Engineering probiotics with surface modified protective shell, preparation method and application thereof

Abstract

The invention relates to the technical field of biomedical engineering, in particular to engineered probiotics with a surface-modified protective shell, a preparation method and application of the engineered probiotics, the engineered probiotics with the surface-modified protective shell comprise the protective shell and engineered probiotics, and the engineered probiotics are coated with the protective shell; the engineered probiotics are subjected to surface modification through immune regulation factors, and metal ions are loaded on the surfaces of the engineered probiotics subjected to surface modification; the engineered probiotics with the surface modified protective shell can regulate immune factors, can be targeted and colonized in colon and promote repair of mucosa surface, and has a better treatment effect on enteritis, so that the engineered probiotics are expected to be applied to preparation of enteritis pharmaceutical preparations; according to the preparation method of the engineering probiotics, raw materials are easy to obtain, the operation process is simple and convenient, reaction conditions are controllable, and large-scale production is facilitated.

Description

Technical Field

[0001] The present invention relates to the field of biomedical engineering technology, and in particular to an engineered probiotic with a surface-modified protective shell, a preparation method and application thereof. Background Art

[0002] Inflammatory Bowel Disease (IBD) is characterized by repeated and persistent intestinal inflammation, which seriously affects the patient's quality of life. The disease can further develop into diseases such as intestinal obstruction, intestinal perforation, or colorectal cancer. The current treatment of IBD mainly relies on the use of anti-inflammatory drugs and immunosuppressants to reduce inflammation. However, these therapies can only partially relieve symptoms and the treatment effect is often not ideal. In addition, long-term use of the above drugs may also lead to serious complications, such as opportunistic infections, gastrointestinal dysfunction, hepatotoxicity or nephrotoxicity. Therefore, there is an urgent need for more effective and safer IBD treatment options.

[0003] Immunity, genetics, environment, and microorganisms are generally considered to be the four major factors that induce the onset of IBD. Among them, at the immune level, the chronic inflammatory response of IBD is directly related to the imbalance and overactivation of the immune system. The imbalance of T cell populations, especially the overactivation of effector subsets (such as Th17 and cytotoxic T cells), coupled with the damage of regulatory T cells (Treg), leads to uncontrolled inflammation. Dysregulated T cell activation not only damages the intestinal mucosa, but also recruits additional immune cells to the site of inflammation, aggravating the damage of the body's tissues. T cell activation is often regulated by immune checkpoint pathways, such as the interaction between programmed death receptor-1 (PD-1) on T lymphocytes and its ligand PD-L1, which can transmit inhibitory signals to counteract T cell activation. This interaction represents an important homeostatic mechanism for alleviating inflammation and maintaining autoimmune tolerance. Recent studies have shown that PD-L1 knockout can increase the morbidity and mortality of colitis models, while the administration of PD-L1 can improve the symptoms of colitis in animals, indicating the potential of PD-L1 as a treatment for IBD. However, PD-L1 has a strong immunosuppressive effect, and its systemic administration is associated with an increased risk of infection and carcinogenesis. In addition, it faces challenges such as high cost and short half-life, and requires multiple administrations for effective treatment. Therefore, it is very necessary to develop a more advanced strategy to improve the local bioavailability of PD-L1 in IBD lesions and fully exert its therapeutic effect in IBD.

[0004] The intestinal flora is a large group of microorganisms that are essential for maintaining intestinal balance and host health. Studies have shown that intestinal flora imbalance is also an important cause of IBD. In the inflamed intestine, harmful microorganisms increase and beneficial bacteria decrease, leading to an increase in harmful toxins and disrupting the host's metabolic processes. Treatments that can re-regulate the intestinal microbiota can help alleviate the symptoms of IBD. Probiotics are used as an alternative to traditional IBD treatment drugs because of their ability to reprogram the intestinal microbial environment, and their application in this area has received great attention. However, due to the presence of gastric acid, various digestive enzymes and destructive pathological microenvironment, maintaining the activity of probiotics in the harsh gastrointestinal environment remains a major challenge. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the related art. To this end, the first object of the present invention is to provide an engineered probiotic with a surface modified protective shell; the second object of the present invention is to provide a method for preparing the engineered probiotic; the third object of the present invention is to provide an application of the engineered probiotic.

