Application of oridonin in treatment of drug-resistant liver cancer

Abstract

The invention relates to application of oridonin in treatment of drug-resistant liver cancer, and discloses application of oridonin in preparation of a medicine for improving sensitivity of liver cancer cells to a growth factor receptor tyrosine kinase inhibitor. The invention relates to an application of a rubescensin B combined growth factor receptor tyrosine kinase inhibitor in preparation of anti-liver cancer drugs with synergistic interaction and an application of the rubescensin B combined growth factor receptor tyrosine kinase inhibitor in preparation of drugs for resisting drug-resistant liver cancer invasion and metastasis. According to the invention, oridonin and lenvatinib are combined for treating liver cancer, the growth, invasion and migration of tumor drug-resistant cells can be obviously inhibited in vitro, the apoptosis of tumor cells can be promoted, the drug resistance of liver cancer can be improved, the increase of tumor volume can be limited and inhibited in vivo, and the effect is obviously superior to that of single use of anticancer drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to an application of Rubescensine B in the treatment of drug-resistant liver cancer. Background Art

[0002] Hepatocellular carcinoma (HCC) is the sixth most common malignant tumor and the third leading cause of cancer death in the world. Its morbidity and mortality rates are increasing year by year, increasing the social and medical burden and seriously threatening human life and health. At present, the treatments for liver cancer mainly include: surgical treatment, ablation therapy, radiotherapy, chemotherapy, targeted therapy, and immunotherapy. Liver resection is the best means for early HCC, but due to the hidden nature of liver cancer, most liver cancer patients are already in the advanced or unresectable stage when they are discovered. Therefore, their main treatment method is systemic therapy, including targeted therapy and immunotherapy. Among them, the first-line drugs for systemic treatment of liver cancer include: tyrosine kinase inhibitors (lenvatinib), VEGFR antagonists (axitinib), VEGF monoclonal antibodies (bevacizumab), etc. Although these drugs have clear effects on targeted treatment of liver cancer, there are still problems such as toxic side effects, uncertain efficacy, and drug resistance.

[0003] Lenvatinib is a multi-target tyrosine kinase inhibitor (TKI) that mainly targets vascular endothelial growth factor receptor (VEGFR) 1-3, fibroblast growth factor receptor (FGFR) 1-4, platelet-derived growth factor receptor a (PDGFRα), and oncogenes RET and KIT, thereby inhibiting angiogenesis, directly inhibiting the proliferation of tumor cells, and regulating the tumor microenvironment, thereby exerting its anti-tumor effect. Lenvatinib has shown activity in a variety of solid tumors, mainly used in thyroid cancer, hepatocellular carcinoma, renal clear cell carcinoma, and endometrial cancer. Currently, lenvatinib has been approved by the US Food and Drug Administration (FDA) for the first-line treatment of HCC. Compared with sorafenib, lenvatinib has superior efficacy. However, with the gradual increase in the application of lenvatinib, lenvatinib resistance is becoming more and more common. Therefore, it is urgent to identify the factors that lead to resistance and methods to alleviate resistance.

[0004] Ponicidin is a kaurenoid diterpenoid compound isolated from the Labiatae plant Rubescens, which has pharmacological activities such as anti-tumor, anti-bacterial and anti-inflammatory, antioxidant and immune enhancement. Studies have shown that Ponicidin can exert anti-cancer effects through its cytotoxicity, cell apoptosis, cell cycle arrest, anti-angiogenesis and anti-tumor cell proliferation.

[0005] With the occurrence of resistance to chemotherapy, radiotherapy and even targeted drugs, it is urgent to find emerging drugs, targets and treatments. Summary of the invention

[0006] The purpose of the present invention is to overcome the defects of the above-mentioned prior art and provide the application of Rubescensine B in the treatment of drug-resistant liver cancer.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] One of the technical solutions of the present invention is to provide the use of Rubescensine B in the preparation of a drug for improving the sensitivity of liver cancer cells to growth factor receptor tyrosine kinase inhibitors.

[0009] In some specific embodiments, the growth factor receptor tyrosine kinase inhibitor is lenvatinib.

[0010] The second technical solution of the present invention is to provide the use of Rubescensine B combined with growth factor receptor tyrosine kinase inhibitors in the preparation of anti-liver cancer drugs with synergistic enhancement.

[0011] In some specific embodiments, the growth factor receptor tyrosine kinase inhibitor is lenvatinib.

[0012] In some specific embodiments, the effective dose of Rubescensine B is 12-18 μM, and the effective dose of lenvatinib is 7-13 μM.

[0013] The third technical solution of the present invention is to provide the use of Rubescensine B combined with growth factor receptor tyrosine kinase inhibitors in the preparation of drugs against the invasion and metastasis of drug-resistant liver cancer.

[0014] In some specific embodiments, the growth factor receptor tyrosine kinase inhibitor is lenvatinib.

[0015] A fourth technical solution of the present invention is to provide an anti-liver cancer pharmaceutical composition, which comprises oridonin B and a growth factor receptor tyrosine kinase inhibitor.

[0016] In some specific embodiments, the anti-liver cancer pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0017] In some embodiments, the carrier comprises one or more of a diluent, a filler, an excipient, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier, a lubricant and a flavoring agent.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) The present invention combines Rubescensine B with lenvatinib for the treatment of liver cancer, which can significantly inhibit the growth, invasion and migration of tumor-resistant cells in vitro, promote tumor cell apoptosis, and improve liver cancer resistance. It can also limit and inhibit the increase of tumor volume in vivo, and its effect is significantly better than that of anticancer drugs alone.

[0020] (2) The combined drug therapy of the present invention can greatly reduce the use of anticancer drugs while ensuring the same anticancer activity, reduce the treatment risks and toxic side effects caused by anticancer drugs at higher doses, and also reduce the treatment costs.

