Application of miR-378a-5p in preparation of intestinal health protection product

Abstract

The invention belongs to the technical field of biology, and relates to an application of miR-378a-5p in preparation of intestinal health protection products, model test research finds that miR-378a-5p can improve symptoms of diseases such as diarrhea and hemafecia of mice with colitis and reverse damage of DSS to colon tissues of the mice, has an obvious effect of relieving colitis, and can be used for preparing intestinal health protection products. The method can be used for preparing intestinal health protection products.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to an application of miR-378a-5p in the preparation of an intestinal health protection product. Background Art

[0002] Inflammatory bowel disease (IBD), including Crohn's disease and ulcerative colitis (UC), is a chronic and recurrent disease characterized by intestinal inflammation. Enteritis is very harmful to the intestines and may cause damage to the intestinal mucosa, intestinal stenosis, and intestinal polyps, which are very harmful to the human body. Therefore, when enteritis occurs, it is necessary to pay attention to avoid damage to the intestines.

[0003] At present, the treatments for intestinal inflammation and intestinal damage are: adjusting diet, drug therapy and surgical treatment. Among them, the drugs used in drug therapy include antibiotics, protective agents, etc., but these drugs have problems such as treating symptoms but not the root cause, obvious side effects, single effect and high price; in addition, most of these drugs are chemical components and will produce side effects. In recent years, more and more studies have shown that exosomal microRNA derived from body cells is a new type of cell messenger that connects the communication between the body and intestinal microorganisms. MicroRNA is a type of non-coding single-stranded RNA molecule with a length of about 22 nucleotides that is commonly present in cells. It degrades target mRNA molecules or inhibits the translation of target mRNA by complementary pairing with the 3' untranslated region of target mRNA, thereby affecting gene expression and further affecting multiple physiological functions of the body. Although microRNA accounts for a small proportion of total cellular RNA, it can efficiently regulate all mRNAs with target sites. Therefore, the role of microRNA in the development of organisms and the occurrence and development of inflammation cannot be ignored.

[0004] Therefore, developing a microRNA-related product that can effectively improve or alleviate colitis is the current focus of research and development in this field. Summary of the invention

[0005] The purpose of the present invention is to provide a miR-378a-5p that can alleviate colitis and its application in the preparation of intestinal health protection products, so as to solve the technical problems of existing products related to the prevention and treatment of colitis, such as treating symptoms but not the root cause, obvious side effects, single effect and high price.

[0006] Through model experiments, the present invention found that miR-378a-5p can improve disease symptoms such as diarrhea and bloody stools in colitis mice, reverse the damage of DSS to the colon tissue of mice, and has a significant effect on relieving colitis. It can be used to prepare intestinal health protection products. In addition, miR-378a-5p is safe, has no side effects, has a wide source, and is low in cost.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] An application of miR-378a-5p in the preparation of intestinal health protection products.

[0009] Application of miR-378a-5p in preparing an intestinal health protection product by reversing weight loss and shortened colon length in colitis mice.

[0010] An application of miR-378a-5p in preparing an intestinal health protection product by reducing the disease activity index, spleen and cecum index of colitis mice.

[0011] A miR-378a-5p is used in the preparation of intestinal health protection products by improving the symptoms of diarrhea and bloody stools in colitis mice and reversing the damage of DSS to the colon tissue of mice.

[0012] An application of miR-378a-5p in preparing an intestinal health protection product by improving the crypt structure of mouse colon.

[0013] A use of miR-378a-5p in preparing an intestinal health protection product by reducing colon inflammatory factors and increasing the content of ZO-1 and Occludin in the colon.

[0014] Colonic inflammatory factors include IL-2, IL-1β, IL-4, IL-6, TNF-α and / or IL-10.

