Nucleic acid aptamer specifically combined with homocysteine and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer specifically combined with homocysteine and application thereof, and belongs to the technical field of molecular biological medicines. The nucleic acid aptamer SEQCR13-2 which is specifically combined with homocysteine is obtained through screening, and the nucleotide sequence of the nucleic acid aptamer SEQCR13-2 is as shown in SEQ ID NO. 1. Through verification, the nucleic acid aptamer SEQCR13-2 has high affinity with homocysteine, the binding dissociation constant (Kd) reaches the nanomole level, and the nucleic acid aptamer SEQCR13-2 has high selectivity, can specifically distinguish homocysteine from cysteine in vitro, has important significance in the aspects of diagnosis and treatment of diseases related to homocysteine and the like, and can be used for preparing the homocysteine. The nucleic acid aptamer SEQCR13-2 can be applied to auxiliary diagnosis of hyperhomocysteinemia and evaluation of cardiovascular disease risk or can be applied to basic research related to occurrence, development and progress of the diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biomedicine, and in particular relates to a nucleic acid aptamer specifically binding to homocysteine ​​and an application thereof. Background Art

[0002] Homocysteine ​​(Hcy), also known as 2-amino-4-mercaptobutyric acid, is an intermediate product in the biosynthesis of methionine and cysteine. The normal reference value of Hcy in the human body is 5-15 μmol / L. Levels above the reference value are often diagnosed as hyperhomocysteinemia. The total homocysteine ​​index in the blood is an important indicator for judging health risks and is beneficial for preventing and controlling the occurrence and development of many chronic diseases. Hyperhomocysteinemia is a hereditary disease caused by enzyme deficiency in the process of methionine metabolism. It is a rare syndrome involving the eye, cardiovascular, bone, and nervous systems. Studies have shown that more than 100 diseases are associated with elevated plasma total homocysteine ​​concentrations, including but not limited to cardiovascular diseases and central nervous system diseases.

[0003] Therefore, timely determination of Hcy content can play a greater role in the auxiliary diagnosis of hyperhomocysteinemia and the prevention of cardiovascular diseases. Hcy has similar characteristics to cysteine ​​(Cys). Cys is an essential amino acid that participates in protein synthesis, detoxification and metabolism. Elevated Cys levels are associated with neurotoxicity, and Cys deficiency is associated with reduced growth rate, hair depigmentation, edema, lethargy, liver damage, muscle and fat loss, skin lesions and weakness. Since Cys and Hcy levels are associated with different diseases, their distinction is necessary. The structural similarity between Cys and Hcy (only one methylene difference) poses a huge challenge to the specific detection of homocysteine.

[0004] Methods for specific detection of homocysteine ​​include enzyme-linked immunosorbent assay, high performance liquid chromatography, mass spectrometry, etc. Among them, enzyme-linked immunosorbent assay mainly converts Hcy into S-adenosylhomocysteine ​​through enzyme reaction, and indirectly determines the content of the sample with anti-S-adenosylhomocysteine ​​antibody, but the antigens and antibodies used are expensive, and the test results have shortcomings such as poor repeatability and high false positives; although high performance liquid chromatography and mass spectrometry have improved the accuracy of detection, the operation is cumbersome, large-scale instruments and equipment are required, the cost is high, and it is not suitable for rapid detection. Although homocysteine ​​nucleic acid aptamers have been screened out, their specificity or detection effect for homocysteine ​​is not ideal in practical applications. Summary of the invention

[0005] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a nucleic acid aptamer that can specifically bind to homocysteine. The aptamer provided by the present invention can simply, rapidly, sensitively and specifically recognize and bind to homocysteine, which is of great significance for the auxiliary diagnosis of hyperhomocysteinemia, cardiovascular disease risk assessment and basic research.

[0006] Technical solution: In order to achieve the above purpose, the nucleic acid aptamer that specifically binds to homocysteine ​​described in the present invention is the nucleic acid aptamer SEQCR13-2, and its nucleotide sequence is as shown in SEQ ID NO.1: 5'-TATAGCAATGGTACGGTACTTCCATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTACAAAAGTGCACGCTACTTTGCTAA-3'.

[0007] The nucleic acid aptamer specifically binding to homocysteine ​​of the present invention has a nucleotide sequence as shown in SEQ ID NO.2: 5'-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3'.