[0021] (3) The anti-liver cancer drug composition of the present invention has a significant inhibitory effect on the growth of liver cancer resistant cells, and can be used as a good solution to solve the thorny problem of tumor resistance in the field of cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 IC50 values ​​of Huh7 cells, Huh7-LR cells (A) and HCC-LM3 cells, HCC-LM3-LR cells (B) for lenvatinib. Figure 2 Figure 2 shows the colony sizes formed by Hep-G2, Huh7, HCC-LM3, Huh7-LR and HCC-LM3-LR cell clones after the treatment of lenvatinib. Figure 3 The numbers of Hep-G2, Huh7, HCC-LM3, Huh7-LR and HCC-LM3-LR cell clones formed after lenvatinib treatment (*P<0.05, **P<0.01, ***P<0.001). Figure 4 This is the expression heat map of sphingomyelin synthesis genes in Huh7 cells and Huh7-LR cells. Figure 5 Ceramide (A) and sphingomyelin (B) levels in Huh7 cells and Huh7-LR cells (*P<0.05, **P<0.01). Figure 6 Comparison of CERT1 mRNA and protein expression between the parental hepatocellular carcinoma cell line and the lenvatinib-resistant line (**P<0.01). Figure 7 Huh7 cells transfected with CERT1 overexpression plasmid were verified by qPCR and WB (**P<0.01, ***P<0.001). Figure 8Huh7-LR cells were transfected with CERT1 siRNA for qPCR and WB verification (**P<0.01, ***P<0.001). Fig. 9 Cell viability of Huh7 cells overexpressing CERT1 (A) and Huh7-LR cells with small interfering CERT1 (B) under lenvatinib treatment. Fig.10 The clonogenic ability of Huh7 cells overexpressing CERT1 (A) and Huh7-LR cells with small interfering CERT1 (B) under lenvatinib treatment. Fig.11 The structure of biotin-labeled Rubescensine B (A), mass spectrometry detection results (B), and nuclear magnetic resonance hydrogen spectrum verification purity results (C). Fig.12 Immunofluorescence detection of the binding of Rubescensine B (red fluorescence) and CERT1 (green fluorescence) in Huh7-LR cells (A) and Hep-G2 cells (B) (Scale bar: 50μm / 25μm). Fig.13 The Co-IP experimental results of Rubescensine B binding to CERT1 molecules in Huh7-LR cells (A) and Hep-G2 cells (B). Fig.14 The fluorescence distribution of Huh7-LR cells (A) and HCC-LM3-LR cells (B) labeled with BODIPY-C5-Ceramide after the action of Rubescensine B and HPA-12. Fig.15 The activity (A, B) and mRNA expression (C, D) of CERT1 in HCC-LM3-LR cells and Huh7-LR cells after the treatment of oridonin and HPA-12. Fig.16 This is a non-targeted lipidomics detection of Rubescensine B on HepG2; A is a differential metabolic volcano map; B is a VIP heat map of differential lipid metabolites sphingomyelin and ceramide; C is a KEGG enrichment analysis bubble map; D is a KEGG topology analysis. Fig.17 The ceramide (A) and sphingomyelin (B) levels of Huh7-LR cells after the treatment of Rubescensine B. Fig.18 EDU was used to detect the effects of Rubescensine B, lenvatinib alone, and the combination of the two drugs on the proliferation of Huh7 cells overexpressing CERT1 (A, B) and Huh7-LR cells with small interference CERT1 (C, D) (**P<0.01, ***P<0.001). Fig.19 The clone formation ability of Huh7 cells overexpressing CERT1 (B) and Huh7-LR cells with interference of CERT1 (A) was detected by plate cloning under the treatment of oridonin B, lenvatinib alone or in combination with the two drugs. Fig. 20 The protein levels of CERT1 in Huh7-LR cells (A) and HCC-LM3-LR cells (B) under the treatment of Rubescensine B, lenvatinib alone or in combination with the two drugs. Fig.21Oridonin B, lenvatinib alone or in combination inhibit the invasion of drug-resistant HCC-LM3-LR cells (A, B) and Huh7-LR cells (C, D). Fig. 22 Oridonin B, lenvatinib alone or in combination inhibit the migration of drug-resistant Huh7-LR cells (A, B) and HCC-LM3-LR cells (C, D). Fig.23 Figures 2 and 3 show the tumor volume (A) and analysis (B) of nude mice in different drug groups (*P<0.05, ***P<0.001). Fig.24 Immunohistochemical staining and average optical density values ​​of CERT1 in tumor tissues of xenografted mice treated with different methods (**P<0.01, ***P<0.001). Fig.25 Figure 4 shows the expression of CERT1 in liver sections of patients who were sensitive and resistant to lenvatinib. DETAILED DESCRIPTION

[0023] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0024] Example 1: Study on the significant correlation between up-regulation of ceramide transport protein 1 (CERT1) expression and lenvatinib resistance

[0025] 1 Experimental Materials

[0026] 1.1 Cell lines:

[0027] (1) Human hepatoma cell line Huh7 (CTCC-003-0019) was purchased from Zhejiang Meisen Cell Technology Co., Ltd.;

[0028] (2) Hep-G2 cells were provided by the Liver Cancer Institute of Zhongshan Hospital, Fudan University.

[0029] (3) Human highly metastatic hepatocellular carcinoma HCC-LM3 cells were obtained from the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences.

[0030] Human liver cancer Huh7, Hep-G2 and HCC-LM3 cells were cultured in high-glucose DMEM medium (SH30243.01, Hyclone), supplemented with 10% fetal bovine serum (04-001-1ACS, Biological Industries) and 1% penicillin-streptomycin-amphotericin B (abs9246, Absin). All cells were cultured in a 37°C, 5% CO2 incubator. The culture medium was changed every two days. Subsequent experiments were performed using cells in the logarithmic growth phase.

[0031] 1.2 Materials and reagents:

[0032] (1) CCK8 kit was purchased from Chongqing Baoguang Biotechnology Co., Ltd. (2) 1% crystal violet was purchased from Solebol. (3) 4% paraformaldehyde was purchased from Beyotime. (4) RIPA lysis buffer (P0013) was purchased from Beyotime Biotechnology. (5) DMSO was purchased from Sigma. (6) RNA extraction kit was purchased from Shandong Sikejie Biotechnology Co., Ltd. (7) Reverse transcription reagents, fluorescent quantitative PCR and ECL ultrasensitive developer were purchased from Novazon. (8) PMSF protease inhibitor was purchased from White Shark. (9) PADF membrane was purchased from Merck Life Sciences, IPVH00010. (10) Lenvatinib was purchased from MCE. (11) Elesclomol (EL) was purchased from Selleck Chemicals. (12) Protein loading buffer was purchased from Yazyme. (13) BCA protein quantification kit was purchased from Shanghai Yisheng, 20201ES76.

[0033] 1.3qPCR related primer sequences:

[0034] (1)CERT 1-F(SEQ ID NO.1):AAAGGCCACAGTTTACGTGAG

[0035] (2)CERT 1-R (SEQ ID NO.2): CTTCTGTAGCGTGTCAACTTGT

[0036] (3)β-actin-F (SEQ ID NO.3): TGGCACCACACTTTCTACAA

[0037] (4)β-actin-R (SEQ ID NO.4): CCAGAGGCGTACAGGGATAG

[0038] (5)GAPDH-F (SEQ ID NO.5): GCACCGTCAAGGCTGAGAAC

[0039] (6) GAPDH-R (SEQ ID NO. 6): TGGTGAAGACGCCAGTGGA

[0040] 2 Experiments and Results

[0041] 2.1 Construction of Lenvatinib-resistant HCC cell lines

[0042] First, the IC50 value of lenvatinib on Huh7 and HCC-LM3 liver cancer cells was determined.

[0043] The cells were made into a cell suspension and inoculated in a 96-well plate at a density of 8000-10000 cells per well according to the cell growth rate and experimental design, with 5 replicate wells set in each group. PBS was added to the surrounding wells to reduce water evaporation, and 1, 2, 4, 8, 16, 24, 32, and 48 μM of lenvatinib were used for treatment for 24 hours; after treatment, the 96-well plate was taken out, 10 μL of CCK-8 reagent was added to each well tested, and incubated at 37°C in the dark for 1 hour. The OD value was detected at 450nm using an enzyme reader. GraphPad Prism 9 was used to statistically analyze the experimental results, calculate the IC50 (half-maximal inhibitory concentration value) of the cells, and draw graphs.

[0044] Next, 1 / 10 of the drug IC50 concentration was used to induce cell resistance, and the dose of lenvatinib was slowly increased by 2 μM each time. The cell IC50 concentration was tested monthly to observe cell resistance. Finally, Huh7 and HCC-LM3 cells were able to grow stably in the medium containing 10 μM and 20 μM lenvatinib concentrations, respectively, and the resistant strains Huh7-LR and HCC-LM3-LR were successfully constructed. Figure 1 As shown in A, compared with the parental cells, the IC50 value of the Huh7-LR resistant strain increased from 4.45 μM to 18.31 μM; Figure 1 As shown in B, the IC50 value of the HCC-LM3-LR resistant strain increased from 16.54 μM to 33.51 μM. The resistance index of the resistant strain Huh7-LR was 2.54; the resistance index of HCC-LM3-LR was 2.03.

[0045] 2.2 Reduced sensitivity of HCC resistant cells to lenvatinib

[0046] To further verify whether the construction of lenvatinib-resistant strains was successful, the sensitivity of Hep-G2, Huh7, Huh7-LR, HCC-LM3 and HCC-LM3-LR to lenvatinib was detected by plate cloning experiment.

[0047] Hepatoma cells were plated at 1*10 3 ~4*10 3 The cells were inoculated in a 12-well plate at a density of 10 cells / well. After the cells adhered to the wall, the drug was added to the cells for 24 hours and cultured for about 10 to 14 days. During the period of 2-3 days, the cell morphology was observed and the medium was changed in time. When obvious clone colony formation was observed under the microscope and the number of cells in each colony was greater than 50, the cell culture was terminated. Subsequently, it was fixed with 4% paraformaldehyde for 15 minutes, stained with 1% crystal violet for 15 minutes, and the stained colonies were washed with running water. Finally, a camera was used to record the colony formation, and the clone formation rate was calculated using Image J software for statistical analysis and drawing of graphs.