[0015] Intestinal health protection products include food, medicine or health products.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. Through model experiments, the present invention found that miR-378a-5p can significantly reverse the weight loss and shortened colon length of colitis mice, reduce the disease activity index (DAI), spleen and cecum index of colitis mice, improve the disease symptoms such as diarrhea and bloody stools in colitis mice, reverse the damage of DSS to the colon tissue of mice, reduce colon inflammatory factors and increase the content of tight junction-related proteins such as ZO-1 and Occludin in the colon, thereby alleviating intestinal inflammatory response and having a protective effect on intestinal health.

[0018] 2. The present invention also found that miR-378-5p can significantly improve the intestinal flora composition of colitis mice.

[0019] 3. The miR-378a-5p involved in the present invention has a sequence of CUCCUGACUCCAGGUCCUGUGU, is safe and has no side effects, has a wide source and low cost; it is especially abundant in breast milk exosomes and is safer.

[0020] 4. Through research, the present invention has found that both artificially synthesized and naturally enriched miR-378a-5p have a good protective effect on intestinal health, and can be used in the preparation of intestinal health protection products, especially in the preparation of foods, medicines or health products related to intestinal health, and has broad market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Experimental protocol for colitis model and miR-378-5p or miR-378a-5p Scramble intervention in animals;

[0022] Figure 2 The weight changes of mice in each group during the experiment;

[0023] Figure 3 The effect of miR-378-5p on stool characteristics and colon length in DSS colitis mice;

[0024] Figure 4 The effect of miR-378-5p on the disease activity index (DAI) of DSS colitis mice;

[0025] Figure 5 The effect of miR-378-5p on spleen index and cecum index in DSS colitis mice;

[0026] Figure 6 The H&E staining sections of colon tissues of mice in each group at 10x and 20x magnifications;

[0027] Figure 7 The effect of miR-378-5p on the mRNA expression levels of IL-2, IL-1β, IL-6, TNF-α, and IL-10 in the colon of mice with DSS colitis;

[0028] Figure 8 The effect of miR-378-5p on the expression levels of ZO-1 and Occludin in the colon of DSS colitis mice;

[0029] Fig. 9 The immunofluorescence results of the expression levels of ZO-1 and Occludin in the colon of each group of mice at 10x and 20x magnifications;

[0030] Fig.10 The effect of miR-378-5p on the intestinal flora composition of DSS colitis mice;

[0031] Fig.11 The experimental protocol for the colitis mouse model and intervention of miR-378-5p-enriched breast milk exosomes in animals;

[0032] Fig.12 Effects of miR-378-5p-enriched breast milk exosomes on the body weight of mice with DSS colitis;

[0033] Fig.13 The effect of breast milk exosomes enriched with miR-378-5p on stool characteristics and colon length in DSS colitis mice;

[0034] Fig.14 The effect of breast milk exosomes enriched with miR-378-5p on the disease activity index (DAI) of DSS colitis mice;

[0035] Fig.15 The effect of breast milk exosomes enriched with miR-378-5p on spleen index and cecum index in DSS colitis mice;

[0036] Fig.16 To observe the effect of miR-378-5p-enriched breast milk exosomes on colon tissue structure in DSS colitis mice at 10x and 20x magnification;

[0037] Fig.17 The effect of miR-378-5p-enriched breast milk exosomes on the mRNA levels of IL-2, IL-1β, IL-6, TNF-α, and IL-10 in the colon of DSS colitis mice;

[0038] Fig.18 Effects of miR-378-5p-enriched breast milk exosomes on the mRNA levels of ZO-1 and Occludin in the colon of DSS colitis mice;

[0039] Fig.19 To observe the effects of miR-378-5p-enriched breast milk exosomes on the expression levels of ZO-1 and Occludin in colon tissues of DSS colitis mice at 10x and 20x magnifications;

[0040] Fig. 20 The effect of breast milk exosomes enriched with miR-378-5p on the intestinal flora composition of DSS colitis mice;

[0041] In the figure above: "*", "**", and "***" all indicate significant differences compared with the M group, *P<0.05, **P<0.01, ***P<0.001; among them, NC group: normal group; M group: colitis model group; BME group: breast milk exosomes group enriched with miR-378-5p (6 mg / kg·BW). DETAILED DESCRIPTION

[0042] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0043] Unless otherwise defined, technical or scientific terms used in the present invention shall have the common meanings understood by one having ordinary skills in the field to which the present invention belongs.