[0008] Wherein, the nucleic acid aptamer is modified with a marker at the 5' end or 3' end of the sequence shown in SEQ ID NO.2.

[0009] Wherein, the marker is a biotin marker, a digoxigenin marker, a fluorescent marker, a nanoluminescent material marker or an enzyme marker.

[0010] Preferably, the nucleic acid aptamer is modified with a FAM group at the 5' end of the sequence shown in SEQ ID NO.2, which is: 5'-FAM-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3' (APT-FAM).

[0011] The nucleic acid aptamer that specifically binds to homocysteine ​​described in the present invention comprises any of the following sequences: 1) a nucleotide sequence that has a homology of more than 80% with the nucleic acid aptamer SEQCR13-2 and can specifically bind to homocysteine; 2) a nucleotide sequence that hybridizes with any one of the nucleotide sequences in the nucleic acid aptamer SEQCR13-2 and can specifically bind to homocysteine; 3) an RNA sequence that is reverse transcribed from any one of the nucleotide sequences in the nucleic acid aptamer SEQCR13-2.

[0012] The nucleic acid aptamer specifically binding to homocysteine ​​of the present invention includes a nucleotide sequence capable of specifically binding to homocysteine ​​obtained by subjecting the nucleotide sequence of the nucleic acid aptamer SEQCR13-2 to phosphate backbone modification, truncation, extension, inversion or chemical modification of the base; or a nucleotide sequence capable of specifically binding to homocysteine ​​obtained by labeling the 5' end or 3' end of the nucleic acid aptamer SEQCR13-2 with a marker.

[0013] The invention discloses an application of the nucleic acid aptamer specifically binding to homocysteine ​​in the preparation of a homocysteine ​​detection reagent or tool.

[0014] Preferably, the nucleic acid aptamer SEQCR13-2, APT-FAM, or a combination of APT-FAM and cDNA-BHQ1 is used in the preparation of a homocysteine ​​detection reagent or tool.

[0015] Among them, APT-FAM is the product of truncating the front and rear primer binding regions of the sequence SEQCR13-2, and the FAM group is modified at the 5' end; the cDNA-BHQ1 sequence is the short complementary chain (cDNA) of the APT-FAM sequence, and the BHQ1 group is modified at the 3' end. Among them, the cDNA-BHQ1 sequence is: 5'-CAGGAGTGGAGCAAATGCCAT-BHQ1-3' (SEQ ID NO.3).

[0016] Furthermore, the present invention is based on the use of nucleic acid aptamers APT-FAM and cDNA-BHQ1 in the preparation of homocysteine ​​detection reagents or tools for detecting homocysteine ​​through fluorescence competition method.

[0017] The invention discloses an application of the nucleic acid aptamer specifically binding to homocysteine ​​in the preparation of a homocysteine ​​diagnostic reagent, a test paper or a biosensor.

[0018] The invention relates to the use of the nucleic acid aptamer specifically binding to homocysteine ​​in the preparation of a reagent or tool for assisting in the diagnosis of hyperhomocysteinemia or evaluating the risk of cardiovascular disease.

[0019] The homocysteine ​​diagnostic reagent, the effective component of the test paper or the biosensor of the present invention comprises the nucleic acid aptamer specifically binding to homocysteine.

[0020] The reagent for assisting in the diagnosis of hyperhomocysteinemia or assessing cardiovascular disease risk of the present invention comprises an effective component of the nucleic acid aptamer specifically binding to homocysteine.

[0021] Preferably, the above reagents include SEQCR13-2, APT-FAM, or APT-FAM and cDNA-BHQ1.

[0022] The present invention uses a regioselective-SELEX screening strategy, takes homocysteine ​​as a screening target, performs multiple rounds of screening, and successfully obtains multiple specific nucleic acid aptamer candidate sequences. It has been verified that the binding of the nucleic acid aptamer SEQCR13-2 to homocysteine ​​has excellent affinity and selectivity, can specifically distinguish homocysteine ​​from cysteine ​​in vitro, and is of great significance in the diagnosis and treatment of Hcy-related diseases. Therefore, the nucleic acid aptamer SEQCR13-2 can be applied to the auxiliary diagnosis of hyperhomocysteinemia and the evaluation of cardiovascular disease risks or in basic research related to the occurrence, development and progression of such diseases.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0024] 1. In the present invention, homocysteine ​​is used as a positive screening target and cysteine ​​is used as a reverse screening target. Based on the regioselective-SELEX technology, a high-affinity homocysteine ​​nucleic acid aptamer SEQCR13-2 is screened for the first time. It is verified that the KD value of SEQCR13-2 for homocysteine ​​is 33±2.74nM, and the affinity for homocysteine ​​is high, which is about 10 times higher than the affinity for cysteine. According to the principle of conformational changes after the aptamer binds to the target, the present invention designs an aptamer-based fluorescence competition detection method, with a detection limit of 10nM for homocysteine ​​and a linear range of 10-25nM, which has good application prospects.