[0048] like Figures 2-3The results showed that after the treatment with 5, 10, and 20 μM of lenvatinib, the size and number of colonies formed by Hep-G2, Huh7, and HCC-LM3 cell clones decreased significantly; while the size and number of colonies formed by lenvatinib-resistant strains Huh7-LR and HCC-LM3-LR cell clones did not change significantly, indicating that the sensitivity of lenvatinib-resistant cells to lenvatinib treatment was significantly reduced, and the lenvatinib-resistant liver cancer strains Huh7-LR and HCC-LM3-LR were successfully constructed.

[0049] 2.3 Transcriptomic analysis of sphingolipid metabolism-related genes in parental and lenvatinib-resistant cells

[0050] To reveal the molecular mechanism of lenvatinib resistance in liver cancer, Huh7 and Huh7-LR cells were collected and transcriptome sequencing was performed to screen for differentially expressed genes between lenvatinib-resistant and parental cells.

[0051] The specific steps are as follows: 1) Collect cell samples: Use sufficient TRIzol lysis buffer to lyse liver cancer cells Huh7 and lenvatinib-resistant cells Huh7-LR, repeat 3 times for each group, 1×10 7 cells.

[0052] 2) RNA sequencing: extract total RNA from the sample, test the concentration and purity of RNA, separate and purify mRNA, fragment it, and synthesize double-stranded cDNA. Then, construct the sample library through adapter ligation and PCR amplification, and sequence the library using the high-throughput sequencing platform Illumina.

[0053] 3) Data processing: The raw data were preprocessed, including removal of adapter sequences and low-quality reads. Subsequently, the processed data were compared with the reference genome and statistically analyzed, and the expression of genes and transcripts was quantified. Genes related to sphingomyelin synthesis were screened out, and heat maps were generated based on the read count values. Sample processing and sequencing were completed by Shanghai Huaying Biotechnology Co., Ltd. Heat maps were generated using R language to observe the expression differences of sphingomyelin synthesis-related genes between resistant cells and parental cells.

[0054] Through transcriptomic analysis, Figure 4 The heat map results showed that after Huh7 cells became resistant to lenvatinib, the expression levels of genes related to sphingomyelin synthesis (SPTLC3, SPTSSA, SGMS1, SGMS2, ​​and VAPA) increased. Although there was no obvious trend in the transcription level of CERT1 gene, it was speculated that the upregulation of genes related to sphingomyelin synthesis might affect the protein expression of CERT1.

[0055] 2.4 Lipidomic analysis of Huh7 and Huh7-LR

[0056] Ceramide is a tumor suppressor molecule, and sphingomyelin is a tumor promoter molecule. The balance between the two sphingolipids is crucial to the occurrence and development of tumors. The non-cystic transport of ceramide from the endoplasmic reticulum to the Golgi apparatus mediated by ceramide transfer protein (CERT1) is the main pathway for sphingomyelin synthesis, which determines the ratio of ceramide and sphingomyelin in cells and affects cancer proliferation, stemness, and drug resistance. Therefore, targeted lipidomics detection was performed on Huh7 and Huh7-LR cells to detect the content of sphingomyelin and ceramide in cells.

[0057] The specific experimental steps are as follows: Huh7 and Huh7-LR liver cancer cells in the logarithmic growth phase were collected. The number of cells in each group was 5.0×10 6 to 1.0×10 7 Each group had 3 replicate samples. The cell samples were collected into EP tubes, the cell metabolic activity was quickly quenched with liquid nitrogen, and the samples were sent to Shanghai Zeli Biotechnology Co., Ltd. for lipidomics analysis. The company mainly uses a targeted lipidomics technology platform (ultra-high performance liquid chromatography-triple quadrupole mass spectrometry UPLC-TQMS) to quantitatively detect lipids in biological samples.

[0058] like Figure 5 The experimental results showed that compared with the parental cells, the ceramide level in liver cancer cells decreased (C14:0, C18:0) and the sphingomyelin level increased (C14:0, C18:0) after becoming lenvatinib-resistant, suggesting that sphingolipid metabolism is closely related to the lenvatinib resistance in liver cancer cells.

[0059] 2.5 Detection of CERT1 RNA and protein levels in parental and lenvatinib-resistant cells

[0060] In order to further confirm the expression of CERT1 in lenvatinib-resistant and parental cells, Huh7, Huh7-LR, HCC-LM3 and HCC-LM3-LR were selected to perform qRT-PCR experiments to detect the mRNA level of CERT1. The specific experimental steps of qPCR and Western Blot are as follows:

[0061] 1) qPCR: Total RNA was extracted using the SPARKeasy Cell RNA Rapid Extraction Kit. cDNA was generated using the II RT Super Mix for qPCR (+g DNA wiper) kit and then amplified using Cham Q SYBR Color qPCR Master Mix (Vazyme). Real-time fluorescence quantitative PCR detection was performed using the Realplex real-time fluorescence quantitative PCR system from Eppendorf SE. All experiments were performed according to the manufacturer's instructions. Each sample was replicated three times. β-actin or GAPDH was used as a reference, and 2 -ΔΔCT The relative expression difference was calculated.

[0062] 2) Western Blot: Collect cell pellets, add RIPA lysis buffer and 1mM PMSF (BL507A-1, bioSharp) to lyse on ice for 15min to extract protein, centrifuge, and take the supernatant. Then, use the BCA protein concentration assay kit to determine the protein concentration and normalize the protein concentration of the sample. Add 5×SDS loading buffer (P0015, Bio-Tech Bio) to the extracted cell lysate and denature at 100 degrees for 8min. Subsequently, take 20μg of protein in 7.5% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) and transfer to PADF membrane for Western blot analysis. After blocking the PVDF membrane with 5% skim milk powder, incubate the membrane with the primary antibody (dilution 1:2500) at 4°C overnight. The next day, incubate the membrane with HRP-labeled anti-rabbit IgG secondary antibody (1:1000) at room temperature for 1 hour. Finally, the target proteins were detected by ECL luminescence solution (E4230-02, Vazyme) and quantitatively analyzed using ImageJ 1.8.0 software.

[0063] like Figure 6 The results showed that, unlike the transcriptome data, CERT1 mRNA expression was significantly upregulated in lenvatinib-resistant cells. At the same time, Western Blot analysis showed that CERT1 protein expression was also significantly upregulated in lenvatinib-resistant cells. This suggests that CERT1-mediated sphingolipid metabolism may play an important role in lenvatinib resistance in liver cancer.

[0064] Example 2: CERT1 affects the sensitivity of liver cancer resistant cells to lenvatinib

[0065] 1 Experimental Materials

[0066] (1) CERT1 (NM_005713.3) overexpression plasmid with GFP tag was purchased from Shanghai Hanheng Biotechnology Co., Ltd. (2) CERT1 small interfering RNA was synthesized by Shanghai Genema Gene. (3) Lipu3000 DNA / siRNA transfection reagent (SB-C006, ShareBio) was purchased from Shanghai Shenger Biotechnology Co., Ltd.

