Novel viable vaccine vector and application thereof

Abstract

The invention discloses a novel viable vaccine vector and application thereof. The invention relates to the technical field of biology, and provides recombinant shigella which is a strain obtained after a fim gene is introduced into receptor shigella. The fim gene is any one of the following: (A1) a DNA (Deoxyribose Nucleic Acid) molecule as shown in SEQ ID No.1; and (A2) a DNA molecule which has 80% or more of identity with the DNA sequence limited by (A1) and has the same function with the DNA sequence limited by (A1). The recombinant shigella provided by the invention is a carrier strain with shigella pili, can be used as a mucosal vaccine delivery carrier, and is used for researching oral viable bacteria carrier vaccines.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a novel live bacteria vaccine carrier and application thereof. Background Art

[0002] 90% of pathogens infect the body through the mucosa, such as Helicobacter pylori, Vibrio cholerae, rotavirus, etc. Compared with intramuscular vaccines, oral mucosal vaccines have the advantages of convenience, high cost-effectiveness, and avoidance of needle injuries. However, the adverse environment of the gastrointestinal tract poses a major challenge to oral vaccines. For example, the rich digestive juices in the gastrointestinal tract can degrade antigens, and the mucosal barrier makes it impossible to effectively deliver antigens. Many studies have shown that attenuated live bacteria have the ability to be mucosal vaccine delivery carriers. Attenuated Shigella flexneri and attenuated Salmonella have been used to deliver heterologous antigens from viruses, bacteria, and fungi to induce immune protection against pathogens.

[0003] FimH is an adhesion component from the tip of type I fimbriae of pathogenic Escherichia coli and Salmonella. Several studies have shown that purified FimH can directly bind to TLR4 and induce the expression of proinflammatory factors in macrophages and NK cells. Liu et al. developed an anti-caries vaccine using FimH as a mucosal adjuvant to provide protection against caries. Microfold cells (M cells) located on Peyer's patches (PPs) play an important role in initiating antigen-specific mucosal immune responses due to their unique characteristics such as the lack of apical microvilli (thin glycocalyx). FimH can help microorganisms or particles enter Peyer's patches by binding to the GP2 receptor at the tip of M cells, thereby inducing immunity.

[0004] The FimH protein sequence of Shigella flexneri vaccine strain 2aT32 differs from that of Escherichia coli k12 by only one amino acid, but the type I fimbriae cluster gene of 2aT32 is fimA and fmD The presence of an insertion fragment in the strain affects the secretion and assembly of its type 1 fimbriae protein FimH. Summary of the invention

[0005] The purpose of the present invention is to provide a novel live bacteria vaccine carrier and application thereof.

[0006] In a first aspect, the present invention claims a recombinant Shigella.

[0007] The recombinant Shigella claimed in the present invention is introduced into the recipient Shigella fim The strain obtained after the gene; Said fim The gene is a recombinant pilus cluster gene artificially obtained from Shigella, and can be any of the following: (A1) DNA molecule shown in SEQ ID No. 1; (A2) A DNA molecule that has more than 80% identity with the DNA sequence defined in (A1) and has the same function.

[0008] The term "identity" as used herein refers to sequence similarity to SEQ ID No. 1. Identity can be assessed by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

[0009] Furthermore, the fim The gene can be introduced into the recipient Shigella in the form of a recombinant vector.

[0010] Exemplarily, in the recombinant vector, the fim The promoter for gene transcription may be an arabinose promoter.

[0011] In one embodiment of the present invention, the recombinant vector is specifically fim The gene was cloned into the expression plasmid pBAD / Myc-HisA between the restriction sites NcoI and HindIII to obtain the recombinant plasmid (named pBAD-Fim).

[0012] Furthermore, the recipient Shigella may be Shigella flexneri.

[0013] In one embodiment of the present invention, the recipient Shigella is Shigella flexneri FWL01. That is, the recombinant Shigella is a strain obtained by introducing the recombinant vector pBAD-Fim into Shigella flexneri FWL01 (named FWL01 (pBAD-Fim)).

[0014] In a second aspect, the present invention claims protection for any of the following biological materials: (B1) As mentioned in the first aspect above fim Gene; (B2) the recombinant vector described in the first aspect above; (B3) containing (B1) fim Gene expression cassette.

