KASP primer for identifying asparagus sex and method for identifying asparagus sex

Abstract

The KASP primer for identifying the sex of the asparagus comprises a primer pair YLSF and YLSR for amplifying a male specific gene SOFF fragment of a Y chromosome of the asparagus; the nucleotide sequence of the YLSF is as shown in SEQ ID NO.1, the 5'end of the nucleotide sequence of the YLSF contains a VIC fluorescent sequence, and the nucleotide sequence of the YLSR is as shown in SEQ ID NO.2; the SEQ ID NO.1 is as follows: GAAGGTCGGAGTCAACGGATTCATGGATCGACACTTGACATGGG, the SEQ ID NO.2 is as follows: 1, and the SEQ ID NO. 2 is as follows: CTGAATCTCCTTCGTATGGAACGT. The two pairs of primers can be used for predicting the sex of the asparagus, especially identifying the super-male plant, a simple and stable molecular marker is provided for identifying the super-male plant of the asparagus, and the two pairs of primers have important application value in the aspect of asparagus all-male molecular marker assisted breeding.

Description

Technical Field

[0001] The invention relates to the technical field of vegetable crop genetic breeding, and in particular to a KASP primer for identifying the sex of asparagus and a method for identifying the sex of asparagus. Background Art

[0002] Asparagus (Asparagus officinalis L.), also known as asparagus, is a perennial herb. Its young stems are rich in nutrients, crisp and tender, and are a high-end nutritious and health-care vegetable that is deeply loved by consumers. It has high economic value and is known as the "king of vegetables." Asparagus belongs to the subgenus Asparagus. Asparagus plants belong to the monocotyledonous plant class Asparagales, Asparagaceae. The genus Asparagus is divided into three subgenuses: subgenus of Asparagus, Myrsiphyllum, and Protasparagus. Myrsiphyllum and Protasparagus plants have bisexual flowers, while subgenus Asparagus has unisexual flowers and is dioecious. Asparagus is a typical dioecious plant. Because male plants do not bear fruit and do not consume nutrients, their yield is more than 25% higher than that of female plants under the same growth conditions. Male plants have many branches, bloom early, have a long lifespan, and are highly resistant. Therefore, vigorously developing all-male asparagus breeding is the goal of asparagus variety selection. Asparagus has 20 (2n=20) chromosomes. The sex chromosome of asparagus is L5, and the sex chromosomes cannot be distinguished morphologically, and are homologous XY chromosomes. The sex of asparagus is controlled by a single gene (M) dominant locus, in which the male-determining gene is dominant over the female-determining gene, including ordinary male plants (Mm), super male plants (MM), female plants (mm), and male-female plants (commonly known as hermaphroditic plants, Mm). Occasionally, a very small number of male plants are found in natural groups to produce bisexual flowers, causing self-pollination or cross-pollination, and producing offspring with a male-female ratio of 3:1. Among them, MM is called a super male plant, which is used as a hybrid copy for all-male asparagus breeding, and all the offspring are male plants. Therefore, the selection of super male plants is the key to all-male asparagus breeding. There is no obvious difference in external morphology between male, super male and female asparagus plants, and it takes about 2-3 years from sowing to flowering. It is difficult to directly distinguish between male and female plants in the early stage, which seriously hinders the process of all-male variety breeding. Therefore, the development of molecular markers closely linked to the sex determination gene of asparagus will help to quickly and accurately distinguish between female and male plants in the seedling stage, providing strong technical support for parent selection, hybrid seed production and all-male variety breeding.

[0003] DNA molecular marker-assisted selection is not affected by the external environment. If DNA molecular markers closely linked to the asparagus sex-determining gene are used for assisted selection, male and female plants can be quickly and accurately distinguished at the seedling stage. If it is a dominant marker, it can also distinguish between super male plants and ordinary male plants, which will facilitate the parent selection and all-male cultivation of asparagus hybrid seed production, so as to accelerate the process of all-male breeding. At present, the research on gene cloning and molecular markers linked to the sex of asparagus is mostly focused on some genetic markers linked to this gene. Zhou Jinsong et al. (2017) used the CDS sequence of the SOFF gene to develop four STS molecular markers (CN107201404A, a molecular biological identification method for the sex of dioecious plants of the genus Asparagus and its application). However, Wang Xingjun et al. (2021) used the four STS molecular markers in the patent to test the female and male plants of 24 asparagus varieties and found that these markers were not very universal in the tested varieties. It can be seen that in asparagus breeding practice, there is currently a lack of molecular markers and methods for identifying male and female sex with good versatility, high stability and high detection throughput. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and provide a KASP primer capable of quickly identifying the sex of asparagus and a method for identifying the sex of asparagus.