[0067] (4) The sequence of the small interfering RNA is:

[0068] CERT-Homo-514 positive strand (SEQ ID NO.7): GUAAGUGGACAAACUACAUTT

[0069] CERT-Homo-514 antisense strand (SEQ ID NO.8): AUGUAGUUUGUCCACUUACTT

[0070] CERT-Homo-745 positive strand (SEQ ID NO.9): GGAUAGAUGCCAUUGAACATT

[0071] CERT-Homo-745 antisense strand (SEQ ID NO.10): UGUUCAAUGGCAUCUAUCCTT

[0072] 2 Experimental methods and results

[0073] 2.1 Transfection of Huh7 with CERT1 overexpression plasmid and transient transfection of Huh7-LR with CERT1 siRNA

[0074] 1) Plating: Digest the cells with trypsin and count them. Cells in the logarithmic growth phase were plated at 6×10 5 The density of cells was inoculated into a six-well plate, and the cell density reached 70%-90% on the second day;

[0075] 2) Prepare liposome nucleic acid transfection reagent complex (per well):

[0076] Solution A: 125μl serum-free medium + 2.5μg DNA + 5μl Lipu3000-A

[0077] Solution B: 125μl serum-free medium + 4μl Lipu3000-B

[0078] 3) Add the DNA diluted in solution A (1:1, v:v) to the reagent in solution B, mix well, and incubate at room temperature for 10 minutes to allow the DNA-liposome complex to form;

[0079] 4) Add DNA-liposome complexes to cells and observe the cell status 24 hours after transfection. If the cell status is good, collect samples for observation in 2-4 days; if the cell status is poor, replace fresh culture medium 24 hours or 12 hours after transfection.

[0080] 5) Culture the cells in a 37°C, 5% CO2 incubator for 2-4 days before conducting subsequent experiments.

[0081] 6) When transfecting siRNA into cells, follow the DNA protocol as above, but do not add Lipu3000-A reagent when diluting siRNA.

[0082] 2.2qRT-PCR verification of successful transfection of overexpression plasmid and small interfering RNA

[0083] 1) Collect samples: Collect the cells transfected in step 2.1 and extract RNA;

[0084] 2) RNA extraction:

[0085] 2-1) Add 500 μL Lysis Buffer to each tube of sample, mix by pipetting until there are no cell clumps, and let stand for 1 min;

[0086] 2-2) Add the mixture to the adsorption column RA, centrifuge at room temperature, 12000 rpm, 30 s, and discard the filter;

[0087] 2-3) Add 500 μL Washing Buffer D2 to the adsorption column, centrifuge at room temperature, 12000 rpm, 30 s, discard the filtrate, and repeat;

[0088] 2-4) Centrifuge at 12000 rpm for 2 min to remove the rinse solution and avoid ethanol residue;

[0089] 2-5) Place the adsorption column RA into a clean RNase Free centrifuge tube, add 25-50 μL of RNase Free H2O to the middle of the adsorption membrane, leave at room temperature for 1 min, and centrifuge at 10,000 rpm for 1 min.

[0090] 3) Reverse transcription:

[0091] 3-1) Take ice and thaw the RNA sample, Enzyme Mix, and 5×All-in-one qRT SuperMix obtained above on ice;

[0092] 3-2) Prepare the reverse transcription reaction system in an RNase-free centrifuge tube according to Table 1 below:

[0093] Table 1 Reverse transcription reaction system

[0094]

[0095] 3-3) Mix the prepared system thoroughly with a pipette, collect the tube at the bottom by centrifugation, and place it in a PCR instrument for reverse transcription. Set the program Step 1: 50℃, 15min; Step 2: 85℃, 5s;

[0096] 3-4) At this point, reverse transcription is completed and cDNA is obtained;

[0097] 3-5) Add 80 μL ddH2O (5-fold dilution) to the cDNA obtained above, and then use it for subsequent qRT-PCR experiments or store it at -20°C.

[0098] 4) qRT-PCR detection

[0099] 4-1) Prepare the reaction solution according to the composition in Table 2 below (operate on ice) with a total volume of 10 μL.

[0100] Table 2 qPCR reaction system component configuration

[0101]

[0102]

[0103] The reaction was carried out according to the reaction conditions in Table 3.

[0104] Table 3

[0105]

[0106] 2.3 Western Blot verification of successful transfection of overexpression plasmid and small interfering RNA

[0107] 1) Cell lysis and protein extraction: Select cells that have been transfected or grown well, discard the culture medium, add PBS to rinse twice, and discard the PBS; add 1 ml of trypsin, digest for 2 min, then add 1 ml of DMEM to terminate the digestion, collect the cells into an EP tube, centrifuge at 1200 rpm for 4 min at room temperature, and keep the precipitate; add Western and IP cell lysis buffer, lyse on ice for 15 min, centrifuge at 10000 rpm for 10 min at 4°C, discard the precipitate, and keep the supernatant; add 5X Loading buffer in proportion and cook for 8 min, cool and put into a -80°C refrigerator for use.

[0108] 2) Gel preparation: Prepare 7.5% separation gel according to the proportion, slowly pour about 5ml of separation gel with a pipette until it reaches the separation gel standard line, and then add anhydrous ethanol to seal the gel. After waiting for 30 minutes, the separation gel solidifies, carefully pour out the anhydrous ethanol, and use a water absorbent to absorb the remaining liquid. Then prepare 7.5% concentrated gel according to the proportion, slowly pour about 2ml of concentrated gel with a pipette, and gently insert a tooth comb after filling. Be careful to avoid bubbles during this process. Let the gel stand at room temperature for about 30 minutes.

[0109] 3) Electrophoresis: Add samples and clamp the prepared gel on the clamping plate, fix it on the electrophoresis rack, add electrophoresis solution, carefully pull out the comb, add appropriate amount of protein sample and marker; start running the gel at 80V constant voltage until bromophenol blue enters the separation gel and the standard lines separate, then adjust the voltage to 120V. Stop running the gel when bromophenol blue reaches the bottom of the separation gel.

[0110] 4) Transfer: Cut a PVDF membrane of appropriate size and soak it in methanol for activation. Place the gel and membrane in the transfer clip in the correct order (positive to negative: transfer pad, filter paper, PVDF membrane, gel, filter paper, transfer pad) without any bubbles in between. Transfer the protein from the gel to the PVDF membrane at 100V for 60 minutes.

[0111] 5) Blocking: The membrane was blocked with 5% skim milk at room temperature for 1.5 h.

[0112] 6) Apply primary antibody: After blocking, cut the band with the correct molecular weight and add it to the primary antibody working solution (CERT1:1*TBST=1:2500) and incubate at 4°C on a shaking table overnight.

[0113] 7) Washing the membrane: The next day, remove the strips, recover the primary antibody working solution, and wash with 1*TBST on a shaker for 3 times, 10 minutes each time.

[0114] 8) Apply secondary antibody: Prepare the corresponding secondary antibody according to the properties of the primary antibody (rabbit / mouse antibody: 1*TBST=1:1000), place the strip facing down in the secondary antibody working solution, and incubate at room temperature for 1 hour.

[0115] 9) Washing the membrane: Take out the strips, recover the secondary antibody working solution, and wash 3 times with 1*TBST on a shaker, each time for 10 minutes.

[0116] 10) Development: Prepare chemiluminescent solution and use chemiluminescent solvent to detect proteins on the membrane. Use a developer and fixer to expose the membrane, and select the clearest bands to take pictures and save.

[0117] The results are as follows: According to Example 1, after liver cancer cells become resistant to lenvatinib, the mRNA and protein levels of CERT1 increase. In order to further study the role of CERT1 in regulating lenvatinib resistance, Huh7 was transiently transfected with CERT1 overexpression plasmid and Huh7-LR was transiently transfected with CERT1 small interfering RNA. After 48 hours of transfection, the cells transfected with plasmid and small interfering RNA were collected, and the transfection efficiency was detected by RT-PCR and Western Blot. Figure 7 The results showed that after Huh7 cells were transfected with CERT1 overexpression plasmid, the mRNA and protein levels of CERT1 in the overexpression group were significantly increased compared with the control group. Figure 8 The results showed that after Huh7-LR cells were transfected with CERT1 small interfering RNA, the mRNA and protein levels of the siCERT1 group were significantly reduced compared with the control group.