[0015] In a third aspect, the present invention claims protection for a set of products.

[0016] The complete set of products claimed in the present invention consists of the biological material described in the second aspect above and the recipient Shigella described in the first aspect above.

[0017] In a fourth aspect, the present invention claims protection for any of the following applications: (C1) Use of the recombinant Shigella described in the first aspect as a live bacterial vaccine carrier; (C2) Use of the recombinant Shigella described in the first aspect above, or the biological material described in the second aspect above, or the complete set of products described in the third aspect above in the preparation of live bacterial vaccine vectors; (C3) Use of the recombinant Shigella described in the first aspect above in stimulating an immune response in an organism; (C4) Use of the recombinant Shigella described in the first aspect above, or the biological material described in the second aspect above, or the complete set of products described in the third aspect above in the preparation of a product for stimulating an immune response in an organism; In the implementation case of the present invention, the application of the recombinant Shigella in stimulating the body's immune response is specifically embodied in that the recombinant Shigella, as a delivery vector, can stimulate the body's immune response to the delivered target antigen.

[0018] (C5) Use of the recombinant Shigella described in the first aspect above for enhancing immune stimulation of macrophages; (C6) Use of the recombinant Shigella described in the first aspect above, or the biological material described in the second aspect above, or the set of products described in the third aspect above in the preparation of a product for enhancing immune stimulation of macrophages; (C7) Use of the biomaterial described in the second aspect above in promoting the expression of pili by recipient Shigella; the recipient Shigella is the recipient Shigella described in the first aspect above; (C8) Use of the biological material described in the second aspect or the set of products described in the third aspect in the preparation of the recombinant Shigella described in the first aspect.

[0019] Furthermore, in (C1) and (C2), the live bacterial vaccine carrier is a mucosal live bacterial vaccine carrier and / or an oral live bacterial vaccine carrier.

[0020] Furthermore, in (C3) and (C4), the immune response may be a mucosal immune response.

[0021] Furthermore, in (C7), the pili are mannose-sensitive pili (i.e., type I pili).

[0022] In one embodiment of the present invention, in (C5) and (C6), the enhanced immune stimulation of macrophages is specifically embodied as: increasing the expression of IL-6 and / or IL-1β in the culture supernatant of macrophages (such as mouse macrophages).

[0023] In a fifth aspect, the present invention claims protection for any of the following methods: Method I: A method for preparing the recombinant Shigella described in the first aspect above, which may include the following steps: introducing the recombinant Shigella described in the first aspect above into the recipient Shigella fim Gene, to obtain the recombinant Shigella.

[0024] Furthermore, the fim The gene can be introduced into the recipient Shigella in the form of the recombinant vector.

[0025] Exemplarily, in the recombinant vector, the fim The promoter for gene transcription may be an arabinose promoter.

[0026] In one embodiment of the present invention, the recombinant vector is specifically fim The gene was cloned into the expression plasmid pBAD / Myc-HisA between the restriction sites NcoI and HindIII to obtain the recombinant plasmid (named pBAD-Fim).

[0027] Furthermore, the recipient Shigella may be Shigella flexneri.

[0028] In an embodiment of the present invention, the recipient Shigella is Shigella flexneri FWL01. That is, the preparation method of the recombinant Shigella is as follows: the recombinant vector pBAD-Fim is introduced into Shigella flexneri FWL01 to obtain the recombinant Shigella.

[0029] Method II: A method for preparing a live bacterial vaccine carrying a target antigen, which may include the following steps (E1) or (E2): (E1) Expressing the target antigen in the recombinant Shigella described in the first aspect above, and the resulting recombinant strain is a live bacterial vaccine carrying the target antigen.

[0030] (E2) introducing the above-mentioned first aspect into the recipient Shigella fim Gene, and express the target antigen in the recipient Shigella, and the obtained recombinant strain is a live bacterial vaccine carrying the target antigen.

[0031] Further, the coding gene of the target antigen and the fim The genes are introduced into the recipient Shigella.

[0032] Furthermore, the coding gene of the target antigen and the fim The gene can be introduced into the recipient Shigella in the form of a recombinant vector.

