Flow cell, sequencing kit and gene sequencing method

Abstract

The invention discloses a flow cell, a sequencing kit and a gene sequencing method. The flow cell comprises a substrate, the electrode is positioned on the substrate; the electrode has a functionalized surface, and the functionalized surface comprises a trithio adamantane derivative joint; the primer is connected with the trithio adamantane derivative in a click chemical reaction manner, and then is anchored on the functionalized surface of the electrode. Compared with a fluorescence labeled nucleotide with light excitation luminescence, when a newly generated strand complementary to a template strand is introduced into the electrochemical luminescence labeled nucleotide, a light signal can be generated only by giving a certain potential to an electrode, an excitation light source is not needed, an optical system can be simplified, noise caused by the excitation source can be eliminated, and the electrochemical luminescence labeled nucleotide can be applied to the electrochemical luminescence labeled nucleotide. And the signal-to-noise ratio is increased, so that the sequencing accuracy can be improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a flow cell, a sequencing kit and a gene sequencing method. Background Art

[0002] Nucleic acid, one of the four major types of molecules in life, is the blueprint of species inheritance-variation and the basis of precision medicine. Massively parallel sequencing technology (NGS) can determine the sequences of unknown genes, genomes, and metagenomes. It is a key core technology and effective means for life sciences, medical sciences, clinical medicine, disease control, etc. It is currently mainly monopolized by Illumina and BGI. Its key core technology is to fix one end of single-stranded deoxyribonucleic acid (ssDNA) on the wall of an optical microfluidic chip, and form a molecular cluster (thousands of identical primers) through bridge polymerase chain reaction (PCR) technology and fix it on the plane inside the optical microfluidic pool. The cluster of molecules is a pixel point during fluorescence imaging, and a chip can have at least 4G pixels. The sequencing process is sequencing while synthesizing, allowing fluorescently labeled and chemically protected deoxyribonucleotide triphosphates (dNTPs), DNA polymerase and other reactants to be added to the optical microfluidic pool to react with primers. The triphosphate nucleotides with fluorescent groups used here are chemically protected, so only one can be extended at a time. After the single-base extension reaction is completed, the entire optical microfluidic pool is washed and then the optical microfluidic pool is imaged fluorescently. Because the extended single base is paired with the base on the primer, and the four nucleotides are labeled with four fluorescent wavelengths, the color of each pixel can be obtained by fluorescence imaging, and the base information (A, T, G, or C) can be obtained from the color. Then, through chemical deprotection, the above-mentioned single-base extension, elution, imaging, and deprotection processes are repeated. Usually, after a certain number of repetitions (usually about 150 times), the nucleic acid sequence of each pixel fixed on the optical chip can be read. Usually, there are several mega pixels on the entire microfluidic optical chip, so this method is called massively parallel sequencing.

[0003] The pain point of the fluorescence technology of Illumina or BGI's NGS is that the signal-to-noise ratio cannot ensure the quality of sequencing after the sequencing length reaches 150 bases. If the electrochemiluminescence (ECL) technology, which has a higher sensitivity than fluorescence, is applied to NGS, it will effectively improve the quality and length of sequencing. The fluorescence technology of Illumina and BGI is easier to implement and was adopted first. However, because fluorescence has a certain excitation scattering background, it is not easy to achieve ultra-high sensitivity imaging. Electrochemiluminescence has a dark background, no interference from the excitation light source, and a high signal-to-noise ratio. This is like observing stars at night and observing stars during the day. Secondly, electrochemiluminescence can be measured many more times than fluorescence, so the linear dynamic range is wide.

[0004] At present, mainstream high-throughput sequencing equipment basically uses fluorescent labeling to detect sequencing base signals. The pain point of fluorescent technology of Illumina or BGI's NGS is that the signal-to-noise ratio cannot ensure the quality of sequencing after the sequencing length reaches 150 bases. Since the fluorescent labeling method requires excitation light for excitation, it will increase the complexity and volume of the equipment. In addition, since fluorescent light has a certain excitation scattering background, it is not easy to achieve ultra-high sensitivity imaging, which will affect the detection sensitivity.

[0005] In contrast, electrochemiluminescence sequencing technology generates fluorescent signals through an electrochemical process and does not require an excitation light source. This not only simplifies the optical system, but also eliminates the noise caused by the excitation source, increases the signal-to-noise ratio, and thus improves sequencing accuracy. In addition, taking the commonly used electrochemiluminescence system as an example, a certain voltage is applied to the working electrode (anode), and the divalent terpyridine ruthenium ([Ru(bpy)3] 2+ ) is oxidized to trivalent terpyridine ruthenium ([Ru(bpy)3] 3+ ), at the same time, the tripropylamine in the solution is also oxidized to generate cationic free radical TPA + ·, and quickly reacts with tripropylamine to remove a proton to form dipropyl propylene amine free radical TPA·. When the strongly oxidizing [Ru(bpy)3] 3+ When the single electron transfer redox reaction with the strongly reducing dipropylamine free radical TPA· occurs, the excited state [Ru(bpy)3] 2+ After the above chemiluminescence process, the reaction system still contains divalent terpyridine ruthenium [Ru(bpy)3] 2+ With tripropylamine (TPA), the electrochemical reaction and chemiluminescence process on the electrode surface can continue, so that the entire reaction process can be cyclic. Through the above-mentioned cyclic process, the measurement signal is continuously amplified, thereby greatly improving the detection sensitivity, so ECL measurement has the characteristics of high sensitivity and high dynamic range.

[0006] However, there are few related applications of electrochemiluminescence technology in the field of gene sequencing in the prior art. The challenge of electrochemiluminescence is how to fix one end of single-stranded deoxyribonucleic acid (ssDNA) to the electrode surface so that electrochemiluminescence can be performed when a single base is extended. Based on this, this application requests protection for a high-throughput sequencing technology based on electrochemiluminescence, specifically a flow cell, a sequencing kit and a gene sequencing method. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a flow cell, a sequencing kit and a gene sequencing method in view of the deficiencies in the above-mentioned prior art.

[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is: In a first aspect of the present invention, a flow cell is provided, comprising:

[0009] substrate;

[0010] an electrode positioned on the substrate;

[0011] The electrode has a functionalized surface, and the functionalized surface includes a trithioadamantane derivative linker;

[0012] and a primer, wherein the primer is connected to a trithioadamantane derivative by a click chemistry reaction and then anchored on the functionalized surface of the electrode.

[0013] Preferably, the electrode is a gold electrode.

[0014] Preferably, the substrate is transparent.

[0015] Preferably, the trithioadamantane derivative contains an alkynyl group in its structure, and the primer terminal contains an azide group.

[0016] Preferably, the structure of the trithioadamantane derivative is shown in 9a below:

[0017]

[0018] Preferably, 1) synthesize 2,2-bis(1,3-dioxolane-2-methyl)-dimethyl malonate, the structural formula of which is shown in 2a, and the synthetic route is as follows:

[0019]

[0020] The specific steps are:

[0021] At room temperature, under nitrogen protection and stirring conditions, potassium tert-butoxide is dissolved in dimethyl sulfoxide, and then dimethyl malonate with the structural formula 1a is added, and finally the mixture is stirred at room temperature and under nitrogen protection conditions; at room temperature, 2-(bromomethyl)-1,3-dioxolane is added to the obtained solution, and the solution is heated and stirred under nitrogen protection conditions for reaction, and after the reaction is completed, the solution is cooled and diluted; the obtained mixture is extracted with ethyl acetate, and the organic layer obtained by the extraction is washed, dried, filtered, and the filtrate is concentrated under reduced pressure; the obtained concentrated solution is purified to obtain 2,2-bis(1,3-dioxolane-2-methyl)-dimethyl malonate;

[0022] 2) Synthesis of 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester, the structural formula of which is shown in 3a, and the synthetic route is as follows:

[0023]

[0024] The specific steps are:

[0025] Dissolve 2,2-bis(1,3-dioxolane-2-methyl)-malonic acid dimethyl ester in N,N-dimethylformamide at room temperature and under stirring conditions, add sodium bromide at room temperature and under nitrogen protection and stirring conditions, and react under heating, nitrogen protection and stirring conditions; after the reaction, cool and dilute the obtained mixed solution, extract it with ethyl acetate, wash, dry and filter the obtained organic layer, reduce pressure and concentrate the filtrate, and purify the concentrated solution to obtain 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester;

[0026] 3) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester, the structural formula of which is shown in 4a, and the synthetic route is as follows:

[0027]

[0028] The specific steps are:

[0029] Dissolve 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester in tetrahydrofuran at room temperature with stirring, add a tetrahydrofuran solution of lithium diisopropylamide dropwise at -45°C under nitrogen protection and stirring, continue stirring for reaction and then naturally warm to room temperature; add NH4Cl solution to the mixture at room temperature to quench the reaction, cool and dilute the obtained mixed solution, extract with ethyl acetate, wash, dry and filter the obtained organic layer, reduce pressure and concentrate the filtrate, purify the obtained concentrated solution to obtain 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester;

[0030] 4) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester, the structural formula of which is shown in 5a, and the synthetic route is as follows:

[0031]

[0032] The specific steps are:

[0033] Under room temperature and stirring conditions, 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester is dissolved in a mixed solution of dioxane and deionized water, and then NaIO4 is added and dissolved, and finally OsO4 is added and dissolved at 0°C under nitrogen protection and stirring conditions, and after the dissolution is completed, the reaction is continued to be stirred at room temperature; after the reaction is completed, the obtained mixed solution is diluted and extracted with ethyl acetate, the organic layer obtained by extraction is washed, dried, filtered, and the filtrate is concentrated under reduced pressure, and the obtained concentrated solution is purified to obtain 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester;

[0034] 5) Synthesis of 2,2-di(2-oxoethyl)-4-aldehyde-butyric acid methyl ester, the structural formula of which is shown in 6a, and the synthesis route is as follows:

[0035]

[0036] The specific steps are:

[0037] Under room temperature and stirring conditions, 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester is added to a mixed solution of HCl and tetrahydrofuran, and stirring is continued; after the stirring is completed, it is neutralized with a saturated NaHCO3 solution to a pH of 7; the obtained mixed solution is extracted with ethyl acetate, and the extracted organic layer is washed, dried, filtered, reduced pressure, and concentrated to obtain 2,2-bis(2-oxoethyl)-4-aldehyde-butyric acid methyl ester;

[0038] 6) Synthesis of methyl 2,4,9-trithioadamantane-7-carboxylate, the structural formula of which is shown in 7a, and the synthesis route is as follows:

[0039]

[0040] The specific steps are:

[0041] Under room temperature and stirring conditions, 2,2-di(2-oxoethyl)-4-aldehyde-butyric acid methyl ester and aluminum oxide are added to acetonitrile, and then P2S5 is added. After heating, the mixture is stirred and reacted under nitrogen protection. After the reaction is completed, the mixture is cooled to room temperature and filtered. The obtained filter cake is washed with ethyl acetate. The obtained filtrate is decompressed, concentrated, and purified to obtain 2,4,9-trithioadamantane-7-carboxylic acid methyl ester.