[0006] In order to achieve the first purpose, the technical solution adopted by the present invention is: An engineered probiotic with a surface-modified protective shell, comprising a protective shell and an engineered probiotic, wherein the protective shell covers the engineered probiotic; Wherein, the protective shell comprises glycyrrhizic acid and pectin, and the mass ratio of the glycyrrhizic acid to the pectin is 3:10 to 10:3; The engineered probiotics are surface-modified by immune regulatory factors, and the surface of the engineered probiotics after surface modification is loaded with metal ions; The complex gastrointestinal environment often leads to the inactivation of probiotics and limits their colonization. The present invention encapsulates the engineered probiotics in a protective shell formed by pectin and glycyrrhizic acid to protect them from the damage of the complex gastrointestinal environment and prolong their retention time in the intestine. Glycyrrhizic acid is a natural anti-inflammatory triterpenoid saponin that can directly bind to the high-mobility group protein 1 (HMG1) in the high-mobility group protein B1 (High Mobility Group Box-1 protein, HMGB1), thereby inhibiting its function as a damage-associated molecular pattern (DAMP) to activate inflammation; pectin is a polysaccharide that can be degraded by colon enzymes while maintaining resistance to upper gastrointestinal enzymes, which can protect engineered probiotics from the interference of pepsin and is an ideal excipient for oral drug delivery to the colon; the present invention performs in situ gelation on the surface of the engineered probiotics, uses metal ions to form cross-linking sites on the surface of the engineered probiotics, and then promotes the cross-linking of glycyrrhizic acid and pectin to form a protective shell with good mechanical properties.

[0007] Furthermore, the mass ratio of the glycyrrhizic acid to the pectin is 1:1.

[0008] Furthermore, the metal ion is calcium ion, and each 1×10 9 The CFU of engineered probiotics is loaded with 0.025mmol to 0.5mmol of calcium ions.

[0009] Further, the engineered probiotic is Escherichia coli Nissle 1917; Among them, the EcN strain represents Escherichia coli Nissle 1917.

[0010] Furthermore, the engineered probiotic is a mutant of the EcN strain with the nlpl gene knocked out, and the nucleotide sequence of the nlpl gene is shown in SEQ ID NO.1; Among them, the ΔEcN strain represents the mutant of the EcN strain in which the nlpl gene was knocked out.

[0011] Furthermore, the immune regulatory factor is selected from PD-L1.

[0012] In order to achieve the second purpose, the technical solution adopted by the present invention is: A method for preparing an engineered probiotic, for preparing an engineered probiotic having a surface-modified protective shell as described in any one of the above, comprising the following steps: S100, preparing competent state of engineered probiotics by calcium chloride method; S200, introducing plasmid pET28a-T5-PD-L1 into the competent state of the engineered probiotics by heat shock method, inducing PD-L1 expression in the competent engineered probiotics, and obtaining engineered probiotics with PD-L1 surface modification; S300, at a concentration of 0.025 to 0.5 mmol mL -1 The metal salt buffer was prepared at a concentration of 5 × 10 8 ~2×10 9 CFU·mL -1 The engineered probiotic suspension modified with PD-L1 surface is stirred and centrifuged to obtain the engineered probiotic suspension adsorbed with metal ions; S400, adding glycyrrhizic acid and pectin to a buffer solution to prepare a mixed buffer solution containing glycyrrhizic acid and pectin; S500, dispersing the mixed buffer solution in step S400 in the bacterial suspension obtained in step S300 to obtain an engineered probiotic suspension loaded with a first coating; S600, after centrifuging the engineered probiotic suspension loaded with the first coating obtained in step S500, add -1 The mixture is stirred and incubated in a buffer solution of a metal salt to obtain an engineered probiotic with a surface-modified protective shell.

[0013] Further, the stirring in step S300 and step S600 is selected from vortex stirring.

[0014] In order to achieve the third purpose, the technical solution adopted by the present invention is: An application of an engineered probiotic, such as the engineered probiotic with a surface-modified protective shell as described in any one of the above items, is used in an enteritis drug preparation.

[0015] Furthermore, the pharmaceutical preparation also includes at least one of pharmaceutically acceptable adjuvants, excipients and carriers.

