body weight trait of strong English duck by using molecular markers, characterized in that, The method comprises the following steps: (1) extracting total DNA of duck wing vein blood; (2) taking the sequence composed of the site of the molecular marker and the upstream and downstream bases thereof as a target sequence, designing specific amplification primers, taking the total DNA as a template, and performing PCR amplification by using the specific amplification primers to obtain an amplification product; wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein the base at position 197 of the nucleotide sequence is C or T; (3) performing genotyping detection and sequencing on the amplification product to obtain the type of the molecular marker of the to-be-tested duck; (4) judging the body weight trait of the duck according to the type of the molecular marker.
4. The method for identifying the body weight trait of strong English duck by using molecular markers according to claim 3, characterized in that, The sequence of the specific amplification primer is as follows: SEQ ID NO. 2: Forward primer: TGTTCCTCTTGTGTTTTAGT; SEQ ID NO. 3: Reverse primer: TGAAAGGTGCTCAATAATAG.
5. The method for identifying the body weight trait of strong English duck by using molecular markers according to claim 3, characterized in that, The genotyping detection method is to obtain enzyme digestion products by using XCMI restriction endonuclease to digest the amplification product, to detect the enzyme digestion products by using agarose gel electrophoresis, to perform genotyping according to the image, and to determine that the enzyme digestion products are: containing one band, CC type; containing two bands, TT type; containing three bands, CT type.
Citation Information
Patent Citations
Molecular marker for identifying duck body weight character based on PRKG2 gene and application
CN118460735A
Molecular marker for identifying duck body weight character based on LYN gene and application
CN118516472A