[0042] 7) Synthesize 2,4,9-trithioadamantane-7-carboxylic acid, the structural formula of which is shown in 8a, and the synthetic route is as follows:

[0043]

[0044] The specific steps are:

[0045] Under room temperature and stirring conditions, methyl 2,4,9-trithioadamantane-7-carboxylate is added to a mixed solution of MeOH, deionized water and tetrahydrofuran, and then sodium hydroxide is added and stirred continuously. After the stirring is completed, the mixture is concentrated in vacuo, and then diluted. The diluted product is acidified to pH 3 with HCl at 0° C., and the obtained solid is filtered and collected, washed and dried to obtain 2,4,9-trithioadamantane-7-carboxylic acid;

[0046] 8) Synthesize 2,4,9-trithioadamantane-7-carboxyl-dibenzocyclooctynamide, the structural formula of which is shown in 9a, and the synthetic route is as follows:

[0047]

[0048] The specific steps are:

[0049] At room temperature, under nitrogen protection and stirring conditions, 2,4,9-trithioadamantane-7-carboxylic acid and N,N-diisopropylethylamine are dissolved in N,N-dimethylformamide, and then 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate is added and stirred continuously. At room temperature and under stirring conditions, dibenzocyclooctynamine is added to the obtained mixture, and the mixture is stirred continuously for reaction. After the reaction is completed, the obtained mixed solution is diluted, and then extracted with ethyl acetate. The organic layer obtained by the extraction is washed, dried, filtered, and the filtrate is concentrated under reduced pressure. The obtained concentrated solution is purified to obtain 2,4,9-trithioadamantane-7-carboxyl-dibenzocyclooctynamide, i.e., the trithioadamantane derivative.

[0050] Preferably, the method of anchoring the primer on the functionalized surface of the gold electrode comprises the following steps:

[0051] A primer containing an azide terminal group and a trithioadamantane derivative containing an alkynyl group are subjected to a click chemistry reaction, wherein the alkynyl group reacts with the azide group to obtain a primer containing three sulfurs at the terminal group; then, the primer containing three sulfurs at the terminal group is reacted with a gold electrode, thereby anchoring the primer on the functionalized surface of the gold electrode.

[0052] Preferably, the method of anchoring the primer on the functionalized surface of the gold electrode comprises the following steps:

[0053] S1-1, dissolving 0.102 mg of a trithioadamantane derivative containing an alkynyl group in 5 ml of a mixed solution consisting of water and DMF in a volume ratio of 1:1 to obtain a solution 1;

[0054] S1-2, 0.66 mg of the primer containing an azide terminal group and 0.132 (200 nmol) of polyethylene glycol containing an azide terminal group were dissolved in 5 ml of a mixed solution composed of water and DMF in a volume ratio of 1:1 to obtain solution 2;

[0055] S1-3, mixing solution 1 and solution 2, and reacting them at room temperature under stirring for 4 hours to obtain solution 3;

[0056] S1-4. After the gold electrode is cleaned and dried, solution 3 is injected into the flow cell from the injection port to fill the flow cell, and the flow cell is left to stand for 12 hours at room temperature in a dark environment, so as to anchor the primer on the functionalized surface of the gold electrode.

[0057] Preferably, the method of anchoring the primer on the functionalized surface of the gold electrode comprises the following steps:

[0058] A trithioadamantane derivative containing an alkynyl group is anchored on the surface of a gold electrode to form a functionalized surface, and then a primer containing an azide end group is added to allow the primer to undergo a click chemical reaction with the alkynyl group in the functionalized surface and be anchored to the functionalized surface of the gold electrode.

[0059] Preferably, the method of anchoring the primer on the functionalized surface of the gold electrode comprises the following steps:

[0060] S2-1, dissolving 0.102 mg of a trithioadamantane derivative containing an alkynyl group in 5 ml of a mixed solution consisting of water and DMF in a volume ratio of 1:1 to obtain a solution 4;

[0061] S2-2, after cleaning and drying the gold electrode, inject solution 4 into the flow cell from the injection port to fill the flow cell, and leave it at room temperature in a dark environment for 12 hours to form a functionalized surface on the gold electrode;

[0062] S2-3, 0.66 mg of the primer containing an azide terminal group and 0.132 (200 nmol) of polyethylene glycol containing an azide terminal group were dissolved in 5 ml of a mixed solution composed of water and DMF in a volume ratio of 1:1 to obtain solution 5;

[0063] S2-4, inject solution 5 from the injection port of the flow cell to fill it, and leave it to stand for 4 hours at room temperature in a dark environment. Repeat the operation 3 times to anchor the primer on the functionalized surface of the gold electrode.

[0064] In a second aspect of the present invention, a sequencing kit is provided, comprising: a flow cell as described above; and labeled nucleotides to be introduced into the flow cell, each labeled nucleotide comprising:

[0065] Nucleotides with 3'OH blocking groups;

[0066] a linker molecule attached to the base or sugar of the nucleotide;

[0067] and an electrochemiluminescent label attached to the linker molecule.

[0068] Preferably, the labeled nucleotides include at least three different labeled nucleotides, and wherein the corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinguishable detectable signal, and the detectable signal is an emission spectrum, an excitation potential, an electrochemiluminescent emission lifetime or an electrochemiluminescent emission intensity.

[0069] Preferably, the labeled nucleotides include at least three different labeled nucleotides, and wherein the corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct emission spectrum.

[0070] Preferably, the labeled nucleotides include at least three different labeled nucleotides, and wherein the corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct oxidation potential or reduction potential.

[0071] Preferably, the labeled nucleotides include at least three different labeled nucleotides, and wherein the corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct electrochemiluminescent emission lifetime.

[0072] Preferably, the labeled nucleotides include at least three different labeled nucleotides, and wherein the corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct electrochemiluminescent emission intensity.

[0073] Preferably, the labeled nucleotide comprises the following structure:

[0074]

[0075] R1 is one of a monophosphate group and a polyphosphate group;

[0076] R2 is a 3'OH blocking group, which is -CH2N3, -NH2, -CH=CHCH2, o-nitrobenzyl ether, o-nitrobenzyl alkyl carbonate, tert-butoxyethoxy, -CH2OCH3, 2,4-dinitrophenoxysulfenyl, tetrahydrofuran ether, 3' phosphate, ether, -F, -H2, -OCH3, -N3, -HCOCH3 or 2-nitrobenzene carbonate;

[0077] R3 is hydrogen or hydroxyl;

[0078] Bases include adenine, guanine, cytosine, thymine, uracil, hypoxanthine or their analogs;

[0079] The electrochemiluminescent label is an anodic electrochemiluminescent label or a cathodic electrochemiluminescent label.

[0080] Preferably, the electrochemiluminescent marker in the labeled nucleotide structure is selected from tris(2,2'-bipyridine)ruthenium(II) (Ru(bpy)3 2+ ), tris(2-phenylpyridine)iridium(III) (Ir(ppy)3 3+ ), tris(2,2'-bipyridyl)osmium(II) (Os(bpy)3 2+ ), at least one of 2-thianthrenecarboxylic acid and sodium 9,10-diphenylanthracene-2-sulfonate (DPAS).

[0081] Preferably, the labeled nucleotide structure R1 is a triphosphate group, and R2 is -CH2N3; the labeled nucleotide structure is as follows:

[0082]

[0083] A third aspect of the present invention provides a gene sequencing method, comprising:

[0084] (1) attaching the template polynucleotide chain to the electrodes of the flow cell as described above;

[0085] (2) introducing a fluid comprising a polymerase and nucleotides into a flow cell, at least some of the nucleotides being labeled nucleotides, each of at least some of the labeled nucleotides being a nucleotide as described above;

[0086] One of the nucleotides is incorporated into a nascent strand that is complementary to the template polynucleotide strand;

[0087] applying an electric potential to the electrodes;

[0088] and detecting optical emission in response to the applied potential.

[0089] Preferably, one of the incorporated ones of the nucleotides is one of the labeled nucleotides, and wherein the application of the potential initiates a redox reaction pathway involving an electrochemiluminescent label of the incorporated one of the labeled nucleotides.

[0090] Preferably, there are four flow cells, each of which introduces a fluid containing a polymerase and nucleotides, and the fluid introduced into each flow cell contains a labeled nucleotide of a different base type, one of the nucleotides is incorporated into a nascent chain complementary to the template polynucleotide chain; an electric potential is applied to the electrode; and optical emission in response to the applied electric potential is detected.