[0033] In one embodiment of the present invention, the coding gene of the target antigen and the fim The gene is introduced into the recipient Shigella in the form of a recombinant vector. The recombinant vector is specifically cloned between the restriction sites NcoI and HindIII of the expression plasmid pBAD / Myc-HisA. fimgene, and the recombinant plasmid (named pBAD-Fim-trc-napA-His) obtained by inserting "Trc promoter connected to the coding gene of the target antigen" at the restriction site PaeI.

[0034] Wherein, the target antigen is a Shigella heterologous antigen.

[0035] In one embodiment of the present invention, the target antigen is Helicobacter pylori NapA protein (neutrophil activation protein A).

[0036] Wherein, the amino acid sequence of the Helicobacter pylori NapA protein is shown as SEQ ID No.2.

[0037] Accordingly, the coding gene of the Helicobacter pylori NapA protein is shown in positions 1524-1955 of SEQ ID No.3.

[0038] Furthermore, the recipient Shigella may be Shigella flexneri.

[0039] In one embodiment of the present invention, the recipient Shigella is Shigella flexneri FWL01.

[0040] In the sixth aspect, the present invention claims protection for a live bacterial vaccine carrying a target antigen prepared by the method II in the fifth aspect above, such as after the recombinant vector pBAD-Fim-trc-napA-His is introduced into Shigella flexneri FWL01, the recombinant strain is a live bacterial vaccine carrying the target antigen (Helicobacter pylori NapA protein).

[0041] The present invention firstly constructs a plasmid capable of expressing Shigella pili in Shigella flexneri FWL01 (a derivative strain derived from Shigella flexneri vaccine strain 2aT32), then co-expresses neutrophil activation protein A (NapA) antigen in the pili-expressing vaccine strain FWL01 (pBAD-Fim), and finally verifies the humoral and mucosal immune effects of the recombinant vaccine strain in a mouse model. The research content of the present invention shows that the carrier strain FWL01 (pBAD-Fim) with Shigella pili can be used as a mucosal vaccine delivery carrier for the study of oral live bacterial carrier vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 It is a schematic diagram of the sequence of the fused fimbriae fragment (Fim) of the present invention.

[0043] Figure 2 To observe the expression of Shigella pili by electron microscopy.

[0044] Figure 3To detect type I pili by mannose-sensitive guinea pig hemagglutination assay. 1: FWL01 (pBAD-Fim); 2: FWL01; 3: PBS. The first two rows do not contain mannose.

[0045] Figure 4 Verification of IL-6 and IL-1β gene transcription in stimulated mouse macrophage J774A.1. 1: FWL01 (pBAD-Fim); 2: FWL01.

[0046] Figure 5 Detection of IL-6 and IL-1β concentrations in the culture supernatant of mouse macrophages J774A.1 after stimulation. 1: FWL01 (pBAD-Fim); 2: FWL01. ** indicates P < 0.01; **** indicates P < 0.0001.

[0047] Figure 6 This is the plasmid map of the recombinant plasmid pBAD-Fim-trc-napA-His.

[0048] Figure 7 SDS-PAGE analysis of the expression of recombinant protein NapA-His. Lane 1: protein marker; Lane 2: FWL01 bacterial lysate; Lane 3: FWL01 (pTrc99A-napA-His) bacterial lysate; Lane 4: FWL01 (pBAD-Fim-trc-napA-His) bacterial lysate. The red arrow marks the position corresponding to the target protein size, about 18 kDa.

[0049] Figure 8 To analyze the expression of pili by yeast agglutination assay. 1: FWL01 (pBAD-Fim-trc-napA-His); 2: FWL01 (pTrc99A-napA-His); 3: PBS.