[0016] The above one or more technical solutions in the embodiments of the present invention have at least one of the following technical effects: The present invention provides an engineered probiotic with a surface-modified protective shell, comprising a protective shell and an engineered probiotic, wherein the protective shell covers the engineered probiotic; the engineered probiotic is surface-modified by an immune regulatory factor, and the surface of the engineered probiotic after surface modification is loaded with metal ions. The protective shell is guided by metal ions and cross-linked to form a protective layer on the surface of the engineered probiotic; cell experiment results show that ΔEcN P@PG can inhibit the activity of neutrophils, repolarize pro-inflammatory macrophages, inhibit the secretion of pro-inflammatory cytokines, reduce the number of Th17, Th1 and Tfh cells, and upregulate immunosuppressive Treg cells; the results of in vivo experiments in mice showed that ΔEcN P @PG can target and colonize in the colon, promote the repair of the intestinal mucosal surface of mice, and has a good therapeutic effect on mice with enteritis. Therefore, this engineered probiotic with a surface-modified protective shell is expected to be used in the preparation of enteritis drug preparations.

[0017] The present invention provides a method for preparing an engineered probiotic, the raw materials are easy to obtain, the operation process is simple, the reaction conditions are controllable, and it is conducive to large-scale production.

[0018] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the PCR test results of the ΔEcN strain and the EcN strain and their bacterial vesicle protein content provided in Example 1 of the present invention.

[0020] Figure 2 is the ΔEcN provided in Example 1 of the present invention P Immunoblotting of PD-1 protein expressed by the strain.

[0021] Figure 3 This is a statistical graph of the PD-1 retention percentage in different strains and the vesicles produced therefrom provided in Example 1 of the present invention.

[0022] Figure 4 is the ΔEcN provided in Example 2 of the present invention P Scanning electron micrographs of the strain before and after being coated with a protective shell.

[0023] Figure 5 This is a statistical chart of the number of different strains surviving 10 minutes and 20 minutes in simulated gastric fluid in vitro provided in Example 2 of the present invention.

[0024] Figure 6 This is the macrophage regulation ability of different groups provided in Example 2 of the present invention.

[0025] Figure 7 This is the therapeutic effect of different groups on inflammatory mice provided in Example 2 of the present invention.

[0026] Figure 8 This is the immunohistochemical image of ZO-1 protein and Occludin protein in colon samples of different groups provided in Example 2 of the present invention.

[0027] Fig. 9 This is a statistical chart of inflammatory cytokines in different groups provided in Example 2 of the present invention.

[0028] Fig.10 It is a flow cytometry scatter plot of different groups provided in Example 2 of the present invention.

[0029] Fig.11 The MHC II in the intestinal tissues of different groups of mice provided in Example 2 of the present invention + Statistical graphs of the expression of DCs, F4 / 80 macrophage markers, IFN-γ cytokine, and IL-17A cytokine.

[0030] Fig.12 This is a statistical chart of the effects of different groups on the abundance of intestinal flora in mice with inflammatory bowel disease provided in Example 2 of the present invention.

[0031] Fig.13 This is a principal component analysis (PCA) diagram of intestinal flora of different groups provided in Example 2 of the present invention.