[0091] Preferably, there are two flow cells, each of which introduces a fluid containing a polymerase and nucleotides, and the fluid introduced into each flow cell respectively contains two different base types of the labeled nucleotides, one of which is incorporated into a nascent chain complementary to the template polynucleotide chain; an electric potential is applied to the electrode; and optical emission in response to the applied electric potential is detected.

[0092] Preferably, wherein:

[0093] The fluid includes at least three different labeled nucleotides;

[0094] The corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct emission spectrum;

[0095] And the method further comprises identifying the incorporated one of the labeled nucleotides from optical emission of the incorporated one of the labeled nucleotides.

[0096] Preferably, wherein:

[0097] The fluid includes at least three different labeled nucleotides;

[0098] The corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct oxidation potential or reduction potential;

[0099] And the method further comprises identifying the incorporated one of the labeled nucleotides from the applied potential.

[0100] Preferably, the method further comprises introducing a co-reactant into the flow cell prior to applying the potential.

[0101] Preferably, wherein the linking molecule and the electrochemiluminescent label of the incorporated one of the labeled nucleotides are attached during incorporation, potential application and optical detection, and wherein after the optical detection, the method further comprises:

[0102] The linking molecule and the electrochemiluminescent marker are cleaved from the one of the labeled nucleotides incorporated therein by introducing a deblocking agent or applying an electric potential, and the 3'OH blocking group is removed from the one of the labeled nucleotides incorporated therein, thereby enabling another nucleotide or another labeled nucleotide to be incorporated into the nascent chain.

[0103] Preferably, wherein:

[0104] a photodiode detecting the optical emission;

[0105] And the method also includes detecting an electrical signal corresponding to the optical emission.

[0106] Preferably, wherein:

[0107] The optical emission is detected using a camera, for example, using a CCD, CMOS or EMCCD.

[0108] The beneficial effects of the present invention are:

[0109] (1) The present invention provides a gene sequencing flow cell, a kit and a gene sequencing method based on electrochemiluminescence. Compared with fluorescent labeled nucleotides that emit light by light excitation, when the electrochemiluminescent labeled nucleotides are introduced into a newly generated chain complementary to the template chain, a light signal can be generated by applying a certain potential to the electrode without the need for an excitation light source. This can not only simplify the optical system, but also eliminate the noise caused by the excitation source, thereby increasing the signal-to-noise ratio and improving the sequencing accuracy.

[0110] (2) The flow cell of the present invention uses trithioadamantane derivatives to modify its electrode surface. Compared with the commonly used functionalized electrode surface obtained by reacting thiol linkers or amine linkers with metals, which is easy to fall off under the conditions of large temperature changes, frequent cleaning times and complex chemical environment during sequencing, the number of sulfur atoms in a single molecule of trithioadamantane derivatives that interact with the electrode is large, the interaction force is greater, and the attachment stability is stronger; the rigid adamantane cage structure of the trithioadamantane derivative can form a dilution effect, which can reduce the spatial crowding and electrostatic repulsion between adjacent oligonucleotides, thereby making it easier for the target oligonucleotide to bind to the complementary chain; the cage structure of the trithioadamantane derivative is conducive to the extension of the oligonucleotide sequence away from the electrode surface, thereby reducing the nonspecific interaction between the base and the gold surface. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1 The chemical structures of several anodic ECL markers are shown: (a) Ru(bpy)3 2+ , (b) Ir(ppy)3 3 ,(c)Os(bpy)3 2+ Chemical structure of

[0112] Figure 2 Examples of types of ruthenium complexes that can be excited to emit light at different potentials are given;

[0113] Figure 3 It is a mass spectrum of an electrochemiluminescent labeled nucleotide structure;

[0114] Figure 4It is a hydrogen spectrum of an electrochemiluminescent labeled nucleotide structure;

[0115] Figure 5 A synthetic route for an electrochemiluminescent labeled nucleotide;

[0116] Figure 6 Schematic diagram of the flow cell structure containing electrodes;

[0117] Figure 7 Schematic diagram of the system structure of the electrochemiluminescence sequencing device. DETAILED DESCRIPTION

[0118] The present invention is further described in detail below in conjunction with embodiments so that those skilled in the art can implement the invention with reference to the description.

[0119] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0120] The test methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are all commercially available unless otherwise specified. In the following examples, if no specific conditions are specified, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0121] Example 1

[0122] A flow cell comprising:

[0123] substrate;

[0124] an electrode, the electrode being positioned on the substrate;

[0125] The electrode has a functionalized surface, and the functionalized surface includes a trithioadamantane derivative linker;

[0126] and a primer, wherein the primer is connected to a trithioadamantane derivative by a click chemistry reaction and then anchored on the functionalized surface of the electrode.

[0127] Preferably, the electrodes are gold electrodes.

[0128] Preferably, the substrate is transparent.

[0129] Preferably, the trithioadamantane derivative contains an alkynyl group in its structure and the primer terminal contains an azide group.

[0130] Preferably, the trithioadamantane derivative comprises the following structure:

[0131]

[0132] Preferably, the overall synthesis route of the trithioadamantane derivative is as follows:

[0133]

[0134] The preparation method of trithioadamantane derivative comprises the following steps:

[0135] 1) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-malonic acid dimethyl ester, the structural formula of which is shown in 2a, and the synthesis route is as follows:

[0136]

[0137] The specific steps are:

[0138] At room temperature, nitrogen protection, stirring conditions, potassium tert-butoxide (t-BuOK) (30.6g, 172.5mmol) was dissolved in 300mL of dimethyl sulfoxide (DMSO), and then 15g (113.5mmol) of dimethyl malonate (Compound 1a) was added thereto, and finally the mixture was stirred for 1h at room temperature and nitrogen protection conditions. At room temperature, 45.5g (272.5mmol) of 2-(bromomethyl)-1,3-dioxolane was added to the above solution, and the resulting mixture was stirred overnight at 80°C under nitrogen protection conditions, cooled to room temperature, and diluted with 600mL of water. The resulting mixture was extracted 3 times with 200mL of ethyl acetate (EtOAc), and the organic layer obtained by extraction was washed with 500mL of brine, dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The obtained concentrate was purified by silica gel column chromatography using PE / EA (5:1) as eluent to obtain 16 g of dimethyl 2,2-bis(1,3-dioxolane-2-methyl)-malonate (Compound 2a) (yield 44.00%) as a colorless oil.

[0139] 2) Synthesis of 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester, the structural formula of which is shown in 3a, and the synthetic route is as follows:

[0140]

[0141] The specific steps are:

[0142] At room temperature and under stirring conditions, 16 g (52.581 mmol) of 2,2-bis (1,3-dioxolane-2-methyl) -dimethyl malonate (Compound 2a) was dissolved in 160 mL of N,N-dimethylformamide (DMF), and then 10.82 g (105.162 mmol) of sodium bromide (NaBr) was added thereto at room temperature, under nitrogen protection, and under stirring conditions, and the temperature was 150 ° C, nitrogen protection, and stirring conditions overnight. The obtained mixed solution was cooled to room temperature, diluted with 500 mL of deionized water, and then extracted with 200 mL of ethyl acetate (EtOAc) for 3 times, and the organic layer obtained by extraction was washed 3 times with 300 mL of brine, dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The concentrate was purified by silica gel column chromatography using PE / EA (6:1) as eluent to obtain 8.2 g of 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester (Compound 3a) (yield 63.33%) as a light yellow oil.

[0143] 3) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester, the structural formula of which is shown in 4a, and the synthetic route is as follows:

[0144]

[0145] The specific steps are:

[0146] 8.2g (33.298mmol) of 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester (Compound 3a) was dissolved in 140mL of tetrahydrofuran (THF) at room temperature and under stirring conditions, and then 24.97mL (49.947mmol) of 2mol / L of lithium diisopropylamide (LDA) in tetrahydrofuran (THF) solution was added dropwise at -45°C under nitrogen protection and stirring conditions, and the mixture was stirred for 2h and then naturally warmed to room temperature. At room temperature, 100mL of NH4Cl solution was added to the mixture to quench the reaction. The mixed solution obtained above was cooled to room temperature, diluted with 500mL of water, and extracted with 200mL of ethyl acetate (EtOAc) three times, dried with anhydrous Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The obtained concentrate was purified by silica gel column chromatography using PE / EA (6:1) as eluent to obtain 7.1 g of methyl 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoate (Compound 4a) (yield 74.47%) as a light yellow oil.

[0147] 4) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester, the structural formula of which is shown in 5a, and the synthetic route is as follows:

[0148]

[0149] The specific steps are:

[0150] At room temperature and under stirring conditions, 7.1g (24.797mmol) of 2,2-bis (1,3-dioxolane-2-methyl) -4-ene-1-pentanoic acid methyl ester (compound 4a) was dissolved in a mixed solution of 150mL of dioxane and 30mL of water, and then 15.91g (74.391mmol) of NaIO4 was added and dissolved, and finally 0.63g (2.480mmol) of OsO4 was added and dissolved at 0°C, nitrogen protection, and stirring conditions. After the dissolution was completed, stirring was continued at room temperature for 12h. The above-obtained mixed solution was diluted with 500mL of water and extracted three times with 200mL of ethyl acetate (EtOAc). The organic layer obtained by extraction was washed with 100mL of brine, dried with anhydrous Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The resulting concentrate was purified by silica gel column chromatography using PE / EA (5:1) as eluent to obtain 3.8 g of 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester (Compound 5a) (yield 53.16%) as a colorless oil.