[0044] Technologies, methods, and equipment known to ordinary technicians in the relevant field may not be discussed in detail, but where appropriate, the technologies, methods, and equipment should be considered as part of the specification.

[0045] It should also be understood that the specific embodiments described above are only used to explain the present invention, and the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and inventive concepts of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0046] It should be noted that the mice involved in the following embodiments are 4-6 week old male SPF (Specific pathogen free) grade C57BL / 6 mice, purchased from Shaanxi Normal University and raised in the ultra-clean breeding unit of the Experimental Animal Center of Shaanxi Normal University.

[0047] It should be noted that the dextran sulfate sodium (DSS) involved in the following examples was purchased from MP Biomedical; the fecal occult blood qualitative detection kit was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; the TRIzol involved in the following examples was purchased from Beijing Qingke Biotechnology Co., Ltd.; the 4% paraformaldehyde fixative involved in the following examples was purchased from Xinsaimei Biotechnology Co., Ltd.; the PBS buffer involved in the following examples was purchased from Wuhan Sewell Biotechnology Co., Ltd.; the lithium chloride involved in the following examples was purchased from Shanghai Biyuntian Biotechnology Co., Ltd.

[0048] It should be noted that the detection methods involved in the following embodiments are as follows:

[0049] 1. Determination of spleen, cecum and colon indicators

[0050] The cecum and colon of mice just killed were collected, placed on filter paper, and the length was measured and photographed for record.

[0051] Cecum index = cecum weight (g) / body weight (g)

[0052] Spleen index = spleen weight (g) / body weight (g).

[0053] 2. Disease activity index (DAI) detection method

[0054] DAI is evaluated by the clinical symptoms of mice (weight loss rate, stool morphology and fecal occult blood) (the specific scoring criteria are shown in Table 1). During the modeling period, the weight of mice was measured every day, and the blood in the stool and the stool morphology of mice were tested. The scores were given according to Table 1. DAI is the sum of the three scores, that is, DAI = weight loss score + stool morphology score + fecal occult blood score. The fecal occult blood was determined using a fecal occult blood qualitative detection kit. The specific operation was carried out according to the instructions of the kit. If reddish-brown or bright red blood can be seen in the stool, it is bloody stool. The stool morphology is divided into five levels: normal, soft stool, loose stool, mucous stool, thin liquid stool and diarrhea.

[0055] Table 1 Disease activity index scoring criteria

[0056] score 0 1 2 3 4 Weight loss (%) none 1-5 6-10 11-20 ≥20 Stool form normal Soft stools Mucoid stool Thin liquid stool diarrhea Fecal occult blood Negative Light blue blue Dark Blue Naked bloody stool

[0057] 3. Preparation of colon tissue pathological sections and hematoxylin-eosin staining

[0058] Fresh colon tissue was collected, cut longitudinally along the long axis, fixed with 4% formalin to maintain the original cell morphology and structure, and then dehydrated with alcohol as a dehydrating agent to remove the water in the tissue block. The tissue was then placed in a transparent agent xylene for transparency, and then the tissue was immersed in wax and embedded, fixed on a slicer, cut into 3-4 micron thick slices, and stained with hematoxylin and eosin (H&E) after paraffin sectioning. The prepared slice samples were observed and pathologically analyzed under the bright field of an Axio Imger Upright Microscope (ZEISS, AxioImger M2) upright fluorescence microscope, and the corresponding area was photographed.