[0118] 2.4 CCK-8 assay and plate cloning assay to detect the effect of CERT1 on the proliferation of hepatocellular carcinoma cells

[0119] Since CERT1 can transport ceramide to the Golgi apparatus for the synthesis of sphingomyelin, it is speculated that overexpression of CERT1 will cause a decrease in Cer and an increase in SM, thereby promoting the proliferation of drug-resistant liver cancer cells and inhibiting apoptosis. The effect of CERT1 on the proliferation of liver cancer cells was detected by CCK-8 assay and plate cloning assay.

[0120] First, the CCK-8 test results are as follows Fig. 9 As shown: It is known that Huh7 is sensitive to lenvatinib treatment, while Huh7-LR is not. Overexpression of CERT1 induces Huh7 cells to become resistant to lenvatinib, with increased cell viability and increased IC50 for lenvatinib; small interference CERT1 enhances the sensitivity of Huh7-LR cells to lenvatinib, with decreased cell viability and reduced IC50 of lenvatinib in resistant cells.

[0121] Similarly, in the plate cloning experiment, it can be observed that overexpression of CERT1 can eliminate the inhibitory effect of lenvatinib on Huh7, while interference with CERT1 expression reverses the resistance of Huh7-LR to lenvatinib treatment, inhibits the proliferation of Huh7-LR, and significantly reduces the size and number of cloned colonies. Fig.10 shown.

[0122] Example 3: Oridonin B binds to CERT1

[0123] 1 Experimental Materials

[0124] (1) Oridonin B was purchased from MCE Company; (2) Biotin-labeled Oridonin B was synthesized by Shanghai Huaying Biotechnology Co., Ltd. Its 1H-NMR and high-resolution mass spectra were as follows: Fig.11 As shown, Rubescensine B was successfully labeled with biotin, and the purity of the labeled product was above 95%; (3) HuProt TM Human proteome chip was purchased from Shanghai Huaying Biotechnology Co., Ltd.; (4) Trtion X-100 was purchased from Solebao Biotechnology Co., Ltd.; (5) BSA was purchased from Shanghai Biyuntian Biotechnology Co., Ltd.; (6) Streptavidin magnetic beads were purchased from Cell Signaling Technology; (7) FITC fluorescent secondary antibody and CERT1 primary antibody were purchased from Abcam; (8) Streptavidin-affinity CY3 fluorescent secondary antibody was purchased from APExBIO, USA.

[0125] 2 Experiments and Results

[0126] 2.1 HuProt of Rubescensine B TM Human proteome microarray analysis

[0127] HuProt TM Human proteome chip (purchased from Shanghai Huaying Biotechnology Co., Ltd.) is a simple, rapid and accurate drug target screening experimental technology. TM Human proteome microarray identifies proteins that interact with oridin B.

[0128] The chip was first incubated with 5% BSA blocking buffer at room temperature for 1.5 hours to prevent nonspecific proteins from binding to the chip surface. Then, it was incubated with 10 μM biotin-labeled oridonin B at room temperature for 1 hour. After the chip was fully washed, 0.1% Cy5-Streptavidn Solution was added and reacted at room temperature for 20 minutes. Finally, the chip was scanned using a GenePix 4000B scanner at 635 nm, Power (100%) to capture the fluorescent signal indicating the interaction between oridonin B and the protein. TM Pro v6.0 software reads the chip and obtains the raw data. In order to eliminate the signal inconsistency caused by background fluorescence changes, the background correction method is applied, that is, the raw signal intensity I of each site is equal to the median of the fluorescence signal value of each site divided by the median of the background signal value of each site. M is the median of the signal intensity of all sites, and SD is its standard deviation. The correction data Z-Score of each site is calculated (Z-Score = (IM) / SD). The higher the Z-Score, the more the protein binds to oridonin B.

[0129] HuProt TM Human proteome chip analysis, after deducting the biotin background, screened out proteins related to lipid metabolism that Rubescensine B may bind to according to experimental conditions. The higher the Z-score, the more complete the binding. The data is shown in Table 4. The Z-score of CERT 1 (also known as COL4A3BP) is 4.755, suggesting that Rubescensine B may target CERT 1 to exert its effect.

[0130] Table 4 Analysis results

[0131]

[0132] 2.2 Molecular docking of Rubescensine B and CERT1

[0133] In order to verify the molecular mechanism of Rubescensine B affecting the growth of liver cancer cells through CERT1, Rubescensine B was molecularly docked with the gene CERT1 screened by human proteome chip.

[0134] Download the pdb structure file corresponding to the core protein CERT1 from the RCSB PDB (https: / / www.rcsb.org) database, and use Pymol software to remove water molecules and receptor ligands. Download the 2D structure of Rubescensine B from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov / ), optimize the mechanical structure with ChemDraw3D 16.0 and save it in mol2 format. Use Auto Duck Tools 4.0 software to perform molecular docking of Rubescensine B and CERT1, select Pymol software to display the results of the binding site, and draw a molecular docking pattern diagram. The size of the score value is used to judge the tightness or binding ability of the compound to the target.

[0135] Active ingredients with binding energy ≤-5.0 kcal / mol were selected as the basis for target screening, which means that their biological affinity and activity are good. The smaller the binding energy, the easier it is for the component that interacts with the target to bind and react. As shown in Table 5, the binding energy of Rubescensine B with the target molecule CERT 1 is -10.4, and the two are easy to bind and react.

[0136] Table 5 Docking results of Rubescensine B and CERT1

[0137]

[0138] 2.3 Immunofluorescence: Oridonin B binds to CERT1

[0139] In order to verify that CERT1 is the binding target of Rubescensine B, immunofluorescence technology was used to detect the co-localization of the two in cells.

[0140] Huh7-LR and Hep-G2 cells were cultured at 1×10 5 The cells were seeded at a density of 100 μg / mL in a six-well plate containing a cell slide. After the cells adhered overnight, oridonin B and biotin-labeled oridonin B were added for treatment for 24 hours. After the treatment, the cells were fixed with 4% paraformaldehyde for 10 minutes, then permeabilized with 0.5% Triton X-100 for 5 minutes, and blocked with 5% BSA for 1 hour at room temperature. Next, the samples were incubated with the CERT1 primary antibody at 4°C overnight. The next day, after washing with PBS, FITC and CY3 fluorescently labeled secondary antibodies with biotin avidin tags were added, and incubated in the dark for 1 hour at room temperature. Finally, 10 μL of mounting medium containing DAPI was taken for light-proof mounting. After natural air drying, a laser scanning confocal microscope was used to observe and record the co-localization of biotin and CERT1. Fig.12 The results showed that Rubescensine B co-localized with CERT1 in the cytoplasm.

[0141] 2.4 Co-immunoprecipitation: Rubescensine B directly binds to CERT1

[0142] To further determine whether Rubescensine B can directly bind to CERT1, biotin-labeled Rubescensine B (Bio-Pon) was added to Hep-G2 and Huh7-LR cells and incubated for 24 hours to perform endogenous immunoprecipitation experiments.

[0143] The specific steps of co-immunoprecipitation are as follows: Huh7-LR and Hep-G2 cells were cultured at 6×10 5 The cells were seeded at a density of 100 μg / mL in a six-well plate. After the cells adhered overnight, DMSO, oridonin B and biotin-labeled oridonin B were added for treatment for 24 hours. After the treatment, the cells were removed, IP lysis buffer and protease inhibitors were added, the cells were scraped with a cell scraper, transferred to a pre-cooled EP tube, left to stand on ice for 15 minutes, and centrifuged at 4°C to obtain the supernatant. The protein sample was divided into two parts, one for input sample and the other for IP detection. The streptavidin magnetic beads were washed with cell lysis buffer. Subsequently, the protein solution for IP detection was added to the EP tube with magnetic beads, placed on a flip mixer, and incubated overnight at 4°C. The next day, unbound proteins were removed using a magnetic separator, and the streptavidin affinity magnetic beads were thoroughly washed with PBS. Subsequently, a mixture of PBS and loading buffer prepared in proportion was added to the magnetic beads, and denatured at 100°C for 5 minutes. Finally, Western Blot detection was performed. Among them, the primary antibody was Anti-CERT antibody (1:2500, AB72536, Abcam)

[0144] Biotin-avidin magnetic beads were used to pull down proteins that can bind to oridonin, such as Fig.13 Western Blot analysis showed that CERT1 protein was detected at 71 kDa, indicating that Rubescensine B can bind endogenously to the CERT1 molecule.