[0151] 5) Synthesis of 2,2-di(2-oxoethyl)-4-aldehyde-butyric acid methyl ester, the structural formula of which is shown in 6a, and the synthesis route is as follows:

[0152]

[0153] The specific steps are:

[0154] At room temperature and under stirring conditions, 3.8 g (13.181 mmol) of 2,2-bis (1,3-dioxolane-2-methyl) -4-aldehyde - butyric acid methyl ester (compound 5a) was added to a mixed solution of 38 mL HCl and 38 mL tetrahydrofuran (THF), and stirred overnight. After stirring, it was neutralized with a saturated solution of NaHCO3 to a pH of 7. The mixed solution obtained above was extracted 3 times with 50 mL of ethyl acetate (EtOAc). The organic layer obtained by extraction was washed with 30 mL of brine, dried over anhydrous Na2SO4, filtered, decompressed, and concentrated. 1.8 g of 2,2-bis (2-oxoethyl) -4-aldehyde - butyric acid methyl ester (compound 6a) (yield 68.22%) was obtained as an off-white solid.

[0155] 6) Synthesis of methyl 2,4,9-trithioadamantane-7-carboxylate, the structural formula of which is shown in 7a, and the synthesis route is as follows:

[0156]

[0157] The specific steps are:

[0158] At room temperature and under stirring conditions, 1.8 g (8.991 mmol) of 2,2-di(2-oxoethyl)-4-aldehyde-butyric acid methyl ester (Compound 6a) and 9.17 g (89.910 mmol) of aluminum oxide were added to 40 mL of acetonitrile (ACN), and then 2.19 g (9.8901 mmol) of P2S5 was added thereto, and the mixture was stirred overnight under nitrogen protection after heating to 85 ° C. The resulting mixture was cooled to room temperature and filtered. The filter cake was washed three times with 30 mL of ethyl acetate. The filtrate was reduced pressure and concentrated. The concentrate was purified by silica gel column chromatography and eluted with PE / EA (5:1) to obtain 970 mg of 2,4,9-trithioadamantane-7-carboxylic acid methyl ester (Compound 7a) (yield 41.83%) as a yellow solid.

[0159] 7) Synthesize 2,4,9-trithioadamantane-7-carboxylic acid, the structural formula of which is shown in 8a, and the synthetic route is as follows:

[0160]

[0161] The specific steps are:

[0162] At room temperature and under stirring conditions, 970 mg (3.905 mmol) of methyl 2,4,9-trithioadamantane-7-carboxylate (Compound 7a) was added to a mixed solution of 5 mL MeOH, 5 mL deionized water and 5 mL tetrahydrofuran (THF), and 312.4 mg (7.810 mmol) of sodium hydroxide was added thereto and stirred for 3 hours. After stirring, the mixture was concentrated in vacuo. After concentration, the mixture was diluted with 20 mL of water. The residue after dilution was acidified to pH 3 with 1 mol / L HCl at 0°C, the solid obtained was filtered and collected, and then washed twice with 5 mL of deionized water. The solid obtained in the previous step was dried under vacuum to obtain 2,4,9-trithioadamantane-7-carboxylic acid (Compound 8a) as a white solid.

[0163] 8) Synthesize 2,4,9-trithioadamantane-7-carboxyl-dibenzocyclooctynamide, the structural formula of which is shown in 9a, and the synthetic route is as follows:

[0164]

[0165] The specific steps are:

[0166] At room temperature, nitrogen protection, and stirring conditions, 700 mg (2.987 mmol) of 2,4,9-trithioadamantane-7-carboxylic acid (Compound 8a) and 1.15 g (8.961 mmol) of N,N-diisopropylethylamine (DIEA) were dissolved in 10 mL of N,N-dimethylformamide (DMF), and 1.36 g (3.584 mmol) of 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) was added thereto and stirred for 5 min. At room temperature, 907.96 mg (3.286 mmol / L) of dibenzocyclooctynamine (DBCO-NH2) was added to the mixture in the previous step and stirred for 2 h. The mixture obtained above was diluted with 50 mL of water, and then extracted twice with 20 mL of ethyl acetate (EtOAc), dried over anhydrous Na2SO4, filtered, and the filtrate was concentrated under reduced pressure. The concentrated solution was purified by reverse phase flash chromatography, with a C18 silica gel column as the solid phase and an acetonitrile aqueous solution as the mobile phase, to obtain 1.07 g (yield: 72.71%) of 2,4,9-trithioadamantane-7-carboxyl-dibenzocyclooctynamide (Compound 9a) as an off-white solid, i.e., the trithioadamantane derivative.

[0167] The method for the "click chemistry" reaction of the trithioadamantane derivative containing an alkynyl group and the primer containing an azide terminal group is as follows:

[0168]

[0169] Preferably, the method of anchoring the primer on the functionalized surface of the gold electrode includes two methods:

[0170] Method 1:

[0171] Firstly, a trithioadamantane derivative compound containing an alkynyl group is synthesized, and a primer containing an azide terminal group is synthesized;

[0172] A primer containing an azide terminal group and a trithioadamantane derivative containing an alkynyl group is subjected to a click chemistry reaction, wherein the alkynyl group reacts with the azide group to obtain a primer containing three sulfurs at the terminal group; then, the primer containing three sulfurs at the terminal group is reacted with a gold electrode, thereby anchoring the primer on the functionalized surface of the gold electrode.

[0173] Method 2:

[0174] Firstly, a trithioadamantane derivative compound containing an alkynyl group is synthesized, and a primer containing an azide terminal group is synthesized;

[0175] Then, the trithioadamantane derivative containing an alkynyl group is anchored on the surface of the gold electrode to form a functionalized surface; and then a primer containing an azide end group is added to allow the primer to undergo a click chemical reaction with the alkynyl group in the functionalized surface and be anchored to the functionalized surface of the gold electrode.

[0176] Corresponding to method 1, the specific steps are as follows:

[0177] S1-1, 0.102 mg (200 nmol) of a trithioadamantane derivative containing an alkynyl group was dissolved in 5 ml of a mixed solution consisting of water and DMF (N,N-dimethylformamide) in a volume ratio of 1:1 to obtain a solution 1;

[0178] S1-2, 0.66 mg (200 nmol) of the primer containing an azide terminal group and 0.132 (200 nmol) of polyethylene glycol containing an azide terminal group were dissolved in 5 ml of a mixed solution composed of water and DMF in a volume ratio of 1:1 to obtain solution 2;

[0179] S1-3, mixing solution 1 and solution 2, and reacting them at room temperature under stirring for 4 hours to obtain solution 3;

[0180] S1-4. After cleaning and drying the gold electrode, inject solution 3 from the injection port of the flow cell to fill it. Leave it at room temperature in a dark environment for 12 hours to anchor the primer on the functionalized surface of the gold electrode.

[0181] Corresponding to method 2, the specific steps are as follows:

[0182] S2-1, dissolving 0.102 mg (200 nmol) of a trithioadamantane derivative containing an alkynyl group in 5 ml of a mixed solution consisting of water and DMF in a volume ratio of 1:1 to obtain a solution 4;

[0183] S2-2, after cleaning and drying the gold electrode, inject solution 4 into the flow cell from the injection port to fill the flow cell, and leave it at room temperature in a dark environment for 12 hours to form a functionalized surface on the gold electrode;

[0184] S2-3, 0.66 mg (200 nmol) of the primer containing an azide terminal group and 0.132 (200 nmol) of polyethylene glycol containing an azide terminal group were dissolved in 5 ml of a mixed solution composed of water and DMF in a volume ratio of 1:1 to obtain solution 5;

[0185] S2-4, inject solution 5 from the injection port of the flow cell to fill it, and leave it at room temperature in a dark environment for 4 hours. Repeat the operation 3 times to anchor the primer on the functionalized surface of the gold electrode.

[0186] The polyethylene glycol containing an azide end group is used as a diluent, and the density of the primer on the electrode surface is controlled by adjusting the amount of the polyethylene glycol and the primer added. The polyethylene glycol containing an azide end group is purchased from Aladdin, CAS number: N#A232396.

[0187] Wherein, the primer can be any forward amplification primer or reverse amplification primer containing a functional group, preferably, wherein the functional group can undergo a click chemistry reaction, and examples of suitable functional group-terminated primers include alkyne-terminated primers and azide-terminated primers. A mixture of primers can also be used. Examples of suitable primer sequences include P5 primers and or P7 primers, wherein the P5 sequence example: TCGGTGGTCGCCGTATCATT (SEQ ID NO.1); P7 sequence example: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO.2). The primers are commissioned to be synthesized by Bioengineering.

[0188] Example 2

[0189] A sequencing kit, comprising: the flow cell of Example 1;

[0190] and labeled nucleotides to be introduced into the flow cell, each labeled nucleotide comprising:

[0191] Nucleotides with 3'OH blocking groups;

[0192] a linker molecule attached to the base or sugar of a nucleotide;

[0193] and an electrochemiluminescent label attached to the linker molecule.

[0194] The general structural formula of electrochemiluminescent labeled nucleotides is as follows:

[0195]

[0196] R1 is one of a monophosphate group and a polyphosphate group; a triphosphate group

[0197] R2 is a 3'OH blocking group, which can be -CH2N3, -NH2, -CH=CHCH2, o-nitrobenzyl ether, o-nitrobenzyl alkyl carbonate, ester moieties, other allyl moieties, acetals (e.g., tert-butoxyethoxy), MOM (-CH2OCH3) moieties, 2,4-dinitrophenthoxysulfenyl, tetrahydrofuran ether, 3' phosphate, ether, -F, -H2, -OCH3, -N3, -HCOCH3, and 2-nitrobenzene carbonate, etc.;

[0198] R3 is hydrogen or hydroxyl;

[0199] Bases include adenine, guanine, cytosine, thymine, uracil, hypoxanthine or their analogs;

[0200] The linker molecule is connected to the 5-position of pyrimidine (C, T, U) and the 7-position of deazapurine (A, G), and has a cleavable site on the linker molecule.