[0050] Fig. 9 Immunological evaluation of recombinant bacteria co-expressing Shigella pili and napA fragment. 1: FWL01 (pBAD-Fim-trc-napA-His); 2: FWL01 (pTrc99A-napA-His); 3: PBS. ns indicates no significant difference; * indicates P < 0.05; *** indicates P < 0.001. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0052] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0053] Shigella flexneri FWL01: This strain is preserved in our laboratory and recorded in the paper “Wang, H.; Feng, E.; Lin, Y.; Liao, X.; Jin, M.; Jin, M.; Huang, L.; Su, G.; Huang, C. Construction of a trivalent candidate vaccine against Shigella species with DNA recombination. Science in China 2002, 45, 10-20.” The public can obtain this strain from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0054] Example 1: Construction and verification of Shigella pili expression strain 1. Construction of plasmid pBAD-Fim The genome of Shigella flexneri FWL01 was used as a reference sequence to design synthetic primers, and then the genome of Shigella flexneri FWL01 was used as a template to amplify Fim 1-93aa Fragment, Fim 1365-3836aa Fragments and Fim 4613-8639aa fragments, and the above fragments were separated by fusion PCR. Figure 1 Gene fragments were obtained in the order shown fim (The nucleotide sequence is shown in SEQID No. 1), and then cloned into the expression plasmid pBAD / Myc-HisA by seamless connection to obtain the recombinant plasmid pBAD-Fim.

[0055] Among them, used to amplify Fim -330-93aa The primers for the fragments are as follows (5'-3'): CATG CCATGG TGTTAAGGCATGCTTGCGGTTATG; TTAAAGTGAATGGTCCCACCATTTACCGTCGTAGT.

[0056] For amplification of Fim 1365-3836aa The primers for the fragments are as follows (5'-3'): GGTAAATGGTGGGACCATTCACTTTAAAGGGGAAG; CAATCCGATTCTGTACACTATTTCCGCTGAA.

[0057] For amplification of Fim 4613-8639aa The primers for the fragments are as follows (5'-3'): GGAAATAGTGTACAGAATCGGATTGGGGGTAAC; CGCGTCGACTTATTGATAAACAAAAGTCACG.

[0058] When performing fusion PCR, Fim -330-93aa Fragment, Fim 1365-3836aa Fragments and Fim 4613-8639aa The fragments were mixed as templates and then PCR amplified with primers CATG CCATGG GCAAAATTAAAACTCTGGCAATCGTTGTTC (the underlined part is the recognition sequence of the restriction site NcoI) and CCC AAGCTT TTATTGATAAACAAAAGTCACGCCA (the underline is the recognition sequence of the restriction site HindIII) was amplified by PCR to finally obtain the gene fragment fim (Corresponding to Fim 1-93aa -Fim 1365-3836aa -Fim 4613 -8639aa ).

[0059] Description of the structure of the recombinant plasmid pBAD-Fim: Insert the gene fragment shown in SEQ ID No.1 between the restriction sites NcoI and HindIII of the pBAD / Myc-HisA plasmid fim The resulting recombinant plasmid.

[0060] 2. Construction of recombinant strains expressing fimbriae and qualitative identification of FimH activity The recombinant plasmid pBAD-Fim constructed in step 1 was electroporated into Shigella flexneri FWL01, and the resulting recombinant bacteria was named FWL01 (pBAD-Fim). A single clone of the FWL01 (pBAD-Fim) strain was picked and inoculated into 3 mL of LB medium (containing 100 μg / ml ampicillin) and cultured overnight at 37°C and 220 rpm. At the same time, Shigella flexneri FWL01 was used as a negative control. The above two bacteria were transferred to 5 mL of culture medium at a ratio of 1:100, cultured for 3 hours, and 0.2% arabinose was added for induction. The target protein was induced by shaking and cultured at 37°C and 120 rpm for 4 hours to induce the expression of the target protein.

[0061] Take a certain volume of bacterial solution, centrifuge and collect the bacteria, and perform guinea pig erythrocyte agglutination test and electron microscope observation. The guinea pig erythrocyte agglutination test is as follows: take 12 μl of OD 600nm = 2 or 12 μl PBS (as a control), and then 24 μl 1% guinea pig red blood cells were added and shaken on ice for 20 minutes.

[0062] The results showed that compared with the FWL01 control strain, the FWL01(pBAD-Fim) strain had obvious pili ( Figure 2 ), and showed mannose-sensitive guinea pig hemagglutination reaction ( Figure 3 ), indicating the production of type I pili.

[0063] 3. Immunostimulatory effect of recombinant strains expressing fimbriae on mouse macrophages The induced FWL01 (pBAD-Fim) strain and FWL01 strain in step 2 were used to stimulate mouse macrophages J774A.1 at an MOI of 1:20.

[0064] On the one hand, RNA was extracted from cells 3 hours after stimulation using the Trizol method, and the expression of IL-6 and IL-1β genes was detected by qRT-PCR.