[0005] In order to solve the above technical problems, the technical solution proposed by the present invention is: a KASP primer for identifying the sex of asparagus, comprising a primer pair YLSF and YLSR for amplifying the SOFF fragment of the male-specific gene of the Y chromosome of asparagus; the nucleotide sequence of YLSF is shown in SEQ ID NO.1, the 5' end of the nucleotide sequence of YLSF contains a VIC fluorescent sequence, and the nucleotide sequence of YLSR is shown in SEQ ID NO.2; The SEQ ID NO.1 is as follows: GAAGGTCGGAGTCAACGGATTCATGGATCGACACTTGACATCGG; The SEQ ID NO.2 is as follows: CTGAATCTCCTTCGTATGGAACGT.

[0006] In the above-mentioned KASP primers for identifying the sex of asparagus, preferably, the VIC fluorescent sequence at the 5' end of the nucleotide sequence of YLSF is: GAAGGTCGGAGTCAACGGATT.

[0007] The above-mentioned KASP primers for identifying the sex of asparagus, preferably, the KASP primers also include a primer pair XLSF and XLSR for amplifying the WIP2 / NTT fragment of the X chromosome specific region of asparagus; the nucleotide sequence of the XLSF is shown in SEQ ID NO.3, the 5' end of the nucleotide sequence of the XLSF contains a FAM fluorescent sequence, and the nucleotide sequence of the XLSR is shown in SEQ ID NO.4; The SEQ ID NO.3 is as follows: GAAGGTGACCAAGTTCATGCTGGCTTGATGCCGTGTTTTCGC; The SEQ ID NO.4 is as follows: GCAGAAATAACATCGACCACCCTC.

[0008] In the above-mentioned KASP primers for identifying the sex of asparagus, preferably, the FAM fluorescent sequence at the 5' end of the nucleotide sequence of the XLSF is GAAGGTGACCAAGTTCATGCT.

[0009] A method for identifying the sex of asparagus comprises the following steps: 1) Extracting asparagus sex genes; the asparagus sex genes include one or both of the Y chromosome male-specific gene SOFF fragment or the asparagus X chromosome specific region gene WIP2 / NTT fragment; 2) amplifying the asparagus sex gene extracted in step 1) using the KASP primers according to any one of claims 1 to 4; 3) Detect the fluorescence of the PCR amplification product. When the fluorescence of the amplification product is expressed as FAM, it indicates that the sample contains the homozygous X allele at this KASP marker site. When the fluorescence of the amplification product is expressed as VIC, it indicates that the sample contains the homozygous Y allele at this KASP marker site. When the fluorescence of the amplification product is expressed as a heterozygous genotype cluster of FAM and VIC, it indicates that the sample contains the heterozygous X and Y alleles at this marker site.

[0010] In the above method for identifying the sex of asparagus, preferably, the PCR reaction system used for PCR amplification in step 2) is: 10 ng-50 ng / μL of asparagus sex genomic DNA, the concentration of YLSR primer is 0.1 mmol / L; the concentration of XLSR primer is 0.1 mmol / L; the concentration of YLSF primer is 0.1 mmol / L; the concentration of XLSF primer is 0.1 mmol / L; the volume ratio of YLSR primer, XLSR primer, YLSF primer and XLSF primer is 1:1:1:1.

[0011] In the above method for identifying the sex of asparagus, preferably, the amplification conditions in step 2) are: 94°C, 15 minutes; 94°C, 20 seconds; annealing at 65°C-57°C for 60 seconds, with the annealing temperature decreasing by 0.8°C in each cycle, for 10 cycles; 94°C, 20 seconds, 57°C, 60 seconds, for 33 cycles.

[0012] Compared with the prior art, the advantages of the present invention are: The two pairs of primers described in the present invention can be used to predict the sex of asparagus, especially to identify super male plants, providing a simple and stable molecular marker for identifying super male asparagus plants, and having important application value in asparagus all-male molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the detection result of KASP marker genotyping in Example 1.