[0032] Fig.14 This is a statistical heat map of the effects of different groups on the abundance of intestinal flora provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0034] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0035] The nucleotide sequence of the nlpl gene (SEQ ID NO.1) from 5' to 3' is as follows: ATGAAGCCTTTTTTGCGCTGGTGTTTCGTTGCGACAGCACTTACGCTTGCAGGATGCAGTAATACTTCCTGGCGTAAAAGTGAAGTCCTCGCGGTACCATTGCAACCGACTTTACAGCAGGAAGTGATTCTGGCACGTATGGAACAGATCCTTGCCAGTCGGGCTTTAACCGATGACGAACGCGCACAGCTTTTATATGAGCGCGGAGTGTTGTATGATAGTCTCGGTCTGAGGGCATTAGCGCGTAACGATTTTTCGCAAGCGCTGGCAATCCGACCGGATATGCCTGAAGTATTCAATTACTTAGGCATATATTTAACGCAGGCAGGCAATTTTGATGCTGCCTATGAAGCGTTTGATTCTGTACTTGAGCTTGATCCAACTTACAACTACGCGCACTTGAATCGCGGGATCGCATTATATTACGGCGGTCGTGACAAGTTAGCGCAAGATGATCTGCTGGCGTTTTATCAAGACGATCCCAATGATCCTTTCCGTAGTCTGTGGCTTTATCTCGCCGAGCAGAAGCTCGATGAGAAGCAGGCTAAAGAAGTGTTGAAACAGCACTTCGAAAAATCGGATAAGGAACAGTGGGGATGGAACATTGTCGAGTTCTACCTGGGCAACATTAGCGAACAAACGTTAATGGAAAGGCTCAAGGCGGACGCAACGGATAACACCTCGCTCGCTGAGCATCTCAGTGAAACCAACTTCTATTTAGGTAAGTACTACCTAAGTCTGGGGGATTTGGACAGCGCCACGGCACTGTTCAAACTGGCGGTTGCCAACAACGTTCATAACTTTGTTGAGCACCGATACGCATTGTTGGAATTATCGCTCCTGGGCCAGGACCAAGATGACCTGGCAGAATCGGACCAGCAATAG。

[0036] The nucleotide sequence of the upstream homology arm of EcN-nlpl-HA1 (SEQ ID NO.2) from the 5' to 3' end is shown as follows: TGCTCTGACCGAAGAAACCGGCACCACCATCGAAATTGAAGATGACGGTACTGTGAAGATTGCAGCGACCGACGGCGAGAAAGCGAAACACGCGATTCGTCGTATCGAAGAGATCACTGCAGAAATCGAAGTGGGCCGCGTCTACAATGGTAAAGTGACCCGTATCGTTGATTTTGGCGCATTTGTTGCCATTGGTGGCGGTAAAGAAGGTCTGGTCCACATCTCTCAAATCGCTGATAAACGCGTTGAGAAAGTGACCGATTACCTGCAGATGGGTCAGGAAGTACCGGTGAAAGTTCTGGAAGTTGATCGCCAGGGCCGTATCCGTCTGAGCATTAAAGAAGCGACTGAGCAATCTCAACCTGCTGCAGCACCGGAAGCTCCGGCTGCTGAACAGGGCGAGTAAGGTTGCCATTTGCCCTCCGCTGCGGCGGGGGGCTTTTAACCGGGCAGGACGCCTTGTTAGCAACCGGGAACAGGACGTTCATTCAACCGTGGTCTTCGGGAGTGGGAA。

[0037] The nucleotide sequence of the downstream homologous arm of EcN-nlpl-HA2 (SEQ ID NO.3) from the 5' to 3' end is shown as follows: TTTCAATGAAAATTGCTGATCAATTTCATGATGAGTTATGTAGACTGGCCGCCATTAATTTTGAGGCACACGTACTACATGGCTGAATTCGAAACCACTTTTGCAGATCTGGGCCTGAAGGCTCCTATCCTTGAAGCCCTTAACGATCTGGGTTACGAAAAACCATCTCCAATTCAGGCAGAGTGTATTCCACATCTGCTGAATGGCCGCGACGTTCTGGGTATGGCCCAGACGGGGAGCGGAAAAACTGCAGCATTCTCTCTACCTCTGCTGCAGAATCTTGATCCTGAGCTGAAAGCACCACAGATTCTGGTGCTGGCACCGACCCGCGAACTGGCGGTACAGGTTGCTGAAGCAATGACGGATTTCTCTAAACACATGCGCGGCGTAAACGTGGTTGCCCTGTACGGCGGCCAACGTTATGACGTGCAATTACGCGCCCTGCGTCAGGGGCCGCAGATCGTTGTCGGTACTCCGGGCCGTCTGCTGGACCACCTGAAACGTGG。

[0038] Example 1 Preparation of surface-modified engineered probiotics.

[0039] Refer to the preparation methods disclosed in the following two documents: I. Caldwell BJ, Bell CE. Structure and mechanism of the Red recombination system of bacteriophage λ. Prog Biophys Mol Biol. 2019;147: 33-46.