[0145] Example 4: Oridonin inhibits CERT1 activity and expression and regulates cellular sphingomyelins (SM) and ceramide levels

[0146] 1 Experimental Materials

[0147] (1) BODIPY-C5-Ceramide was purchased from MCE; (2) HPA-12 was purchased from Tokyo Chemical Industry (TCI); (3) Non-targeted lipidomics was provided by Meiji Biotechnology; (4) Targeted lipidomics was provided with technical support by Shanghai Zeli Biotechnology Co., Ltd.

[0148] 2 Experiments and Results

[0149] 2.1 Detection of CERT1 activity inhibition by Rubescensine B in living cells with fluorescent labeling

[0150] BODIPY-C5-Ceramide is a fluorescent analog of ceramide, which can be transported to the Golgi apparatus through the ceramide transporter or vesicle pathway, thereby indirectly reflecting the transport activity of CERT1 from the endoplasmic reticulum to the Golgi apparatus. In order to further study the effect of Rubescensine B on the activity and expression of CERT1 in liver cancer resistant cells Huh7-LR and HCC-LM3-LR, the transport of fluorescently labeled exogenous ceramide BODIPY-C5-Ceramide by CERT1 was analyzed.

[0151] The following experimental steps were performed: first, a cell suspension was prepared and adherent cells were seeded in a six-well plate; then, the cells were incubated with oridonin B and HPA-12 for 24 hours; then, 100 μL of the staining working solution was added, gently shaken to evenly cover the cell surface, and incubated at 4°C for 20-30 minutes (this temperature setting is intended to exclude the influence of vesicle transport). After that, the staining working solution was discarded, oridonin B and HPA-12 were added and incubated for 15 minutes, and then fresh culture medium was replaced and incubated at 37°C for another 15 minutes. Finally, the cells were washed twice with culture medium for 5 minutes each time, and then the cells were observed by fluorescence microscopy.

[0152] like Fig.14As shown in the figure, it can be observed that the fluorescent probe is mainly distributed in the cytoplasm (marking the endoplasmic reticulum) at 0 min; and distributed in the perinuclear region (marking the Golgi apparatus) after 30 min, showing a dotted distribution. Consistent with the positive control CERT1 inhibitor HPA-12, Rubescensine B can inhibit the transport activity of CERT1, so that the fluorescent probe cannot be transported to the Golgi apparatus by CERT1 and is mainly distributed in the endoplasmic reticulum.

[0153] 2.2 Oridonin inhibits CERT1 activity and expression in lenvatinib-resistant hepatocellular carcinoma cells

[0154] In order to study the effect of Rubescensine B on the activity of CERT1, the activity of CERT1 is regulated by phosphorylation. The phosphorylation of CERT1 was examined by Western Blot experiment. The fast migration band corresponds to the active / hypophosphorylated form of CERT1; the slow migration band corresponds to the inactive / hyperphosphorylated form. The experimental operation is the same as 2.5 in Example 1.

[0155] like Fig.15 As shown in A to B in Figure 1, compared with the control group, the expression of both active and inactive forms of CERT1 decreased significantly after the action of Rubescensine B, which is consistent with the results of HPA-12 in the CERT1 inhibitor group. Fig.15 The qRT-PCR results of C to D in Figure 1 also showed that the mRNA level of CERT1 decreased significantly after the action of oridonin B. In summary, oridonin B can inhibit the activity and expression of CERT1 in lenvatinib-resistant liver cancer cells Huh7-LR and HCC-LM3-LR.

[0156] 2.3 Oridonin inhibits sphingomyelin and ceramide levels in Hep-G2 cells

[0157] Metabolic changes are a recognized hallmark of cancer, and the occurrence of liver cancer is inevitably accompanied by lipid disorders and metabolic changes. In order to study the molecular mechanism of oridonin in liver cancer, the effect of oridonin on lipid metabolism in liver cancer cells Hep-G2 was analyzed by non-targeted lipidomics.

[0158] Hep-G2 hepatoma cells in the logarithmic growth phase were collected and divided into two experimental groups: DMSO control group and Rubescensine B treatment group. The number of cells in each group was 1.0×10 7 Each group had 3 replicate samples. The cell samples were collected into EP tubes, and the cell metabolic activity was quickly quenched with liquid nitrogen. The samples were sent to Shanghai Meiji Biotechnology Co., Ltd. for non-targeted lipidomics analysis.

[0159] The instrument platform used for LC-MS analysis was the Thermo Fisher Scientific's ultra-high performance liquid chromatography tandem Fourier transform mass spectrometry UHPLC-Q Exactive HF-X system. Among them, the chromatographic conditions were: the chromatographic column was an Accucore C30 column (100mm×2.1mmi.d., 2.6μm; Thermo); the mobile phase A was 50% acetonitrile aqueous solution (containing 0.1% formic acid, 10mmol / L ammonium acetate), and the mobile phase B was acetonitrile / isopropanol / water (10 / 88 / 2) (containing 0.02% formic acid, 2mmol / L ammonium acetate), the injection volume was 5μL, and the column temperature was 40℃. Mass spectrometry conditions: the sample was electrospray ionized, and the mass spectrometry signals were collected in positive and negative ion scanning modes respectively. Among them, sample processing, LC-MS analysis and data analysis were completed by Shanghai Meiji Biotechnology Co., Ltd.

[0160] The data of the DMSO group and the PON-treated group of Hep-G2 cells were compared and analyzed, and the substances that met VIP ≥ 1.0, p ≤ 0.05, and the difference multiple was 1 were regarded as the differential metabolites between the two groups, such as Fig.16 As shown in A in Figure 1, there are 258 differential metabolites that meet VIP ≥ 1.0, p ≤ 0.05, and a difference factor of 1. Then SM and Cer were screened out from the differential lipid metabolites for VIP analysis, as shown in Figure 1. Fig.16 In B, it can be observed that sphingomyelin decreased and ceramide increased after administration. In addition, KEGG analysis was performed on 258 differential metabolites, such as Fig.16 C and D in the figure show that the action of Rubescensine B may be related to the sphingolipid metabolism pathway and sphingolipid signaling pathway, which has significant research significance.

[0161] The above studies have proved that oridonin binds to CERT1 and regulates sphingolipid metabolism in liver cancer cells. We speculate that oridonin regulates CERT1, increases ceramide levels, reduces sphingomyelin levels, inhibits the growth and proliferation of liver cancer cells, and promotes apoptosis.

[0162] 2.4 Oridonin inhibits sphingomyelin and ceramide levels in Huh7-LR cells

[0163] As a key molecule in sphingolipid metabolism, CERT1 determines the ratio of intracellular ceramide and sphingomyelin, affecting the proliferation, invasion, migration and drug resistance of cancer cells. Targeted lipidomics was used to detect the levels of ceramide and sphingomyelin in Huh7-LR cells.

[0164] Hepatoma cells Huh7 and Huh7-LR in the logarithmic growth phase were collected. The experimental groups included Huh7 and Huh7-LR; DMSO control group of Huh7-LR and Rubescensine B treatment group. The number of cells in each group was 5.0×10 6 to 1.0×107 Each group had 3 replicate samples. The cell samples were collected into EP tubes, and the cell metabolic activity was quickly quenched with liquid nitrogen. The samples were sent to Shanghai Zeli Biotechnology Co., Ltd. for lipidomics analysis. The targeted lipidomics technology platform (ultra-high performance liquid chromatography-triple quadrupole mass spectrometry UPLC-TQMS) was mainly used to quantitatively detect lipids in biological samples.