[0014] Figure 2 This is the verification result of KASP marker genotyping in Example 1. DETAILED DESCRIPTION

[0015] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and carefully in combination with preferred embodiments below, but the protection scope of the present invention is not limited to the following specific embodiments.

[0016] It should be noted that when an element is described as being "fixed, fixed, connected or connected to" another element, it can be directly fixed, fixed, connected or connected to the other element, or it can be indirectly fixed, fixed, connected or connected to the other element through other intermediate connectors.

[0017] Unless otherwise defined, all the professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention. Example

[0018] In this embodiment, the sex gene of asparagus is the nucleotide sequence of the male-specific sex determination gene SOFF on the Y chromosome of asparagus and the gene WIP2 / NTT in the X chromosome specific region.

[0019] Based on the reference genome of asparagus, Asparagus_officinalis, primers were designed using the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ). The two sets of primers were primer pairs YLSF and YLSR for amplifying the SOFF fragment of the male-specific gene on the Y chromosome of asparagus, and primer pairs XLSF and XLSR for amplifying the WIP2 / NTT fragment of the X chromosome-specific region of asparagus. The 5' end of the nucleotide sequence of YLSF contained the VIC fluorescent sequence GAAGGTCGGAGTCAACGGATT, and the 5' end of the nucleotide sequence of XLSF contained the FAM fluorescent sequence GAAGGTGACCAAGTTCATGCT. The nucleotide sequence information of the primer set is as follows: YLSF: GAAGGTCGGAGTCAACGGATTCATGGATCGACACTTGACATCGG; YLSR: CTGAATCTCCTTCGTATGGAACGT; XLSF: GAAGGTGACCAAGTTCATGCTGGCTTGATGCCGTGTTTTCGC; XLSR:GCAGAAATAACATCGACCACCCTC.

[0020] This example also provides a method for identifying the sex of asparagus, and the molecular markers are verified and detected using the Array Tape system of Douglas Scientific. The Array Tape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for fluorescence signal scanning, and INTELLICS for data analysis.

[0021] PCR amplification system: NEXAR was used to automatically assemble the PCR amplification system, which is shown in Table 1 below.

[0022] In the table, Primer_R1 is XLSR primer; Primer_R2 is YLSR primer; μM Primer_F1 is XLSF primer; Primer_F2 is YLSF primer; M is mol / L.

[0023] Table 1. PCR amplification system for KASP marker genotyping Final concentration Actual usage 100 μM Primer_R1 0.42μM 0.0033 μL 100 μM Primer_R2 0.42μM 0.0033 μL 100 μM Primer_F2 0.17μM 0.0013 μL 100 μM Primer_F1 0.17μM 0.0013 μL 2× KASP Master Mix 1× 0.3945 μL Ultrapure water 0.3962 μL DNA (add DNA to the tape membrane and dry it) 10 ng-50 ng Total volume 0.8 μL PCR amplification: PCR was performed using SOELLEX, and the amplification conditions were as follows: 94°C for 15 min; 94°C for 20 sec, 65°C-57°C (annealing temperature decreased by 0.8°C each cycle) for 60 sec, 10 cycles; 94°C for 20 sec, 57°C for 60 sec, 33 cycles.

[0024] Signal scanning and genotyping: After the PCR reaction is completed, ARAYA is used to scan the fluorescence signal of the reaction system; then INTELLICS is used for genotyping and data analysis. In the KASP marker genotyping test, the genotypes of the samples are divided into three clusters, namely the FAM cluster, the VIC cluster, and the heterozygous genotype cluster; Figure 1 As shown in the figure, the FAM cluster indicates that the sample contains the homozygous X allele at this KASP marker site, which is located in the upper left corner of the figure; the VIC cluster indicates that the sample contains the homozygous Y allele at this KASP marker site, which is located in the lower right corner of the figure; the heterozygous genotype cluster indicates that the sample contains the heterozygous X and Y allele at this marker site, which is located in the upper right corner of the figure.

[0025] In this example, 81 materials were used to verify the molecular marker combination. It was verified that the homozygous and heterozygous clusters were well-typed and compact, the loci were single-copy and the detection rate was higher than 98%, which was sufficient for accurate detection of asparagus sex. The molecular marker combination detection results are shown in Figure 2. Figure 2 shown.

[0026] In this example, the test results of 81 samples with different genotypes are shown in Table 2 below: Table 2. Molecular marker detection and phenotypic results of 81 samples .