[0040] II. Thomas SC, Madaan T, Kamble NS, Siddiqui NA, Pauletti GM, Kotagiri N. Engineered Bacteria Enhance Immunotherapy and Targeted Therapy through Stromal Remodeling of Tumors. Adv Healthc Mater. 2022;11(2).

[0041] The nlpl gene in the genome of Escherichia coli Nissle 1917 (EcN) was targeted and knocked out using λ-Red recombinase-mediated genetic engineering technology to obtain the ΔEcN strain, which includes the following steps: 1. Construct the homologous recombination fragment of the nlpl gene. The process is as follows: using EcN-nlpl-HA1 as the upstream homologous arm primer, EcN-nlpl-HA2 as the downstream homologous arm primer, and plasmid pKD13 as the template, use EcN-nlpl-HA1 and EcN-nlpl-HA2 primers to amplify the homologous recombination fragment EcN-nlpl-HA1-kanR-EcN-nlpl-HA2 with short homologous arms of the nlpl gene at both ends, and fuse it with the kanamycin box fragment by overlapping PCR to form the EcN-nlpl-HA1-kanR-EcN-nlpl-HA2 long homologous recombination fragment.

[0042] 2. Prepare competent cells. The process is as follows: transform the pKD46 plasmid encoding the Red recombination system into the EcN strain, screen the transformants and name them EcN / pKD46. After culturing the EcN / pKD46 strain at 30°C overnight, transfer it to LB medium containing kanamycin resistance at a 1% inoculation ratio, add L-arabinose with a final concentration of 50 mM, and culture until OD600 = 1.0 to stop, so that the homologous recombinase is expressed in large quantities to improve the knockout efficiency, and use the electroporation method to prepare EcN / pKD46 competent bacteria.

[0043] 3. The EcN-nlpl-HA1-kanR-EcN-nlpl-HA2 long homologous recombination fragment was introduced into EcN / pKD46 competent cells by electroporation, transformants were selected on plates containing kanamycin, and PCR identification was performed using primer pairs to screen EcN competent bacteria with the nlpl gene replaced by the kanamycin cassette.

[0044] 4. The pCP20 plasmid expressing FLP recombinase was electroporated into the selected EcN competent bacteria, site-specific recombination was carried out under the action of FLP recombinase, the kanamycin cassette was deleted, the temperature-sensitive pCP20 plasmid was eliminated by high-temperature culture at 42°C, and resistance plate verification was performed to finally obtain the EcN strain with nlpl gene knockout, namely the ΔEcN strain.

[0045] The protein content in the ΔEcN strain, the EcN strain and the outer membrane vesicles (OMV) was detected by PCR and BCA methods. Figure 1 As shown; in, Figure 1 In the figure, A is the PCR detection result of ΔEcN strain and EcN strain, and B is the statistical result of protein content in outer membrane vesicles of ΔEcN strain and EcN strain.

[0046] Fifth, pET28a-T5-PD-L1 was introduced into the ΔEcN strain by the heat shock method, and PD-L1 expression was induced by adding isopropyl β- d -1-thiogalactoside (IPTG, 0.1 mM) to the culture medium and incubating at 25°C for 12 h to obtain the ΔEcN strain modified with PD-L1 surface, namely ΔEcN P strains, and their protein blotting was as Figure 2 As shown, the results show that ΔEcN P The strain can effectively express the target protein PD-1. Figure 2 GAPDH in the expression vector is glyceraldehyde-3-phosphate dehydrogenase, which is used as an internal reference protein.

[0047] The control strain, ΔEcN, OMV (ΔEcN secreted vesicles), ΔEcN P and OMV P (ΔEcN P The secreted vesicles were incubated with PD-1, and the residual concentration of PD-1 was detected by enzyme-linked immunosorbent assay (ELISA) to evaluate their PD-1 binding activity. Figure 3 As shown, ΔEcN P and OMV P They accounted for 46.48% and 86.49% of PD-1 respectively, which were significantly better than ΔEcN (5.78%) and OMVs (2.91%). The results showed that ΔEcN overexpressing PD-L1 was successfully prepared and had strong PD-1 binding ability. In the figure, the control strain was an EcN strain with the nlpl gene knocked out but without the expression plasmid transferred into it.

[0048] Example 2 Preparation of ΔEcN with protective shell P strains.