[0201] The electrochemiluminescent label may be an anodic electrochemiluminescent label or a cathodic electrochemiluminescent label;

[0202] The anodic electrochemiluminescent marker can be tris(2,2'-bipyridine)ruthenium(II) (Ru(bpy)3 2+ ), tris(2-phenylpyridine)iridium(III) (Ir(ppy)3 3+ ), tris(2,2'-bipyridyl)osmium(II) (Os(bpy)3 2+ ), 2-thianthrenecarboxylic acid, sodium 9,10-diphenylanthracene-2-sulfonate (DPAS).

[0203] (1) Nucleotides include a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position present in ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) can be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U) and their modified derivatives or analogs. The C-1 atom of ribose or deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleotides can be in the form of monophosphates or polyphosphates containing several phosphate groups (e.g., triphosphates (i.e., gamma phosphates), tetraphosphates, pentaphosphates, hexaphosphates, etc.).

[0204] (2) The nucleotide has a 3'OH blocking group attached to it. The 3'OH blocking group can be attached to the oxygen atom of the sugar molecule in the nucleotide. The 3'OH blocking group can be a reversible terminator that only allows a single base incorporation to occur in each sequencing cycle. The reversible terminator prevents additional bases from being incorporated into a nascent chain complementary to the template polynucleotide chain, thereby enabling detection and identification of a single incorporated base. The 3'OH blocking group can then be removed, allowing additional sequencing cycles to occur at each template polynucleotide chain. The 3'OH blocking group can be a 3'-ONH2 reversible terminator, a 3'-O-allyl reversible terminator (i.e., -CH=CHCH2), a 3'-O-azidomethyl reversible terminator (i.e., -CH2N3), o-nitrobenzyl ether, o-nitrobenzyl alkyl carbonate, ester moieties, other allyl moieties, acetals (e.g., tert-butoxyethoxy), MOM (-CH2OCH3) moieties, 2,4-dinitrophenthoxysulfenyl, tetrahydrofuran ether, 3' phosphate, ether, -F, -H2, -OCH3, -N3, -HCOCH3, and 2-nitrobenzene carbonate, etc.

[0205] (3) The linker molecule can be attached to the base or sugar of the nucleotide. Preferably, the linker molecule is attached to the purine base or pyrimidine base of the nucleotide. The linker molecule has a cleavage site.

[0206] (4) The electrochemiluminescent marker may have a distinctive emission spectrum, oxidation potential or reduction potential, electrochemiluminescent emission lifetime, electrochemiluminescent emission intensity or specific cleavage activity. The electrochemiluminescent marker may be an anodic ECL marker, such as tris(2,2'-bipyridine)ruthenium(II) (Ru(bpy)3 2+ ), tris(2-phenylpyridine)iridium(III) (Ir(ppy)3 3+ ), tris(2,2'-bipyridyl)osmium(II) (Os(bpy)3 2+ ), 2-thianthrenecarboxylic acid, 9,10-diphenylanthracene-2-sulfonate sodium (DPAS). Tris(2,2'-bipyridyl)ruthenium(II) (Ru(bpy)3 2+ ), tris(2-phenylpyridine)iridium(III) (Ir(ppy)3 3+ ), tris(2,2'-bipyridyl)osmium(II) (Os(bpy)3 2+ ) are structured as follows Figure 1 As shown;

[0207] The structure of 2-thioanthracenecarboxylic acid, sodium 9,10-diphenylanthracene-2-sulfonate (DPAS) is shown below:

[0208]

[0209] 2-Thianthrenecarboxylic acid 9,10-diphenylanthracene-2-sulfonate sodium salt (DPAS)

[0210] Anodic ECL tagged nucleotides are oxidized under an applied positive potential to generate radical cations, which can then undergo an electron transfer reaction with a co-reactant (such as a reducing agent) to form a neutral excited state that is emissive.

[0211] Figure 2 Examples are given of the types of ruthenium complexes that can be excited to emit light at different potentials.

[0212] Suitable reducing agent co-reactants for anodic ECL labels include aliphatic amines, such as trialkylamines (eg, tri-n-propylamine), N,N-diethylethanolamine (DBAE), and oxalate esters.

[0213] Specifically, the structure of the electrochemiluminescent labeled nucleotide includes the following structure:

[0214]

[0215] More specifically, the structure of the electrochemiluminescent labeled nucleotide includes the following structure:

[0216]

[0217] More specifically, the structure of the electrochemiluminescent labeled nucleotides includes the following structures: (1) cytosine

[0218]

[0219] (2) Thymine

[0220]

[0221] (3) Adenine

[0222]

[0223] (4) Guanine

[0224]

[0225] Example 3

[0226] This embodiment provides a method for preparing the above-mentioned specially labeled nucleotides, that is, a method for preparing electrochemiluminescent labeled nucleotides, comprising:

[0227] The synthesis of nucleotides containing cytosine is used as an example to introduce the preparation process of electrochemiluminescent labeled nucleotides in detail:

[0228]

[0229] The overall synthetic route of the electrochemiluminescent labeled nucleotides is referenced Figure 4 The specific preparation process mainly includes the following steps:

[0230] A. Compound 1b The synthesis of the linker molecule on the labeled nucleotide is as follows:

[0231]

[0232] The specific synthesis steps are as follows:

[0233] 1. Dissolve 5 g (30.089 mmol) of ethyl 3-hydroxybenzoate (compound 1b-1) in 30 mL of N,N-dimethylformamide (DMF), then add 15.07 g (90.267 mmol) of 2-(bromomethyl)-1,3-dioxolane, 8.32 g (60.178 mmol) of K2CO3 and 2.00 g (12.036 mmol) of KI, stir and react for 10 h at 110 ° C under nitrogen protection, and cool to room temperature after the reaction is completed. At room temperature, add water to quench the reaction. The resulting mixture is extracted with 100 mL of ethyl acetate three times. The organic layer obtained by extraction is washed three times with 100 mL of saturated brine, and finally dried over anhydrous sodium sulfate. The resulting mixture is filtered and the filtrate is concentrated under reduced pressure. The residue was purified by silica gel column chromatography using PE / EA (0-19%) as eluent to obtain 6.8 g of ethyl 3-(1,3-dioxolanyl-2-methoxy)benzoate (Compound 1b-2) (yield: 89.59%, purity: 97.596%) as a colorless oil.

[0234] 2. Dissolve 1 g (3.964 mmol) of ethyl 3-(1,3-dioxolane-2-methoxy)benzoate (Compound 1b-2) in 5 mL of dichloromethane, add 0.57 mL (4.360 mmol) of trimethylsilane and 27.84 μL (0.238 mmol) of tin tetrachloride, and stir the reaction at room temperature under nitrogen protection for 2 h. At room temperature, add 5 mL of 2% methanol to quench the reaction. The resulting mixture is concentrated under reduced pressure. The resulting concentrate is purified by silica gel column chromatography and eluted with PE / EA (0-50%) to obtain 440 mg of ethyl 3-[2-azido-2-(2-hydroxyethoxy)ethoxy]benzoate (Compound 1b-3) (yield 37.59%, purity 94%), which is a colorless oil.

[0235] 3. 0.44 g (1.490 mmol) of ethyl 3-[2-azido-2-(2-hydroxyethoxy)ethoxy]benzoate (Compound 1b-3) and 0.60 g (14.900 mmol) of NaOH were reacted in a mixed solution of 3.3 mL of ethanol and 3.3 mL of water at room temperature with stirring for 3 h. The resulting mixture was concentrated under reduced pressure. The concentrated solution was dissolved with 3.3 mL of water. The resulting mixed solution was acidified with 10% H2SO4 to a pH of 2. The resulting aqueous layer was extracted three times with 30 mL of dichloromethane. The above organic layers were combined and dried over anhydrous Na2SO4 and filtered. The resulting filtrate was decompressed and concentrated to obtain 363 mg of 3-[2-azido-2-(2-hydroxyethoxy)ethoxy]benzoic acid (Compound 1b-4), a colorless oil.

[0236] 4. Dissolve 223 mg (0.834 mmol) of 3-[2-azido-2-(2-hydroxyethoxy)ethoxy]benzoic acid (Compound 1b-4) in 2.3 mL of N,N-dimethylformamide, and first react with 256.51 mg (1.001 mmol) of N,N-disuccinimidyl carbonate and 122.34 mg (1.001 mmol) of 4-dimethylaminopyridine (DMAP) at room temperature and under stirring for 10 min, then add 160.43 mg (1.001 mmol) of tert-butyl N-(2-aminoethyl)carbamate and 348.84 μL (2.002 mmol) of N,N-diisopropylethylamine, and react at room temperature and under stirring for 16 h. After the reaction is completed, add water to make up to 10 mL. The resulting mixture is extracted 3 times with 20 mL of dichloromethane. The organic layers were combined, washed three times with 20 mL of brine, and then dried over anhydrous Na2SO4. The mixture was filtered and the filtrate was concentrated under reduced pressure. The resulting concentrate was purified by silica gel column chromatography and eluted with PE / EA (0% to 95%) to obtain 253 mg of tert-butyl N-[2-({3-[2-azido-2-(2-hydroxyethoxy))ethoxy]phenyl}formamido)ethyl]carbamate (compound 1b-5) (yield 74.05%, purity 100%) as a colorless oil.