[0065] Among them, the primers used to detect the IL-6 gene are as follows (5'-3'): TTAGCCACTCCTTCTGTGACTCC; ACCCCAATTTCCAATGCTCT.

[0066] The primers used to detect the IL-1β gene are as follows (5'-3'): AGAGCTTCAGGCAGGCAGTAT GAAGGTGCTCATGTCCTCATC.

[0067] The GAPDH gene was used as an internal reference, and the primers were as follows (5'-3'): AGGTTGTCTCCTGCGACTTC; ACTCCTTGGAGGCCATGTAG Adoption 2 -△△CT Quantitative expression levels.

[0068] On the other hand, the contents of IL-6 and IL-1β in the culture supernatant of mouse macrophages after stimulation for 3 hours were detected by ELISA. The kits used were CSB-E04639m-IS and CSB-E08054m-IS, Cusabio, Wuhan, China. For specific operations, please refer to the instructions.

[0069] The results showed that compared with the FWL01 control group, the transcription of IL-6 and IL-1β genes in mouse macrophages stimulated by the FWL01(pBAD-Fim) strain was increased ( Figure 4 ). By ELISA test, the IL-6 and IL-1β in the culture supernatant of mouse macrophages stimulated by FWL01(pBAD-Fim) were 15.6 and 2.5 times that of the FWL01 control group, respectively ( Figure 5 ). The above results indicate that FWL01(pBAD-Fim) can stimulate immune response.

[0070] Example 2: Co-expression of other exogenous proteins in Shigella pilus expression strains 1. Construction of fusion protein expression vector Using the genome of Helicobacter pylori SS1 as a reference sequence, synthetic primers were designed as follows (5'-3'): F: CTAG TCTAGA ATGAAAACATTTGAAATTTT (the underlined part is the recognition sequence of the restriction site XbaI); R:AAA CTGCAG TTAATGATGATGATGATGATGACTACCACCACCGCCAGCTAAATGGGCTTC (the underlined part is the recognition sequence of the restriction site PstI).

[0071] Then, the genome of Helicobacter pylori SS1 was used as a template and the napA-His fragment (sequence: "CTAG TCTAGA + 1524-1991st position of SEQ ID No.3 + CTGCAGTTT"), and then the above fragment was ligated to the pTrc99A plasmid to obtain the recombinant plasmid pTrc99A-napA-His.

[0072] Description of the structure of the recombinant plasmid pTrc99A-napA-His: The recombinant plasmid was obtained by inserting the napA-His fragment shown in positions 1524-1991 of SEQ ID No. 3 between the restriction sites XbaI and PstI of the pTrc99A plasmid.

[0073] Using pTrc99A-napA-His as template, design synthetic primers as follows (5'-3'): F:GAAGCG GCATGC ATTTACGTTGA (the underlined part is the recognition sequence of the restriction site PaeI); R: AGGCACATTATGTTAATGATGATGAT.

[0074] Amplify the trc-napA-His fragment (SEQ ID No. 3). Figure 6 The sequence was ligated into the pBAD-Fim plasmid constructed in Example 1 to obtain the recombinant plasmid pBAD-Fim-trc-napA-His.

[0075] Description of the structure of the recombinant plasmid pBAD-Fim-trc-napA-His: The recombinant plasmid obtained by inserting the trc-napA-His fragment shown in SEQ ID No.3 into the PaeI restriction site of the pBAD-Fim plasmid. Positions 1524-1955 of SEQ ID No.3 are the coding gene of NapA (neutrophil activation protein A), encoding the amino acid sequence shown in SEQ ID No.2.

[0076] 2. Expression of fusion protein in vector strain The recombinant plasmids pBAD-Fim-trc-napA-His and pTrc99A-napA-His constructed in step 1 were respectively electroporated into Shigella flexneri FWL01, and the resulting recombinant strain carrying the pBAD-Fim-trc-napA-His plasmid was named FWL01 (pBAD-Fim-trc-napA-His), and the recombinant strain carrying the pTrc99A-napA-His plasmid was named FWL01 (pTrc99A-napA-His).