[0049] 1×10 9 ΔEcN of CFU P The strain was dispersed in 1 ml of PBS buffer (containing 55.5 mg of calcium chloride) to obtain ΔEcN P The strain suspension was vortexed for 2 min to allow calcium ions to interact with the strain monomers, and then centrifuged to obtain the ΔEcN adsorbed by calcium ions. P Strain suspension, ΔEcN P / Ca 2+ strain suspension; Glycyrrhizic acid (25 mg) and pectin (25 mg) were dissolved in 5 ml of PBS solution to obtain a PBS mixed solution of glycyrrhizic acid and pectin. The mixed solution was dispersed in ΔEcN P / Ca 2+ The strain suspension was incubated for 1 h to promote the cross-linking of the first coating. Subsequently, the strain suspension was centrifuged at 4000 g for 5 min to obtain a concentrated bacterial solution. 1 ml of PBS buffer (containing 55.5 mg of calcium chloride) was added to the concentrated bacterial solution and vortexed for 2 min. Then, it was incubated with 5 ml of a PBS mixed solution of glycyrrhizic acid (25 mg) and pectin (25 mg) for the second coating to obtain ΔEcN with a protective shell. P strain, namely ΔEcN P @PG, protective shell coating ΔEcN P SEM images of the strain before and after Figure 4 This result shows that the protective shell can reduce the ΔEcN P The strains formed an effective coating.

[0050] Put 1×10 8 ΔEcN of CFU P Strains and ΔEcN P The @PG strain was incubated with simulated gastric fluid for 10 min and 20 min respectively, and then diluted and plated to see the number of remaining live bacteria. The results are as follows: Figure 5 The results showed that glycyrrhizic acid and pectin protective shell had an effect on ΔEcN P The strain has better protection ability.

[0051] Control strain, PBS buffer, ΔEcN, ΔEcN@PG and ΔEcN P Macrophages co-incubated with the supernatants of HT-29 cells treated with @PG were analyzed by flow cytometry for the expression of representative markers of the M1 phenotype (iNOS) and biomarkers of the M2 phenotype (CD206) in each group, where the control was the EcN strain in which the nlpl gene was knocked out but the expression plasmid was not transferred; The results are as follows Figure 6 As shown, the ΔEcN@PG and ΔEcN coated with protective shell P The expression of iNOS in PG macrophages was significantly reduced, while the expression of CD206 was increased, indicating that macrophages were polarized from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype; in, Figure 6 In the figure, A is the expression of iNOS in each group by flow cytometry, B is the statistical graph of iNOS macrophage markers in each group, C is the expression of CD206 in each group by flow cytometry, and D is the statistical graph of CD206 macrophage markers in each group.

[0052] ΔEcN P The treatment effect of @PG on inflammatory bowel disease mice was investigated as follows: the mice were divided into a healthy group, a PBS group, a ΔEcN strain group, a ΔEcN@PG group, and a ΔEcNP @PG, ΔEcN@PG protective shell coating method and ΔEcN P @PG The covering method of the protective case is the same; Colitis in mice was established by giving mice 2.5% dextran sulfate sodium salt (DSS) in drinking water; Among them, each group received oral administration every two days until euthanasia on the 14th day; like Figure 7 As shown, compared with other treatment groups, ΔEcN P The mice in the PG treatment group lost the least weight and had the lowest disease activity index (DAI) score. The DAI score of the mice at the end of the experiment decreased from 10.2 at the beginning of the experiment to 2.2. Among them, ΔEcN P The effects of @PG treatment group on the body weight of mice were statistically analyzed with those of PBS group, ΔEcN strain group and ΔEcN@PG group, and the results were P<0.0001, P<0.0001, P<0.0001 and P=0.0475, respectively; ΔEcN P The effects of @PG treatment group on the disease therapeutic index of mice were statistically analyzed with those of PBS group, ΔEcN strain group and ΔEcN@PG group, and the results were P<0.0001, P<0.0001, P<0.0001 and P=0.0020, respectively; ΔEcN P The colon length of the @PG group was significantly restored to about 5.68 cm, while the length of the DSS-induced control group was shortened to about 3.40 cm. This result shows that ΔEcN P @PG is effective in treating colitis; in, Figure 7 In the figure, A is a curve diagram showing the relationship between the percentage of mouse body weight and time, B is a curve diagram showing the relationship between the disease treatment index of mice and time, C is a picture of the colon of each group of mice after the 14-day treatment cycle, and D is a statistical graph showing the colon length of each group of mice.