[0059] 4. RNA extraction and real-time fluorescence quantitative PCR

[0060] Colon or fecal samples (50 mg) were extracted using TRIzol reagent (Beijing Qingke Biotechnology Co., Ltd., China), and the concentration and purity of RNA were assessed by spectrophotometry at 260 nm / 280 nm. Total RNA (2 μg) was reverse transcribed into cDNA using MightyScript First-Strand cDNA Synthesis Master Mix Kit (Sangon Biotech). For tissue samples in the DSS model group, the isolated RNA was purified using lithium chloride (LiCl). Subsequently, 0.1 volume of 3 M sodium acetate (Beyotime) and 2 volumes of ethanol were added to 1 volume of RNA solution to reprecipitate RNA in the absence of DSS. Real-time fluorescence quantitative PCR (RT-PCR) detection was performed on a Roche LightCycler 480II (Indianapolis, IN, USA), and RT-PCR was performed according to the manufacturer's protocol.

[0061] Example 1

[0062] The purpose of this example is to use artificially synthesized miR-378a-5p to investigate its effect on alleviating the symptoms of DSS-induced colitis in mice.

[0063] In this embodiment, the sequence of the artificially synthesized miR-378a-5p is: CUCCUGACUCCAGGUCCUGUGU.

[0064] 1. Grouping

[0065] (1) Twenty healthy male C57BL / 6 mice aged 4-6 weeks were randomly divided into normal control group (NC), colitis model group (M), miR-378a-5p group and miR-378a-5p Scramble group after one week of adaptive feeding. The NC group had normal drinking water, while the M group, miR-378a-5p group and miR-378a-5p Scramble group were first treated with 2% DSS drinking water for 4 days and then with normal water for 7 days, which was repeated 4 times. Starting from 16 days before the end of the experiment, the miR-378a-5p group and the miR-378a-5p Scramble group (negative control) were injected with 5 nmol miR-378a-5p or miR-378a-5p Scramble through the tail vein every two days, and the other groups were injected with normal saline. The animal experimental scheme for grouping and miR-378-5p or miR-378a-5p Scramble intervention is as follows Figure 1 shown.

[0066] (2) During the experiment, body weight and food intake were recorded at the end of each intervention period and recovery period and within 16 days before the end of the experiment. Feces of mice were collected and fecal occult blood test and 16S bacterial flora qPCR verification were performed. After the end of the experiment, mice were fasted (but not water) for 12 hours and then euthanized. Tissues, serum and intestinal contents were collected, quickly frozen and stored at -80°C for testing.

[0067] 2. Results Analysis

[0068] Depend on Figure 2 It can be seen that the weight of mice changed significantly during the modeling period. Compared with the model group, the weight of mice recovered after miR-378a-5p intervention.

[0069] like Figure 3 As shown, compared with the model group, the mice in the miR-378a-5p group reversed the DSS-induced shortening of colon length and improved the stool morphology and blood in stool of the mice.

[0070] Depend on Figure 4 and Figure 5 It can be seen that compared with the model group, the disease activity index (DAI), spleen and cecum index of mice were significantly reduced after miR-378a-5p intervention.

[0071] HE staining results showed that the colon mucosal tissue of the normal group mice was intact, the epithelium was neat, the crypt structure was intact, and there were abundant goblet cells. The colon mucosa of the model group mice was ruptured, the crypts and goblet cells disappeared, and there was inflammatory cell infiltration, indicating that the model was successful. The crypt structure of the miR-378a-5p intervention group mice was significantly improved, but there was no significant change in the miR-378a-5pScramble group (eg Figure 6 ).

[0072] The mRNA expression levels of IL-2, IL-1β, IL-6, TNF-α, and IL-10 in the mouse colon were quantitatively analyzed by qPCR technology. Figure 7 shown.

[0073] See also Figure 7 Compared with the model group, the expression levels of IL-2, IL-1β, IL-6, TNF-α and IL-10 in the mice treated with miR-378a-5p were significantly decreased.