[0027] The molecular marker combination for asparagus sex identification provided in this embodiment can accurately detect and identify the sex of asparagus and has wide application universality. The method for identifying the sex of asparagus in this embodiment is a detection method based on KASP markers, which can be used for the detection of the sex of asparagus. The KASP marker detection method is simple and fast, has low detection cost, and is suitable for different detection instruments and equipment. The detection method provided in this embodiment is a co-dominant marker with high specificity, sensitivity and resolution; the marker is not affected by environmental conditions, can use seeds or any type of plant tissue, and the detection results are accurate, repeatable and stable; different testing laboratories and different data results can be compared and verified with each other, and the data has universal comparability.

Claims

1. A KASP primer for identifying the sex of asparagus, characterized in that: It comprises a primer pair YLSF and YLSR for amplifying the SOFF fragment of the male-specific gene of the Y chromosome of asparagus; the nucleotide sequence of YLSF is shown in SEQ ID NO.1, the 5' end of the nucleotide sequence of YLSF contains a VIC fluorescent sequence, and the nucleotide sequence of YLSR is shown in SEQ ID NO.2; The SEQ ID NO.1 is as follows: GAAGGTCGGAGTCAACGGATTCATGGATCGACACTTGACATCGG; The SEQ ID NO.2 is as follows: CTGAATCTCCTTCGTATGGAACGT.

2. The KASP primer for identifying the sex of asparagus according to claim 1, characterized in that: The VIC fluorescent sequence at the 5' end of the YLSF nucleotide sequence is: GAAGGTCGGAGTCAACGGATT.

3. The KASP primer for identifying the sex of asparagus according to claim 1, characterized in that: The KASP primers also include a primer pair XLSF and XLSR for amplifying the WIP2 / NTT fragment of the X chromosome specific region of asparagus; the nucleotide sequence of the XLSF is shown in SEQ ID NO.3, the 5' end of the nucleotide sequence of the XLSF contains a FAM fluorescent sequence, and the nucleotide sequence of the XLSR is shown in SEQ ID NO.4; The SEQ ID NO.3 is as follows: GAAGGTGACCAAGTTCATGCTGGCTTGATGCCGTGTTTTCGC; The SEQ ID NO.4 is as follows: GCAGAAATAACATCGACCACCCTC.

4. The KASP primer for identifying the sex of asparagus according to claim 3, characterized in that: The FAM fluorescent sequence at the 5' end of the XLSF nucleotide sequence is GAAGGTGACCAAGTTCATGCT.

5. A method for identifying the sex of asparagus, characterized in that: The following steps are involved: 1) Extracting asparagus sex genes; the asparagus sex genes include one or both of the Y chromosome male-specific gene SOFF fragment or the asparagus X chromosome specific region gene WIP2 / NTT fragment; 2) amplifying the asparagus sex gene extracted in step 1) using the KASP primers according to any one of claims 1 to 4; 3) Detect the fluorescence of the PCR amplification product. When the fluorescence of the amplification product is expressed as FAM, it indicates that the sample contains the homozygous X allele at this KASP marker site. When the fluorescence of the amplification product is expressed as VIC, it indicates that the sample contains the homozygous Y allele at this KASP marker site. When the fluorescence of the amplification product is expressed as a heterozygous genotype cluster of FAM and VIC, it indicates that the sample contains the heterozygous X and Y alleles at this marker site.

6. The method for identifying the sex of asparagus according to claim 5, characterized in that: The PCR reaction system used for PCR amplification in the step 2) is: 10 ng-50 ng / μL of asparagus sex genomic DNA, the concentration of YLSR primer is 0.1mmol / L; the concentration of XLSR primer is 0.1mmol / L; the concentration of YLSF primer is 0.1mmol / L; the concentration of XLSF primer is 0.1mmol / L; the volume ratio of YLSR, XLSR primer, YLSF primer and XLSF primer is 1:1:1:

1.

7. The method for identifying the sex of asparagus according to claim 5, characterized in that: The amplification conditions in step 2) are: 94°C, 15 minutes; 94°C, 20 seconds; 65°C-57°C annealing for 60 seconds, with the annealing temperature decreasing by 0.8°C in each cycle, for 10 cycles; 94°C, 20 seconds, 57°C, 60 seconds, for 33 cycles.

Images