[0077] The FWL01(pBAD-Fim-trc-napA-His) strain and the FWL01(pTrc99A-napA-His) strain were selected and inoculated into 3 mL of LB medium (containing 100 μg / ml ampicillin) and cultured overnight at 37°C and 220 rpm. Shigella flexneri FWL01 was used as a negative control. The three bacteria were transferred to 5 mL of culture medium at a ratio of 1:100 and cultured for 3 hours with an OD value of about 0.8. 0.2% arabinose and IPTG were added for induction, and the target protein was induced for 4 hours at 37°C and 220 rpm.

[0078] On the one hand, a certain volume of bacterial liquid was taken, centrifuged to collect the bacterial cells, and then subjected to SDS-PAGE electrophoresis. The results showed that ( Figure 7), compared with Shigella flexneri FWL01, the recombinant bacteria carrying pBAD-Fim-trc-napA-His or pTrc99A-napA-His plasmids were able to express the target protein (i.e., recombinant protein NapA-His).

[0079] On the other hand, a certain volume of bacterial solution was taken to perform a yeast agglutination test. The yeast agglutination test was performed as follows: 12 μl OD 600nm =2 recombinant strain or 12μl PBS (as control), add 24μl of 1% yeast, and shake on ice for 20 minutes. The results show ( Figure 8 ), compared with the FWL01(pTrc99A-napA-His) strain, the FWL01(pBAD-Fim-trc-napA-His) strain expressed pili.

[0080] The above results showed that the exogenous protein NapA and pili were successfully co-expressed in Shigella flexneri FWL01.

[0081] Example 3: Application of Shigella pili expression vector strain FWL01 To further prove that the Shigella pili expression vector strain can be used as an antigen delivery system for corresponding vaccine research, the FWL01 (pBAD-Fim-trc-napA-His) strain and the FWL01 (pTrc99A-napA-His) strain constructed in Example 2 were used to express the target antigen NapA, and the immunogenicity of the antigen was verified by animal experiments. The specific operation is as follows: 1. The recombinant strains FWL01 (pBAD-Fim-trc-napA-His) and FWL01 (pTrc99A-napA-His) obtained in Example 2 were inoculated into 3 mL of LB medium (containing 100 μg / ml ampicillin) and cultured overnight at 37°C and 220 rpm. Then they were transferred to 100 mL of culture medium at a ratio of 1:100 and cultured for 3 hours with an OD value of about 0.8; 0.2% arabinose and IPTG were added and cultured for 4 hours at 37°C and 220 rpm with shaking.

[0082] 2. Collect the bacteria by centrifugation, wash them three times with PBS, and then resuspend them to a certain volume for animal immunization.

[0083] 3. Specific immunization scheme: 6-8 week old BALB / c female mice (N=6 / group) were selected and orally inoculated three times on days 0, 14 and 28. Three groups were immunized, namely: FWL01(pBAD-Fim-trc-napA-His) group, FWL01(pTrc99A-napA-His) group and PBS control group. The single immunization dose of each group is as follows: 10 9 CFU / head, FWL01(pTrc99A-napA-His) group was detected by Image J software and 10 9 CFU FWL01 (pBAD-Fim-trc-napA-His) with the same napA-His expression level; PBS group: 200 μl.

[0084] 4. On the 35th day after immunization, serum and fresh feces samples were collected from all mice, and serum-specific IgG and feces-specific sIgA levels were detected by ELISA. The coated antigen in the ELISA experiment was purified Helicobacter pylori NapA expressed by Escherichia coli. The specific method can be found in the literature (Zhang, X.; Sang, S.; Guan, Q.; Tao, H.; Wang, Y.; Liu, C. Oral administration of aShigella2aT32-Based vaccine expressing UreB-HspA fusion antigen with and without parenteral rUreB-HspA boost confersprotection against Helicobacter pylori in mice model. Front Immunol. 2022, 13 ,894206.) was performed by the standard indirect ELISA method.

[0085] The results of the immune assessment were Fig. 9As shown, compared with the PBS control group, the experimental animals in the FWL01(pBAD-Fim-trc-napA-His) group and the FWL01(pTrc99A-napA-His) group specifically produced IgG antibodies and sIgA antibodies against NapA. Compared with the FWL01(pTrc99A-napA-His) group, the antigen-specific sIgA antibodies in the feces of the FWL01(pBAD-Fim-trc-napA-His) group were significantly increased, indicating that the Shigella pilus expression vector strain FWL01(pBAD-Fim) can achieve effective delivery of the target antigen, stimulate the experimental animals to produce IgG and sIgA responses against the target antigen NapA, and improve the mucosal immune response compared with the FWL01 strain.