[0074] The ZO-1 and Occludin levels in the mouse colon were measured by qPCR. Figure 8 shown.

[0075] See also Figure 8Compared with the model group, miR-378a-5p significantly reversed the DSS-induced downregulation of ZO-1 and Occludin expression, and immunofluorescence results further confirmed this finding ( Fig. 9 ).

[0076] See also Fig.10 Compared with the model group, miR-378a-5p significantly improved the intestinal flora composition of DSS-disturbed mice.

[0077] In summary, the artificially synthesized miR-378a-5p can significantly reverse the weight loss and shortened colon length of colitis mice, reduce the disease activity index (DAI), spleen and cecum index of colitis mice, improve the disease symptoms such as diarrhea and bloody stools in colitis mice, reverse the damage of DSS to the colon tissue of mice, reduce the level of colon inflammatory factors, and increase the content of tight junction-related proteins such as ZO-1 and Occludin in the colon, thereby alleviating intestinal inflammatory response and having a protective effect on intestinal health.

[0078] Example 2

[0079] The purpose of this example is to find materials rich in miR-378a-5p from natural substances, and then use them to alleviate the symptoms of DSS-induced colitis in mice.

[0080] Preferably, taking breast milk in nature as an example, obtaining breast milk exosomes rich in miR-378a-5p specifically includes the following steps:

[0081] S1. Take breast milk and centrifuge it at 3000g for 15 minutes to remove insoluble impurities in the breast milk; collect the supernatant, and then centrifuge it at 12000g for 60 minutes to further obtain a clarified sample.

[0082] S2. Continue to perform a second centrifugation at 35000g for 60 min to ensure thorough removal of impurities, and collect the supernatant at each step. Repeat this second centrifugation process three times to remove impurities, and collect the supernatant through a 0.22 μm filter membrane.

[0083] S3. The filtered supernatant was centrifuged at 120,000 g for 60 min to remove large vesicles. The supernatant was collected again and centrifuged for a second time at the same speed for 60 min.

[0084] S4. Collect the resulting precipitate and resuspend it in 1 mL of cold phosphate buffer to obtain exosomes containing miR-378a-5p.

[0085] All the above centrifugation steps were performed at 4°C.

[0086] Finally, the BCA method was used to quantify the exosomes containing miR-378a-5p, and the concentration was about 1.2 mg / mL. miR-378a-5p was highly abundantly expressed in breast milk exosomes. And it was stored in a -80℃ refrigerator for future use.

[0087] The above-mentioned breast milk exosomes enriched with miR-378a-5p were further taken for performance testing.

[0088] 1. Grouping

[0089] (1) Thirty healthy male C57BL / 6 mice aged 4-6 weeks were randomly divided into a normal control group (NC) of 5 mice, a colitis model group (M) of 5 mice, and a breast milk exosome group enriched with miR-378-5p (BME group, 6 mg / kg·BW) of 5 mice after one week of adaptive feeding. All mice were given free access to water and standard food.

[0090] (2) Preventive treatment for 10 days before modeling: NC and M groups were gavaged with normal saline, and the treatment group was gavaged with the corresponding dose of breast milk exosomes. After that, except for the NC group, all groups drank drinking water containing 2% DSS for 4 consecutive days, followed by drinking ordinary water without DSS for 7 days. This cycle was repeated four times, during which the treatment group continued to receive the corresponding dose of breast milk exosomes; the animal experimental scheme for grouping and breast milk exosome intervention treatment is as follows Fig.11 shown.

[0091] 2. Results Analysis

[0092] Depend on Fig.12 It can be seen that compared with the model group, breast milk exosomes significantly inhibited DSS-induced weight loss in mice. Fig.13 As shown, breast milk exosomes can significantly improve DSS-induced shortening of colon length and bloody stools in mice.