[0237] 5. Dissolve 2.23 g (5.446 mmol) of tert-butyl N-[2-(({3-[2-azido-2-(2-hydroxyethoxy))ethoxy)phenyl}formamido)ethyl]carbamate (Compound 1b-5) in 23 mL of tetrahydrofuran, treat with 0.39 g (16.338 mmol) of NaH (60% wt mineral oil solution) at 0°C under nitrogen protection for 10 min, then add 2.00 g (11.981 mmol) of ethyl 2-bromoacetate under the same conditions and stir for 3 h. After the reaction is completed, add 50 mL of water at 0°C to quench the reaction. After returning to room temperature, add 1 mol / L of LiOH solution to the above mixture and continue stirring for 2 h. Concentrate under reduced pressure to remove tetrahydrofuran. The resulting mixture is acidified to pH 3 with citric acid solution and extracted 3 times with 200 mL of dichloromethane. Combine the organic layers and dry with anhydrous Na2SO4. The filtrate was filtered and concentrated under reduced pressure. The concentrate was purified by reverse phase flash chromatography using a C18 silica gel column with acetonitrile-water as the mobile phase and a gradient of 2% to 40% for 30 min. 1.23 g of (2-{1-azido-2-[3-({2-[(tert-butoxycarbonyl)amino]ethyl}carbamoyl)phenoxy]ethoxy}ethoxy)acetic acid (compound 1b-6) (yield 47.49%, purity 99.26%) was obtained as a light orange oil.

[0238] 6. Dissolve 690 mg (1.476 mmol) of (2-{1-azido-2-[3-({2-[(tert-butoxycarbonyl)amino]ethyl}carbamoyl)phenoxy]ethoxy}ethoxy)acetic acid (Compound 1b-6) in 7 mL of dichloromethane, add 1.2 mL of trifluoroacetic acid, and stir the reaction at room temperature under nitrogen protection for 1 h. The resulting mixed solution was diluted with 2 mL of toluene. The resulting mixture was concentrated under vacuum. The concentrate was purified by reverse phase flash chromatography under the conditions of C18 silica gel column, acetonitrile-water as the mobile phase, and a gradient of 2% to 20% elution for 30 min; 300 mg of [2-(2-{3-[(2-aminoethyl))carbamoyl]phenoxy}-1-azidoethoxy)ethoxy]acetic acid (Compound 1b) (yield 55.33%, purity 100%) was obtained as a white solid.

[0239] B. Compound 2b That is, the electrochemiluminescent marker was purchased from Bidex Pharmaceuticals, CAS No. 218600-82-9, product No. BD01408635.

[0240] C. Compound 3b The synthesis of an electrochemiluminescent marker with a linker molecule: Compound 1b and compound 2b undergo amidation reaction to obtain compound 3b. The synthesis route is as follows:

[0241]

[0242] The specific synthesis steps are:

[0243] 500.23 mg (0.553 mmol) of bis(2,2'-bipyridine)[2,2'-bipyridine-4-carboxylic acid]ruthenium(II) hexafluorophosphate (compound 2b) was dissolved in 5 mL of N,N-dimethylformamide, and then 283.64 mg (1.107 mmol) of N,N'-succinimidyl carbonate and 135.27 mg (1.107 mmol) of 4-dimethylaminopyridine were added thereto under nitrogen protection and stirred for 30 min. After the reaction was completed, 533 mg (1.107 mmol) of [2-(2-{3-[(2-aminoethyl)carbamoyl]phenoxy}-1-azidoethoxy)ethoxy]acetic acid and 283.64 μL (2.214 mmol) of N,N-diisopropylethylamine were added to the mixture at room temperature and stirred for 2 h. The resulting mixture was concentrated under vacuum. The concentrate was purified by reverse phase flash chromatography using a C18 silica gel column and acetonitrile-water as the mobile phase with a gradient of 10% to 50% for 30 min to obtain 300 mg of bis(2,2'-bipyridine)([2,2'-bipyridine]-4-({2-[(3-{2-azido-2-[2-(carboxymethyloxy)ethoxy]ethoxy}phenyl)formamide]ethyl}carbamoyl))ruthenium(II) hexafluorophosphate (compound 3b) (yield: 21.63%, purity: 98.597%) as a reddish brown solid.

[0244] D. Compound 4b That is, the nucleotide with a blocking group attached to 3'OH was purchased from MCE (MedChemExpress), CAS: 666847-71-8, molecular weight: 575.26, catalog number: HY-132138;

[0245] E. Synthesis of compound 5b - target product (nucleotide modified with electrochemiluminescent marker), the synthetic route is as follows:

[0246]

[0247]

[0248] The specific synthesis steps are:

[0249] Bis(2,2'-bipyridine)([2,2'-bipyridine]-4-({2-[(3-{2-azido-2-[2-(carboxymethyloxy)ethoxy]ethoxy}phenyl)formamide]ethyl}carbamoyl))ruthenium(II) hexafluorophosphate (compound 3b) was dissolved in 300 μL of N,N-dimethylformamide and treated with 10 mg (0.010 mmol) of [(dimethylamino)[(2,5-dioxocyclopentyl)oxy]methylene]dimethylazacyclopentene; then 4.69 mg (0.015 mmol) of tetrafluoroborate, 1.90 mg (0.015 mmol) of 4-dimethylaminopyridine and 30.00 mg (0.232 mmol) of N,N-diisopropylethylamine were added thereto under nitrogen protection at room temperature and the reaction was stirred for 2 h. After the reaction was completed, 300 μL of N,N-dimethylformamide solution containing 2.8 mg (0.004 mmol) of 7-deaza-7-propynylamino-3'-azidomethyl-guanine-5-triphosphate triethylamine salt (compound 4b) was slowly added to the mixture, and the reaction was stirred for 1 hour. The resulting mixture was purified by Prep-HPLC, the mobile phase was 100 mM triethylammonium bicarbonate buffer-acetonitrile, and the chromatographic column was YMC-Actus TriartC18ExRS21.2*250mm, 5μm, to obtain 1.1mg of bis(2,2'-bipyridine)([2,2'-bipyridine]-4-{[2-({3-[2-(2-{[(3-{4-amino-1-[(2R,4S,5R)-4-(azidomethoxy)-5-({[hydroxy([hydroxy(phosphonyloxy)phosphate]oxy)phosphate]oxy}methyl)oxolan-2-yl]-2-oxopyrimidin-5-yl}prop-2-yn-1-yl)carbamoyl]methoxy}ethoxy)-2-azidoethoxy]phenyl}formamide)ethyl]carbamoyl})ruthenium(II)tetrakistriethylamine salt (compound 5b) (yield 6.97%, purity 95.4%), which is an orange solid, i.e., electrochemiluminescent labeled guanylate.

[0250] Example 4

[0251] A method for detecting a nucleic acid sequence, comprising:

[0252] (1) The template polynucleotide chain is introduced into the flow cell anchored with the primers, wherein the primers will hybridize with the complementary sequences on the adaptors of the template polynucleotide chain. The template polynucleotide chain is prepared for sequencing. Before sequencing, the template chain is enriched by bridge amplification to enhance the signal strength.

[0253] (2) A fluid containing a polymerase and nucleotides is introduced into a flow cell, the flow cell contains electrodes and is attached with a template polynucleotide chain, at least some of the nucleotides are the above-mentioned specially labeled nucleotides, one of the nucleotides is incorporated into an extended sequencing primer by a corresponding polymerase, and into a nascent chain complementary to the template polynucleotide chain. In other words, at each template polynucleotide chain throughout the flow cell, the corresponding polymerase extends the hybridized sequencing primer by one of the nucleotides in the solution (labeled or unlabeled). The nucleotides in the solution exist as single individual molecules, and therefore natural competition minimizes incorporation bias. Four different nucleotides can be used in the fluid.

[0254] (3) introducing a wash solution into the flow cell to remove unincorporated nucleotides;

[0255] (4) Optionally, a co-reactant is introduced into the fluid together with the polymerase and nucleotides. Or after step (3), a fluid containing the co-reactant is introduced. In addition, a redox shuttle can be added together with the co-reactant. The redox shuttle can move charge to or from the active substance through the fluid. The redox shuttle can diffuse to the electrode surface and become oxidized or reduced. The oxidized or reduced redox shuttle can then diffuse to the ECL marker and react with the ECL marker to form an emission state. When the marker is not in direct physical contact with the electrode, the redox shuttle can enable the ECL marker to undergo a redox reaction. The co-reactant can be one of a trialkylamine (e.g., tri-n-propylamine), N,N-diethylethanolamine (DBAE), and an oxalate.

[0256] (5) applying an electric potential to the electrode and detecting the optical emission in response to the applied electric potential. The electric potential applied to the electrode is sufficient to drive the ECL reaction of any base being incorporated into the labeled nucleotide of the nascent chain. A series of different electric potentials can be applied in sequence to drive the ECL reaction of different ECL markers. The applied electric potential can trigger the electrochemical oxidation or electrochemical reduction of the ECL marker to produce free radical ions, which are then reduced or oxidized by the co-reactant to form an excited state. The excited state produces optical emission. The detection device can use a charge coupled device (CCD), CMOS, EMCCD to record information such as intensity, wavelength, position, etc. Among them, the camera / complementary metal oxide semiconductor (CMOS) can image the optical emission to capture the emission color, and the imaging will capture the optical emission generated by various incorporation events and the applied electric potential, and the corresponding incorporated base can be identified from the image. The captured image can be processed with image analysis software to determine which nucleotides are incorporated into each cluster position throughout the flow cell. In addition, the optical emission is detected by the photodiode of the detection device. The photodiode can detect the optically emitted photons and convert these signals into electrical signals (eg, current or voltage). The electrical signals are correlated with the optical emission of the various ECL labels and can therefore be used to identify the incorporation events of single bases.