[0086] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A recombinant Shigella for introducing into a recipient Shigella fim The strain obtained after the gene; Said fim The gene is any of the following: (A1) DNA molecule shown in SEQ ID No. 1; (A2) A DNA molecule that has more than 80% identity with the DNA sequence defined in (A1) and has the same function.

2. The recombinant Shigella according to claim 1, characterized in that: Said fim The gene is introduced into the recipient Shigella in the form of a recombinant vector.

3. The recombinant Shigella according to claim 2, characterized in that: In the recombinant vector, the fim The promoter of gene transcription is the arabinose promoter.

4. The recombinant Shigella according to any one of claims 1 to 3, characterized in that: The recipient Shigella is Shigella flexneri.

5. The recombinant Shigella according to claim 4, characterized in that: The Shigella flexneri is Shigella flexneri FWL01.

6. Any of the following biological materials: (B1) any one of claims 1 to 5 fim Gene; (B2) the recombinant vector according to any one of claims 1 to 5; (B3) containing (B1) fim Gene expression cassette.

7. A complete set of products, consisting of the biological material according to claim 6 and the recipient Shigella according to any one of claims 1 to 5.

8. Any of the following applications: (C1) Use of the recombinant Shigella according to any one of claims 1 to 5 as a live bacterial vaccine carrier; (C2) Use of the recombinant Shigella according to any one of claims 1 to 5, the biological material according to claim 6, or the complete set of products according to claim 7 in the preparation of live bacterial vaccine carriers; (C3) Use of the recombinant Shigella according to any one of claims 1 to 5 in stimulating an immune response in an organism; (C4) Use of the recombinant Shigella according to any one of claims 1 to 5, the biological material according to claim 6, or the complete set of products according to claim 7 in the preparation of a product for stimulating an immune response in an organism; (C5) Use of the recombinant Shigella according to any one of claims 1 to 5 for enhancing immune stimulation of macrophages; (C6) Use of the recombinant Shigella according to any one of claims 1 to 5, the biological material according to claim 6, or the set of products according to claim 7 in the preparation of a product for enhancing immune stimulation of macrophages; (C7) Use of the biomaterial of claim 6 in promoting the expression of pili by a receptor Shigella; the receptor Shigella is the receptor Shigella described in any one of claims 1 to 5; (C8) Use of the biological material according to claim 6 or the complete set of products according to claim 7 in the preparation of the recombinant Shigella according to any one of claims 1 to 5; Furthermore, in (C1) and (C2), the live bacterial vaccine carrier is a mucosal live bacterial vaccine carrier and / or an oral live bacterial vaccine carrier; and / or Further, in (C3) and (C4), the immune response is a mucosal immune response; Furthermore, in (C7), the pili are mannose-sensitive pili.

9. Either of the following methods: Method I: A method for preparing the recombinant Shigella according to any one of claims 1 to 5, comprising the following steps: introducing the recombinant Shigella according to any one of claims 1 to 5 into the recipient Shigella fim Gene, to obtain the recombinant Shigella; Furthermore, the fim The gene is introduced into the recipient Shigella in the form of a recombinant vector as described in any one of claims 1 to 5; Method II: A method for preparing a live bacterial vaccine carrying a target antigen, comprising the following steps (E1) or (E2): (E1) expressing a target antigen in the recombinant Shigella described in any one of claims 1 to 5, and the resulting recombinant strain is a live bacterial vaccine carrying the target antigen; (E2) Introducing the Shigella according to any one of claims 1 to 5 into the recipient Shigella fim Gene, and express the target antigen in the recipient Shigella, and the obtained recombinant strain is a live bacterial vaccine carrying the target antigen; Furthermore, the coding gene of the target antigen and the fim The genes are introduced into the recipient Shigella; Furthermore, the coding gene of the target antigen and the fim The gene is introduced into the recipient Shigella in the form of a recombinant vector; and / or The target antigen is Helicobacter pylori NapA protein.

10. A live bacterial vaccine carrying a target antigen prepared by method II as described in claim 9.

Images