[0165] like Fig.17 As shown, consistent with the results of non-targeted lipidomics, after the action of oridonin B, the ceramide level increased and the sphingomyelin level decreased, except for sphingomyelin (d18:1|16:0), indicating that oridonin B can inhibit the CERT1 activity and expression of lenvatinib-resistant cells Huh7-LR, regulate the levels of cellular sphingomyelin and ceramide, thereby inhibiting the proliferation of resistant liver cancer cells and reversing resistance.

[0166] Example 5: Oridonin-Lenvatinib combination increases the sensitivity of liver cancer cells to Lenvatinib via CERT1

[0167] 1 Experimental Materials

[0168] (1) Edu detection kit was purchased from Bio-Tech Pharmaceuticals; (2) Matrigel was purchased from Corning Incorporated; (3) Protein loading buffer, rapid blocking solution, and protein stripping solution were purchased from Yazyme Corporation.

[0169] 2 Experiments and Results

[0170] 2.1 Oridonin-lenvatinib combination can inhibit the DNA replication ability of Huh7 cells overexpressing CERT1 and Huh7-LR cells expressing small interfering CERT1

[0171] In order to explore the role of CERT1 in the combination of oridonin and lenvatinib, Huh7 transiently transfected with CERT1 overexpression plasmid and Huh7-LR transiently transfected with CERT1 small interfering RNA were used. The experimental groups were control group, 10μM lenvatinib alone group, 15μM oridonin alone group, and 15μM oridonin-10μM lenvatinib combination group. EdU fluorescence detection was performed after 24h of treatment. Cell proliferation was determined by EDU incorporation experiment (C0071S, Beyotime, Shanghai, China). Cells were cultured at 4×10 4Cells were seeded at 12-well plates at 400 μL density. After overnight attachment, cells were treated according to the experimental design and then incubated with 10 μM EdU in an incubator for 2 h. Cells were fixed with 4% paraformaldehyde for 15 min at room temperature. Cells were permeabilized with 0.3% Triton X-100 for 15 min, and then 500 μL Click reaction solution was added and incubated at room temperature in the dark for 30 min. Cell nuclei were counterstained with Hoechst 33342 for 10 min. EdU was detected by inverted fluorescence microscopy.

[0172] The EDU reagent test results show: Fig.18 As shown in A and B in Figure 1, overexpression of CERT1 induces Huh7 cells to become resistant to lenvatinib and enhances DNA replication, while the combination of Rubescensine B and lenvatinib can reverse the effects caused by overexpression of CERT1, restore sensitivity to lenvatinib, and inhibit DNA replication of Huh7. Fig.18 As shown in Figures C and D, siCERT1 expression enhances the sensitivity of Huh7-LR to lenvatinib and inhibits DNA replication. At the same time, the inhibitory effect of oridonin combined with lenvatinib is more significant.

[0173] 2.2 The combination of Rubescensine B and Lenvatinib can inhibit the cell clone formation ability of Huh7 overexpressing CERT1 and Huh7-LR interfering with CERT1

[0174] The experimental operation is the same as in Example 1, 2.2. In the plate cloning experiment, Fig.19 As shown in B, overexpression of CERT1 can eliminate the inhibitory effect of lenvatinib on Huh7, and the combination of Rubescensine B and lenvatinib can reverse the proliferation-promoting effect of CERT1 overexpression. Fig.19 As shown in A, interference with CERT1 expression reversed the resistance of Huh7-LR to lenvatinib treatment and inhibited the proliferation of Huh7-LR. The size and number of cloned colonies decreased significantly. The combination of oridonin and lenvatinib had a significant synergistic effect, significantly inhibiting the size and number of colonies formed by Huh7-LR cell clones.

[0175] 2.3 Oridonin-lenvatinib combination significantly inhibited the protein expression of CERT1 in Huh7-LR and HCC-LM3-LR

[0176] In order to study the protein expression of CERT1 in the combination of Rubescensine B and lenvatinib, the expression of CERT1 in lenvatinib-resistant liver cancer cells Huh7-LR and HCC-LM3-LR was detected by Western Blot experiment, and the operation was the same as 2.5 in Example 1.

[0177] like Fig. 20The data showed that the combination of Rubescensine B and Lenvatinib significantly inhibited the expression of CERT1, thereby regulating sphingolipid metabolism and inhibiting the proliferation of drug-resistant liver cancer cells.

[0178] 2.4 The combination of Rubescensine B and Lenvatinib significantly inhibited the invasion ability of Huh7-LR and HCC-LM3-LR

[0179] In order to study the effect of the combination of Rubescensine B and Lenvatinib on the migration ability of Huh7-LR and HCC-LM3-LR cells, the following experiments were performed:

[0180] Will Matrix LDEV-Free matrix gel was diluted with serum-free DMEM medium at a volume ratio of 1:8. Then, 60 μl of the diluted matrix gel was added to each well of a 24-well plate and spread evenly on the -The upper chamber of a 48-well permeable support plate (Corning). After the matrix gel is completely solidified, the cell suspension in serum-free medium is injected into the upper chamber, and 600 μl of complete medium is added to the lower chamber. After 48 hours of incubation, the liquid in the upper and lower chambers is aspirated, and 300 μl of 4% paraformaldehyde fixative is added to the lower chamber for 30 minutes. Subsequently, the cells are stained with crystal violet, and the excess dye in the upper chamber wells is gently wiped off with a cotton swab. Finally, the cell migration in the lower chamber wells is observed under a microscope.

[0181] like Fig.21 The results showed that the Rubescens group significantly inhibited the invasion of drug-resistant cells. In addition, compared with the lenvatinib group, the combination of Rubescensine B and lenvatinib significantly inhibited the invasion of drug-resistant cells.

[0182] 2.5 The combination of Rubescensine B and Lenvatinib significantly inhibited the migration ability of Huh7-LR and HCC-LM3-LR

[0183] In order to study the effect of Rubescensine B-lenvatinib combination on the invasion ability of Huh7-LR and LM3-LR cells, Huh7-LR and HCC-LM3-LR cells were plated at 8×10 5 The cells were seeded in a 6-well plate at a density of . The next day, a scratch test was performed and the cell debris was removed by washing with PBS. Subsequently, the cells were cultured in DMEM medium containing 2% fetal bovine serum. The experiment was divided into four groups: DMSO control group, lenvatinib treatment group, oridonin treatment group, and oridonin and lenvatinib combined treatment group. Cell images were taken at 0 hours, 24 hours, 48 ​​hours, and 72 hours under an inverted microscope to observe cell migration.

[0184] like Fig. 22The results showed that after 48h and 72h of treatment with oridonin B, the scratch width of Huh7-LR and HCC-LM3-LR was much larger than that of the control group, indicating that oridonin B can significantly inhibit the migration ability of Huh7-LR and HCC-LM3-LR cells, and the inhibitory effect of the combination of oridonin B and lenvatinib is more significant, and there is a synergistic effect.

[0185] Example 6: In vivo study on the enhancement of sensitivity of lenvatinib by Rubescensine B

[0186] 1 Experimental Materials

[0187] (1) Oridonin B was purchased from MCE, USA; (2) Nude mice were 4-week-old BALB / C-nude male mice purchased from Shanghai Jihui Experimental Animal Co., Ltd.; (3) Immunodeficient mouse feed and corn bedding were purchased from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.; (4) Isoflurane was purchased from Shenzhen Ruiwode Biotechnology Co., Ltd.