[0257] (6) Introducing a deblocking agent into the flow cell. The functions of the deblocking agent are: Ⅰ) cleaving the linker molecule from the incorporated labeled nucleotide to remove the ECL label; Ⅱ) removing the 3'OH blocking group from the incorporated labeled nucleotide or unlabeled nucleotide to facilitate subsequent sequencing cycles. Examples of 3'OH blocking groups and suitable deblocking agents include: o-nitrobenzyl ether and alkyl o-nitrobenzyl carbonates that can be removed photolytically; ester moieties that can be removed by alkaline hydrolysis; allyl moieties that can be removed with NaI, chlorotrimethylsilane and Na2S2O3 or with Hg(II) in acetone / water; azidomethyl groups that can be cleaved by phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP); acetals that can be cleaved by acidic conditions, such as tert-butoxyethoxy; MOM (-CH2OCH3) moieties that can be cleaved by LiBF4 and CH3CN / H2O; 2,4-dinitrophenoxythio groups that can be cleaved by nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ethers that can be cleaved by Ag(I) or Hg(II); and 3' phosphates that can be cleaved by phosphatases (e.g., polynucleotide kinases). Other useful reversible moieties include ethers, -F, -H2, -OCH3, -N3, -HCOCH3, and 2-nitrophenyl carbonate, and useful deblocking treatments include irradiation with light (e.g., to induce photocleavage), heating, exposure to a chemical reactant, exposure to a catalyst, exposure to an electric current (e.g., to induce electrolysis), or the like.

[0258] Preferably, the 3'OH blocking group of the nucleotide is an azidomethyl group, and a suitable deblocking agent is a phosphine, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP).

[0259] In addition to using a blocking agent to remove the blocking group of 3'OH, it can also be removed by electrochemical oxidation or reduction. This method only requires applying a certain potential to the electrode to remove the blocking group, which is simple to operate and highly efficient.

[0260] (7) A wash solution is introduced into the flow cell to remove impurities that are not incorporated into the nascent chain.

[0261] Repeat steps (2) to (7) to determine the base sequence of the target template chain.

[0262] Preferably, in the above sequencing process, a flow cell is used, and the four nucleotides introduced into the flow cell are all labeled with electrochemiluminescent groups, and the electrochemiluminescent groups used are all different. They may have different emission wavelengths or different excitation potentials or different emission lifetimes or different luminescence intensities. After completing the reaction of introducing a nucleotide into a nascent chain complementary to the template nucleotide chain, an electric potential is applied, and a detection device is used to detect the light signal generated in the flow cell, and the light signal is analyzed to obtain the template nucleotide sequence.

[0263] Optionally, in the above sequencing process, four flow cells can be used, and each flow cell performs the above sequencing steps. The difference is that, among the nucleotides introduced into each flow cell, only one is an electrochemiluminescent labeled nucleotide, and the other three types of nucleotides are conventionally used unlabeled nucleotides; and the electrochemiluminescent labeled nucleotides introduced into the four flow cells use the same electrochemiluminescent labeling group, but the base types of the four nucleotides are different. For example, four different base nucleotides of A, T, G, and C are introduced into each flow cell, wherein the deoxyadenine nucleotide (abbreviated as deoxyadenosine, A) in the first flow cell is labeled with an electrochemiluminescent group-terpyridine ruthenium, the deoxythymidine nucleotide (abbreviated as deoxythymidine, T) in the second flow cell is labeled with an electrochemiluminescent group-terpyridine ruthenium, the deoxycytidine nucleotide (abbreviated as deoxycytidine, C) in the third flow cell is labeled with an electrochemiluminescent group-terpyridine ruthenium, and the deoxyguanine nucleotide (abbreviated as deoxyguanosine, G) in the fourth flow cell is labeled with an electrochemiluminescent group-terpyridine ruthenium, after completing the reaction of introducing a nucleotide into the nascent chain complementary to the template nucleotide chain, an electric potential is applied, and a detection device is used to detect the light signals generated in the four flow cells, and the template nucleotide sequence is obtained by merging and analyzing. In this way, sequencing can be performed with only one electrochemiluminescent group and at one potential to excite the labeled group to emit light.

[0264] In addition, optionally, in the above sequencing process, two flow cells can be used, and each flow cell performs the above sequencing steps, the difference being that, of the nucleotides introduced into each flow cell, only two are electrochemiluminescent labeled nucleotides, and the electrochemiluminescent groups of the two labeled nucleotides are different, and they can have different emission wavelengths or different excitation potentials or different emission lifetimes or different luminescence intensities, and the other two types of nucleotides are conventionally used unlabeled nucleotides. For example, nucleotides of four different bases of A, T, G, and C are introduced into each flow cell, wherein the deoxyadenine nucleotides (abbreviated as deoxyadenosine, A) and deoxythymidine nucleotides (abbreviated as deoxythymidine, T) in the first flow cell are labeled with two different electrochemiluminescent groups, and the deoxycytosine nucleotides (abbreviated as deoxycytidine, C) and deoxyguanine nucleotides (abbreviated as deoxyguanosine, G) in the second flow cell are labeled with two different electrochemiluminescent groups. After the reaction of introducing a nucleotide into the nascent chain complementary to the template nucleotide chain is completed, an electric potential is applied, and the light signals generated in the two flow cells are detected using a detection device, and combined and analyzed to obtain the template nucleotide sequence.

[0265] Figure 6 Schematic diagram of the flow cell structure including electrodes.

[0266] Figure 7 The system structure of an electrochemiluminescence sequencing device is shown in the figure. The electrochemiluminescence sequencer is mainly composed of a flow cell loading module, an optical detection module, an electrochemical control module, and a liquid circuit control module. Among them, the reaction reagents used in the sequencing process mainly include electrochemiluminescence-labeled deprotectable dNTPs, amplification-related reagents such as DNA amplification enzymes, and electrochemiluminescence system reagents; the flow cell includes a channel, an electrode, and an oligonucleotide probe containing trithioadamantane modified on the electrode surface; the optical detection module includes a high-magnification objective lens, a filter semi-transparent and semi-reflective mirror, and a CCD camera; the electrochemical control module includes an electrical signal generation unit, a transmission line, and an electrical signal feedback unit, etc., which are used to stimulate the electrochemiluminescence reaction; the liquid circuit control module mainly includes a sampler, a multi-channel steering valve, a coupling pump, a flow sensor, etc., which are used to control the flow of liquid during the sequencing reaction.

[0267] The sequencing principle of the electrochemiluminescence sequencer is based on the controllable self-assembly nucleotide anchoring technology on the gold electrode surface, reversible termination technology, sequencing by synthesis technology, electrochemiluminescence technology, etc. First, the diluted library is added to the sequencing flow cell. The library first complements with the oligonucleotide sequence containing trithioadamantane modified on the surface of the flow cell electrode, and the sample sequence information is transferred to the flow cell with the library sequence as a template; then the bridge PCR amplification reaction is carried out on the flow cell to enrich the sample sequence, and each sequence forms a cluster of the same sequence at its adjacent position to enhance the fluorescence detection signal; finally, cycle sequencing is carried out. The specific process is to first pump DNA polymerase, deprotectable dNTPs with electrochemiluminescent groups, and other synthesis reaction system reagents through the liquid control system to perform DNA chain synthesis reaction in a way of extending one base at a time; then the electrochemical control module generates an electrical signal to excite the newly extended ECL-labeled base to emit light, and the optical imaging system is used to read the light signal; finally, the protective group removal reagent is added to remove the protective group and ECL group on the newly extended base, exposing the 3' terminal hydroxyl group for the next sequencing cycle.

[0268] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to specific details.

Claims

1. A flow cell, characterized in that include: substrate; an electrode positioned on the substrate; The electrode has a functionalized surface, and the functionalized surface includes a trithioadamantane derivative linker; and a primer, wherein the primer is connected to a trithioadamantane derivative by a click chemistry reaction and then anchored on the functionalized surface of the electrode.

2. The flow cell according to claim 1, characterized in that The electrode is a gold electrode.

3. The flow cell according to claim 1 or 2, characterized in that in, The trithioadamantane derivative and the primer contain an alkynyl group and an azide group in their structures respectively.

4. The flow cell according to claim 3, characterized in that The structure of the trithioadamantane derivative is shown in 9a below:

5. The flow cell according to claim 4, characterized in that The preparation method of trithioadamantane derivative comprises the following steps: 1) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-malonic acid dimethyl ester, the structural formula of which is shown in 2a, and the synthesis route is as follows: The specific steps are: At room temperature, under nitrogen protection and stirring conditions, potassium tert-butoxide is dissolved in dimethyl sulfoxide, and then dimethyl malonate with the structural formula 1a is added, and finally the mixture is stirred at room temperature and under nitrogen protection conditions; at room temperature, 2-(bromomethyl)-1,3-dioxolane is added to the obtained solution, and the solution is heated and stirred under nitrogen protection conditions for reaction, and after the reaction is completed, the solution is cooled and diluted; the obtained mixture is extracted with ethyl acetate, and the organic layer obtained by the extraction is washed, dried, filtered, and the filtrate is concentrated under reduced pressure; the obtained concentrated solution is purified to obtain 2,2-bis(1,3-dioxolane-2-methyl)-dimethyl malonate; 2) Synthesis of 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester, the structural formula of which is shown in 3a, and the synthetic route is as follows: The specific steps are: Dissolve 2,2-bis(1,3-dioxolane-2-methyl)-malonic acid dimethyl ester in N,N-dimethylformamide at room temperature and under stirring conditions, add sodium bromide at room temperature and under nitrogen protection and stirring conditions, and react under heating, nitrogen protection and stirring conditions; after the reaction, cool and dilute the obtained mixed solution, extract it with ethyl acetate, wash, dry and filter the obtained organic layer, reduce pressure and concentrate the filtrate, and purify the concentrated solution to obtain 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester; 3) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester, the structural formula of which is shown in 4a, and the synthetic route is as follows: The specific steps are: Dissolve 3-(1,3-dioxolane)-2-(1,3-dioxolane-2-methyl)-propionic acid methyl ester in tetrahydrofuran at room temperature with stirring, add a tetrahydrofuran solution of lithium diisopropylamide dropwise at -45°C under nitrogen protection and stirring, continue stirring for reaction and then naturally warm to room temperature; add NH4Cl solution to the mixture at room temperature to quench the reaction, cool and dilute the obtained mixed solution, extract with ethyl acetate, wash, dry and filter the obtained organic layer, reduce pressure and concentrate the filtrate, purify the obtained concentrated solution to obtain 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester; 4) Synthesis of 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester, the structural formula of which is shown in 5a, and the synthetic route is as follows: The specific steps are: Under room temperature and stirring conditions, 2,2-bis(1,3-dioxolane-2-methyl)-4-ene-1-pentanoic acid methyl ester is dissolved in a mixed solution of dioxane and deionized water, and then NaIO4 is added and dissolved, and finally OsO4 is added and dissolved at 0°C under nitrogen protection and stirring conditions, and after the dissolution is completed, the reaction is continued to be stirred at room temperature; after the reaction is completed, the obtained mixed solution is diluted and extracted with ethyl acetate, the organic layer obtained by extraction is washed, dried, filtered, and the filtrate is concentrated under reduced pressure, and the obtained concentrated solution is purified to obtain 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester; 5) Synthesis of 2,2-di(2-oxoethyl)-4-aldehyde-butyric acid methyl ester, the structural formula of which is shown in 6a, and the synthesis route is as follows: The specific steps are: Under room temperature and stirring conditions, 2,2-bis(1,3-dioxolane-2-methyl)-4-aldehyde-butyric acid methyl ester is added to a mixed solution of HCl and tetrahydrofuran, and stirring is continued; after the stirring is completed, it is neutralized with a saturated NaHCO3 solution to a pH of 7; the obtained mixed solution is extracted with ethyl acetate, and the extracted organic layer is washed, dried, filtered, reduced pressure, and concentrated to obtain 2,2-bis(2-oxoethyl)-4-aldehyde-butyric acid methyl ester; 6) Synthesize 2,4,9-trithioadamantane-7-carboxylic acid methyl ester, the structural formula of which is shown in 7a, and the synthesis route is as follows: The specific steps are: Under room temperature and stirring conditions, 2,2-di(2-oxoethyl)-4-aldehyde-butyric acid methyl ester and aluminum oxide are added to acetonitrile, and then P2S5 is added. After heating, the mixture is stirred and reacted under nitrogen protection. After the reaction is completed, the mixture is cooled to room temperature and filtered. The obtained filter cake is washed with ethyl acetate. The obtained filtrate is decompressed, concentrated, and purified to obtain 2,4,9-trithioadamantane-7-carboxylic acid methyl ester. 7) Synthesize 2,4,9-trithioadamantane-7-carboxylic acid, the structural formula of which is shown in 8a, and the synthetic route is as follows: The specific steps are: Under room temperature and stirring conditions, methyl 2,4,9-trithioadamantane-7-carboxylate is added to a mixed solution of MeOH, deionized water and tetrahydrofuran, and then sodium hydroxide is added and stirred continuously. After the stirring is completed, the mixture is concentrated in vacuo, and then diluted. The diluted product is acidified to pH 3 with HCl at 0° C., and the obtained solid is filtered and collected, washed and dried to obtain 2,4,9-trithioadamantane-7-carboxylic acid; 8) Synthesize 2,4,9-trithioadamantane-7-carboxyl-dibenzocyclooctynamide, the structural formula of which is shown in 9a, and the synthetic route is as follows: The specific steps are: At room temperature, under nitrogen protection and stirring conditions, 2,4,9-trithioadamantane-7-carboxylic acid and N,N-diisopropylethylamine are dissolved in N,N-dimethylformamide, and then 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate is added and stirred continuously. At room temperature and under stirring conditions, dibenzocyclooctynamine is added to the obtained mixture, and the mixture is stirred continuously for reaction. After the reaction is completed, the obtained mixed solution is diluted, and then extracted with ethyl acetate. The organic layer obtained by the extraction is washed, dried, filtered, and the filtrate is concentrated under reduced pressure. The obtained concentrated solution is purified to obtain 2,4,9-trithioadamantane-7-carboxyl-dibenzocyclooctynamide, i.e., the trithioadamantane derivative.

6. A sequencing kit, characterized in that: include: The flow cell according to any one of claims 1 to 5; and labeled nucleotides to be introduced into the flow cell, each labeled nucleotide comprising: Nucleotides with 3'OH blocking groups; a linker molecule attached to the base or sugar of the nucleotide; and an electrochemiluminescent label attached to the linker molecule.

7. The sequencing kit according to claim 6, characterized in that Wherein the labeled nucleotides include at least three different labeled nucleotides, and wherein the corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct detectable signal, and the detectable signal is an emission spectrum, an excitation potential, an electrochemiluminescent emission lifetime or an electrochemiluminescent emission intensity.

8. The sequencing kit according to claim 7, characterized in that The labeled nucleotides include the following structure: R1 is one of a monophosphate group and a polyphosphate group; R2 is a 3'OH blocking group, which is -CH2N3, -NH2, -CH=CHCH2, o-nitrobenzyl ether, o-nitrobenzyl alkyl carbonate, tert-butoxyethoxy, -CH2OCH3, 2,4-dinitrophenoxysulfenyl, tetrahydrofuran ether, 3' phosphate, ether, -F, -H2, -OCH3, -N3, -HCOCH3 or 2-nitrobenzene carbonate; R3 is hydrogen or hydroxyl; Bases include adenine, guanine, cytosine, thymine, uracil, hypoxanthine or their analogs; The electrochemiluminescent label is an anodic electrochemiluminescent label or a cathodic electrochemiluminescent label.

9. The sequencing kit according to claim 8, characterized in that The electrochemiluminescent marker in the labeled nucleotide structure is selected from tris(2,2'-bipyridine)ruthenium(II) (Ru(bpy)3 2+ ), tris(2-phenylpyridine)iridium(III) (Ir(ppy)3 3+ ), tris(2,2'-bipyridyl)osmium(II) (Os(bpy)3 2+ ), at least one of 2-thianthrenecarboxylic acid and sodium 9,10-diphenylanthracene-2-sulfonate (DPAS).

10. The sequencing kit according to claim 8, characterized in that In the labeled nucleotide structure, R1 is a triphosphate group and R2 is -CH2N3.

11. The sequencing kit according to claim 9, characterized in that The labeled nucleotide structure is shown below:

12. A gene sequencing method, characterized in that: include: (1) attaching a template polynucleotide chain to an electrode of a flow cell as described in any one of claims 1 to 5; (2) introducing a fluid comprising a polymerase and nucleotides into a flow cell, at least some of the nucleotides being labeled nucleotides, and each of at least some of the labeled nucleotides being a nucleotide as described in any one of claims 6 to 11; One of the nucleotides is incorporated into a nascent strand that is complementary to the template polynucleotide strand; applying an electric potential to the electrodes; and detecting optical emission in response to the applied potential.

13. The method according to claim 12, characterized in that wherein the incorporated one of the nucleotides is one of the labeled nucleotides, and wherein the application of the electric potential initiates a redox reaction pathway involving an electrochemiluminescent label of the incorporated one of the labeled nucleotides.

14. The method according to claim 13, characterized in that There are four flow cells, each flow cell introduces a fluid containing a polymerase and nucleotides, and the fluid introduced into each flow cell contains the labeled nucleotides of a different base type, one of the nucleotides is incorporated into a nascent chain complementary to the template polynucleotide chain; applying a potential to the electrode; and detecting optical emission in response to the applied potential; Alternatively, there are two flow cells, each of which introduces a fluid containing a polymerase and nucleotides, and the fluid introduced into each flow cell respectively contains two different base types of the labeled nucleotides, one of the nucleotides is incorporated into a nascent chain complementary to the template polynucleotide chain; an electric potential is applied to the electrode; and optical emission in response to the applied electric potential is detected.

15. The method according to claim 13, characterized in that in: The fluid includes at least three different labeled nucleotides; The corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct emission spectrum; And the method further comprises identifying the incorporated one of the labeled nucleotides from optical emission of the incorporated one of the labeled nucleotides.

16. The method according to claim 13, characterized in that in: The fluid includes at least three different labeled nucleotides; The corresponding electrochemiluminescent label of each of the at least three different labeled nucleotides has a distinct oxidation potential or reduction potential; And the method further comprises identifying the incorporated one of the labeled nucleotides from the applied potential.

17. The method according to claim 13, characterized in that Wherein before applying the potential, the method further comprises introducing a co-reactant into the flow cell.

18. The method according to claim 17, characterized in that wherein the linking molecule and the electrochemiluminescent label of the incorporated one of the labeled nucleotides are attached during incorporation, application of potential, and optical detection, and wherein after the optical detection, the method further comprises: The linking molecule and the electrochemiluminescent marker are cleaved from the one of the labeled nucleotides incorporated therein by introducing a deblocking agent or applying an electric potential, and the 3'OH blocking group is removed from the one of the labeled nucleotides incorporated therein, thereby enabling another nucleotide or another labeled nucleotide to be incorporated into the nascent chain.

19. The method according to claim 18, characterized in that in: a photodiode detecting the optical emission; And the method also includes detecting an electrical signal corresponding to the optical emission.

20. The method of claim 19, wherein: in: The optical emission is detected using a camera.

Images