[0093] Depend on Fig.14 and Fig.15 It can be seen that compared with the model group, breast milk exosomes can significantly reduce the disease activity index (DAI), spleen and cecum index of colitis mice.

[0094] HE staining results showed that the colon mucosal tissue of the normal group mice was intact, the epithelium was neat, the crypt structure was intact, and there were abundant goblet cells. The colon mucosa of the model group mice was ruptured, the crypts and goblet cells disappeared, and there was inflammatory cell infiltration, indicating that the model was successful. Breast milk exosomes had a significant improvement effect on the colon crypt structure of DSS-induced colitis mice (such as Fig.16 ).

[0095] The mRNA expression levels of IL-1β, IL-2, IL-4, IL-6, IL-10, and TNF-α in the mouse colon were quantitatively analyzed by qPCR technology. Fig.17 shown.

[0096] See also Fig.17 , breast milk exosomes reversed the DSS-induced increase in the expression levels of IL-1β, IL-2, IL-4, IL-6, IL-10, and TNF-α in the mouse colon, indicating that breast milk exosomes can alleviate DSS-induced intestinal inflammatory response.

[0097] The qPCR technique was used to measure ZO-1 and Occludin in the mouse colon. Fig.18 shown.

[0098] from Fig.18 The results showed that breast milk exosomes significantly reversed the DSS-induced downregulation of ZO-1 and Occludin expression ( Fig.18 ); immunofluorescence results further confirmed this finding ( Fig.19 ). This indicates that breast milk exosomes have a certain repair effect on the damage to the intestinal barrier.

[0099] See also Fig. 20 Compared with the model group, breast milk exosomes enriched with miR-378-5p significantly alleviated the DSS-induced intestinal flora disorder in mice.

[0100] In this embodiment, breast milk exosomes rich in miR-378-5p can significantly reverse the weight loss and shortened colon length of colitis mice, reduce the disease activity index (DAI), spleen and cecum index of colitis mice, improve the disease symptoms such as diarrhea and blood in the stool of colitis mice, reverse the damage of DSS to the colon tissue of mice, reduce colon inflammatory factors and increase the content of tight junction-related proteins such as ZO-1 and Occludin in the colon, thereby alleviating intestinal inflammatory response and having a protective effect on intestinal health. In addition, experiments have found that miR-378a-5p enriched in other natural substances such as goat milk can play a good role in protecting intestinal health.

[0101] In summary, the present invention has found through research that miR-378a-5p can improve disease symptoms such as diarrhea and bloody stools in mice with colitis, reverse the damage of DSS to the colon tissue of mice, and has a significant effect on alleviating colitis. It can be used as a substance for intestinal health protection and can be used to prepare intestinal health protection products such as food, medicine or health care products.

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the present invention, although the present invention has been described in detail with reference to the preferred embodiments. It should be understood by those skilled in the art that the technical solutions of the present invention can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. An application of miR-378a-5p in the preparation of intestinal health protection products.

2. An application of miR-378a-5p in the preparation of intestinal health protection products by reversing weight loss and shortened colon length in colitis mice.

3. An application of miR-378a-5p in the preparation of intestinal health protection products by reducing the disease activity index, spleen and cecum index of colitis mice.

4. An application of miR-378a-5p in the preparation of intestinal health protection products by improving the symptoms of diarrhea and bloody stools in colitis mice and reversing the damage of DSS to mouse colon tissue.

5. An application of miR-378a-5p in the preparation of intestinal health protection products by improving the crypt structure of mouse colon.

6. An application of miR-378a-5p in the preparation of intestinal health protection products by reducing colon inflammatory factors and increasing the content of ZO-1 and Occludin in the colon.

7. The use according to claim 6, characterized in that: Colonic inflammatory factors include IL-2, IL-1β, IL-4, IL-6, TNF-α and / or IL-10.

8. The use according to any one of claims 1 to 6, characterized in that: Intestinal health protection products include food, medicine or health products.

Images