[0053] like Figure 8 As shown in the figure, compared with the healthy group, the blank control PBS group significantly inhibited the expression of colon occludin and ZO-1, indicating that the mucosal barrier was severely damaged. P The @PG strain treatment group significantly restored the expression levels of ZO-1 and Occludin in the mouse colon, almost reaching the levels observed in healthy mice, indicating that ΔEcN P@PG can promote the reconstruction of the mucosal barrier.

[0054] like Fig. 9 As shown in the figure, compared with the healthy group, the levels of three key inflammatory cytokines (including IL-1β, IL-6 and TNF-α) in IBD in the blank control PBS group were significantly increased, and the ΔEcN P @In the PG group, the expression of pro-inflammatory cytokines was significantly downregulated, and the expression of anti-inflammatory cytokines (IL-10) was significantly upregulated; in, Fig. 9 In the figure, A is a statistical graph showing the expression of IL-1β in different groups, B is a statistical graph showing the expression of IL-6 in different groups, C is a statistical graph showing the expression of TNF-α in different groups, and D is a statistical graph showing the expression of IL-10 in different groups.

[0055] like Fig.10 and Fig.11 As shown, compared with untreated colitis mice and ΔEcN-treated colitis mice, mice receiving ΔEcN@PG or ΔEcN P The frequencies of dendritic cells (DCs) and macrophages in colitis mice treated with PG were reduced, with ΔEcN P The decrease in the PG group was the most significant, indicating that ΔEcN P @PG can inhibit the recruitment of DCs and macrophages to the colon during colitis; the proportion of IFN-γ-producing Th1 cells and IL-17A-producing Th17 cells in the colon tissue of mice in different treatment groups. + Th1 and Th17 cells differentiated from T cells are often upregulated in IBD and are associated with increased disease activity in IBD patients; the cytokines they secrete (including IFN-γ and IL-17A) play a key role in recruiting immune cells to the intestine, significantly exacerbating the inflammation, tissue damage and intestinal barrier destruction of colitis; compared with the PBS group, ΔEcN P @PG group CD4 + IFN-γ + Th1 and CD4 + IL-17A + The percentage of Th17 cells was significantly reduced. It is worth noting that compared with ΔEcN@PG, ΔEcN P @PG showed a stronger ability to suppress these T cell subsets, highlighting the key role of PD-L1 expression in mediating this suppression; in, Fig.10In the figure, A is a flow cytometric scatter plot of the relationship between CD11c marker and MHC II protein, B is a flow cytometric scatter plot of the relationship between CD11b marker and macrophage marker F4 / 80, C is a flow cytometric scatter plot of the relationship between CD4 marker and IFN-γ cytokine, and C is a flow cytometric scatter plot of the relationship between CD4 marker and IL-17A cytokine; Fig.11 A is the MHCⅡ in the intestinal tissues of mice in different groups + A is a statistical graph of DCs expression, B is a statistical graph of F4 / 80 macrophage marker expression in the intestinal tissues of mice in different groups, C is a statistical graph of IFN-γ cytokine expression in the intestinal tissues of mice in different groups, and D is a statistical graph of IL-17A cytokine expression in the intestinal tissues of mice in different groups.