[0188] 2 Experiments and Results

[0189] 2.1 Oridonin-lenvatinib combination inhibits the growth of liver cancer xenografts in nude mice

[0190] (1) Tumor implantation: Collect Huh7-LR cell pellets, add PBS and gently resuspend to make a suspension and count. Dilute the suspension to 5×10 7 cells / mL. Take 200 μL of the above cell suspension and inoculate it subcutaneously and in the axillary area of ​​nude mice to construct a tumor-bearing nude mouse transplant model. The temperature conditions for animal breeding were 24±1°C, the relative humidity was 55±5%, and the care cycle was 12h. All animal handling and experimental procedures were carried out in accordance with the guidelines for the use of experimental animals issued by the Ethics Committee of Shanghai Health Medical College;

[0191] (2) Grouping: 10 days after tumor formation, mice were randomly divided into the following groups: negative control group (PBS / d); lenvatinib group (10 mg / kg / d); oridonin group (20 mg / kg / d); oridonin (20 mg / kg / d) + lenvatinib group (10 mg / kg / d);

[0192] (3) Administration: The drug was administered by gavage once a day. The combination group was given drugs every 6 hours for 28 days. The tumor volume of nude mice was measured every 5 days during this period.

[0193] (4) Tumor sampling: After isoflurane anesthesia, the nude mice were killed and the tumors were removed, rinsed with saline, and photographed.

[0194] The Huh7-LR was used to construct a tumor-bearing nude mouse transplant model, and the mice were randomly divided into groups after the tumors grew to the 10th day. Four groups were set up, with 5 nude mice in each group, namely: Control group, 10mg / kg lenvatinib group, 20mg / kg oridonin group, and 10mg / kg lenvatinib + 20mg / kg oridonin group. The interval between the two administrations in the combined medication group was 6h, and the tumors were removed for analysis 28 days after administration.

[0195] like Fig.23 The results showed that compared with the control group, the tumor volume of the combined treatment group of 10 mg / kg lenvatinib and 20 mg / kg oridonin B was significantly decreased, indicating that the combination of oridonin B and lenvatinib has a synergistic effect in vivo and can inhibit the growth of drug-resistant liver cancer transplanted tumors in nude mice (*P<0.05, **P<0.01).

[0196] 2.2 The combination of Rubescensine B and Lenvatinib significantly inhibited the expression of CERT1 in mice

[0197] To investigate the effect of Rubescensine B-lenvatinib combination on CERT1 in the nude mouse lenvatinib-resistant xenograft tumor model, paraffin-embedded sections of Huh7-LR nude mouse xenograft tumors were prepared and immunohistochemical detection was performed using COL4A3BP antibody to detect CERT1 expression.

[0198] The specific steps are as follows: Tumor tissues were fixed with 4% paraformaldehyde at 4°C overnight and then embedded in paraffin. Paraffin sections (4-6 μm) were dewaxed. Subsequently, antigen retrieval was performed in a sodium hydrochloric acid solution at 120°C for 15 minutes. Nonspecific binding was blocked with goat serum (162-10064; Gibco) at room temperature, and the sections were incubated with COL4A3BP primary antibody (1:50, 15191-1-AP, proteintech) at 4°C overnight. The next day, HRP-labeled goat anti-rabbit antibody ((1:1000, A0208, Beyotime) was incubated for 1 hour at 37°C. The samples were stained with DAB solution and counterstained with hematoxylin. Finally, images were taken using a microscope. Quantitative analysis under the microscope was performed by immunohistochemistry, and quantification was performed by the mean optical density (MOD) value, which is equal to the staining intensity multiplied by the staining area divided by the total tissue area.

[0199] like Fig.24 As shown in the results, it was observed that the expression of CERT1 in the combination group of Rubescensine B-Lenvatinib was significantly decreased, which was consistent with the results of in vitro experiments. This indicates that the combination of Rubescensine B-Lenvatinib can regulate sphingolipid metabolism through CERT1, reverse lenvatinib resistance, and inhibit the in vivo proliferation of lenvatinib-resistant liver cancer cells.

[0200] 2.3CERT1 is significantly expressed in liver samples of patients with lenvatinib resistance

[0201] To investigate the clinical significance of CERT1, a key gene in sphingolipid metabolism, in lenvatinib resistance, the expression of CERT1 in HCC patients receiving adjuvant lenvatinib therapy was analyzed by immunohistochemistry.

[0202] All samples were collected according to the protocol approved by the Ethics Review Committee of the Second Military Medical University (approval number: 82320205), and written informed consent was obtained from each donor. A total of 60 liver cancer tissue samples that received adjuvant treatment with lenvatinib from 2018 to 2020 were collected from the clinical sample tissue chip purchased by Bioss, including 30 lenvatinib-sensitive samples and 30 lenvatinib-resistant samples. Liver cancer patients who received adjuvant treatment with lenvatinib and whose cancer recurred were classified as the lenvatinib-resistant group, while those who did not relapse were classified as the lenvatinib-sensitive group. In short, COL4A3BP antibody (1:50, 15191-1-AP, proteintech) was used to perform immunohistochemistry on paraffin-embedded liver cancer samples. The specific experimental operation of immunohistochemistry is the same as that in Section 2.2 of this Example.

[0203] like Fig.25 As shown in Figure 2, it was found that liver cancer tissue samples resistant to lenvatinib had higher CERT1 expression levels. This suggests that CERT1 may play an important role in liver cancer resistance to lenvatinib.

[0204] In summary, Rubescensine B reverses the resistance to lenvatinib in primary liver cancer by regulating ceramide transporter. In in vitro experiments, Huh7 and HCC-LM3 cells were selected as research objects, and lenvatinib-resistant strains Huh7-LR and HCC-LM3-LR were constructed. Clinical tissue microarray, transcriptomics, Western Blot and qRT-PCR experiments verified that CERT1 affects the sensitivity of lenvatinib-resistant liver cancer cells to lenvatinib. CERT1 overexpression plasmid and small interfering RNA were introduced, and the effect of CERT1 on the sensitivity of lenvatinib-resistant liver cancer cells was analyzed by Western Blot, qRT-PCR, CCK8 and plate cloning. In the mechanism study, qRT-PCR, Western Blot, lipidomics, proteomic chip analysis, immunofluorescence, immunoprecipitation, live cell fluorescence labeling and other experiments verified that Rubescensine B binds to and inhibits CERT1 activity and expression, regulates sphingolipid metabolism, increases cellular ceramide levels, and reduces sphingomyelin levels, thereby inhibiting proliferation, promoting apoptosis, and improving liver cancer resistance. In the in vivo experiment, Huh7-LR cells were injected subcutaneously into BALB / c-Nude mice to establish a lenvatinib-resistant tumor-bearing mouse model, and Rubescensine B was administered orally, which verified that Rubescensine B alone or in combination with lenvatinib synergistically inhibited the mouse liver cancer resistance tumor-bearing model.

[0205] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. Application of Rubescensine B in the preparation of drugs for increasing the sensitivity of liver cancer cells to growth factor receptor tyrosine kinase inhibitors.

2. The use according to claim 1, characterized in that: The growth factor receptor tyrosine kinase inhibitor is lenvatinib.

3. Application of Rubescensine B combined with growth factor receptor tyrosine kinase inhibitors in the preparation of synergistic anti-liver cancer drugs.

4. The use according to claim 3, characterized in that: The growth factor receptor tyrosine kinase inhibitor is lenvatinib.

5. The use according to claim 4, characterized in that: The effective dose of oridonin B is 12 to 18 μM, and the effective dose of lenvatinib is 7 to 13 μM.

6. Application of Rubescensine B combined with growth factor receptor tyrosine kinase inhibitors in the preparation of drugs to combat the invasion and metastasis of drug-resistant liver cancer.

7. The use according to claim 6, characterized in that: The growth factor receptor tyrosine kinase inhibitor is lenvatinib.

8. An anti-liver cancer pharmaceutical composition, characterized in that: The anti-liver cancer pharmaceutical composition comprises oridonin and a growth factor receptor tyrosine kinase inhibitor.

9. The anti-liver cancer pharmaceutical composition according to claim 8, characterized in that: The anti-liver cancer pharmaceutical composition also includes a pharmaceutically acceptable carrier.

10. The anti-liver cancer pharmaceutical composition according to claim 9, characterized in that: The carrier includes one or more of a diluent, a filler, an excipient, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier, a lubricant and a flavoring agent.

Images