[0056] like Fig.12 , Fig.13 and Fig.14 As shown, ΔEcN P The relative abundance of beneficial bacteria in the @PG treatment group increased, among which Muribaculaceae can regulate the inflammatory response of intestinal diseases, Odoribacter and Lachnospiraceae (NK4A136) can produce short-chain fatty acids, and Prevotellaceae (UCG-001) is beneficial for ulcerative colitis; in addition, compared with healthy mice, the abundance of Proteobacteria (colitis marker) in the intestine of the blank control PBS group increased. Proteobacteria is a marker of colitis, ΔEcN P The PG group reduced the relative abundance of Bacteroides and IBD-related virulent pathogens Escherichia coli and Shigella; further analysis of the top 30 bacterial genera with the highest abundance showed that ΔEcN P @PG group effectively restored the relative abundance of some probiotic groups in IBD mice, close to the level of healthy controls; in, Fig.12In the figure, A is a statistical graph showing the effects of different groups on the relative abundance of Muribaculaceae, B is a statistical graph showing the effects of different groups on the relative abundance of Odoribacter, C is a statistical graph showing the effects of different groups on the relative abundance of Lachnospiraceae, D is a statistical graph showing the effects of different groups on the abundance of Prevotellaceae_UCG-001, E is a statistical graph showing the effects of different groups on the abundance of Bacteroidaceae, F is a statistical graph showing the effects of different groups on the abundance of Escherichia-Shigella, and G is a statistical graph showing the effects of different groups on the abundance of Proteobacteria.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An engineered probiotic with a surface-modified protective shell, characterized in that: It comprises a protective shell and an engineered probiotic, wherein the protective shell covers the engineered probiotic; Wherein, the protective shell comprises glycyrrhizic acid and pectin, and the mass ratio of the glycyrrhizic acid to the pectin is 3:10 to 10:3; The engineered probiotics are surface-modified by immune regulatory factors, and the surfaces of the surface-modified engineered probiotics are loaded with metal ions.

2. The engineered probiotic with a surface modified protective shell according to claim 1, characterized in that: The mass ratio of the glycyrrhizic acid to the pectin is 1:

1.

3. The engineered probiotic with a surface modified protective shell according to claim 1, characterized in that: The metal ion is calcium ion, and each 1×10 9 The CFU of engineered probiotics is loaded with 0.025mmol to 0.5mmol of calcium ions.

4. The engineered probiotic with a surface modified protective shell according to claim 1, characterized in that: The engineered probiotic is Escherichia coli Nissle 1917; Among them, the EcN strain represents Escherichia coli Nissle 1917.

5. The engineered probiotic with a surface modified protective shell according to claim 4, characterized in that: The engineered probiotic is a mutant of the EcN strain with the nlpl gene knocked out, and the nucleotide sequence of the nlpl gene is shown in SEQ ID NO.1; Among them, the ΔEcN strain represents the mutant of the EcN strain in which the nlpl gene was knocked out.

6. The engineered probiotic with a surface modified protective shell according to claim 1, characterized in that: The immune regulatory factor is selected from PD-L1.

7. A method for preparing an engineered probiotic, characterized in that: The method for preparing the engineered probiotic having a surface modified protective shell as claimed in any one of claims 1 to 6 comprises the following steps: S100, preparing competent state of engineered probiotics by calcium chloride method; S200, introducing plasmid pET28a-T5-PD-L1 into the competent state of the engineered probiotics by heat shock method, inducing PD-L1 expression in the competent engineered probiotics, and obtaining engineered probiotics with PD-L1 surface modification; S300, at a concentration of 0.025 to 1 mmol mL -1 The metal salt buffer was prepared at a concentration of 5 × 10 8 ~2×10 9 CFU·mL -1 The engineered probiotic suspension modified with PD-L1 surface is stirred and centrifuged to obtain the engineered probiotic suspension adsorbed with metal ions; S400, adding glycyrrhizic acid and pectin to a buffer solution to prepare a mixed buffer solution containing glycyrrhizic acid and pectin; S500, dispersing the mixed buffer solution in step S400 in the bacterial suspension obtained in step S300 to obtain an engineered probiotic suspension loaded with a first coating; S600, after centrifuging the engineered probiotic suspension loaded with the first coating obtained in step S500, add the mixture to a concentration of 0.025 to 1 mmol·mL -1 The mixture is stirred and incubated in a buffer solution of a metal salt to obtain an engineered probiotic with a surface-modified protective shell.

8. The method for preparing the engineered probiotics according to claim 7, characterized in that: The stirring in step S300 and step S600 is selected from vortex stirring.

9. An application of an engineered probiotic, characterized in that: The engineered probiotic with a surface modified protective shell as claimed in any one of claims 1 to 6 is used for preparing a pharmaceutical preparation for enteritis.

10. The use of the engineered probiotics according to claim 9, characterized in that: The pharmaceutical preparation further comprises at least one of pharmaceutically acceptable adjuvants, excipients and carriers.

Images