[0025] 2. The nucleic acid aptamer SEQCR13-2 in the present invention has a high affinity for homocysteine. The nucleic acid aptamer SEQCR13-2 can be used as a detection reagent for Hcy in the blood or urine of patients with hyperhomocysteinemia, and can also be used for the prevention and control of cardiovascular diseases. It can also be used for basic research related to the occurrence and development of cardiovascular diseases.

[0026] 3. The nucleic acid aptamer SEQCR13-2 in the present invention can simply, rapidly and sensitively identify and bind to homocysteine, and is suitable for the auxiliary diagnosis of hyperhomocysteinemia and the prevention of cardiovascular diseases, or can be directly used as a drug for auxiliary treatment of patients with related diseases. It has broad clinical application prospects and basic application value.

[0027] 4. The nucleic acid aptamer specifically binding to homocysteine ​​in the present invention can be directly synthesized artificially by biological and chemical methods, with good reproducibility between production batches, low cost and easy storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a monitoring diagram of the binding rate in the screening of nucleic acid aptamers;

[0029] Figure 2 KD value and binding curve of nucleic acid aptamer and homocysteine;

[0030] Figure 3 KD value and binding curve diagram of nucleic acid aptamer and cysteine;

[0031] Figure 4 This is a schematic diagram of the principle of the fluorescence detection method based on nucleic acid aptamers;

[0032] Figure 5 This is a schematic diagram of the homocysteine ​​detection standard curve established based on the nucleic acid aptamer fluorescence detection method;

[0033] Figure 6 Schematic diagram of the selectivity test based on nucleic acid aptamer fluorescence assay. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below in conjunction with the accompanying drawings, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention should be included in the protection scope of the present invention.

[0035] Unless otherwise specified, the materials and reagents used in the examples can be obtained from commercial sources.

[0036] Example 1

[0037] Screening and preparation of nucleic acid aptamers specifically binding to homocysteine

[0038] (1) Construction of initial single-stranded nucleic acid library:

[0039] The two ends of the library are the junctions of the forward primer and the reverse primer. The N in the middle of the library represents a random base in (A\T\G\C), and there are 21 random sites in total. The initial library is: 5'-TATAGCAATGGTACGGTACTTCC-(N21)-TTCACAGGCATCTTCATTACAAAAGTGCACGCTACTTTGCTAA-3' (SEQ ID NO.4).

[0040] Forward primer (FP): 5′- TATAGCAATGGTACGGTACTTCC -3′ (SEQ ID NO. 5);

[0041] Reverse primer (RP): 5′- TTAGCAAAGTAGCGTGCACTTTTG -3′ (SEQ ID NO. 6);

[0042] Biotin-labeled reverse primer: Bio-RP: 5'- Biotin-TTAGCAAAGTAGCGTGCACTTTTG -3', which is the 5' end of SEQ ID NO.6 modified with biotin; the above sequences were purchased from GenScript Biotech Co., Ltd.

[0043] (2) Preparation of experimental solutions

[0044] 2× Binding Buffer (2×HEPES Buffer): 50mM HEPES, 100mM NaCl, 1mM MgCl 2 , 20 mM KCl, 1 mM CaCl 2 , 0.1% Tween-20, adjust pH to 7.4. 1×HEPES Buffer is obtained by diluting 2×HEPES Buffer.

[0045] Coupling buffer solution (0.1M MES Buffer): 976.18 mg of 4-morpholineethanesulfonic acid, add 50 mL of ultrapure water, and adjust the pH to 6.

[0046] Preparation of positive and negative screening target solutions: Add 1 mL 1×HEPES Buffer to 1.35 mg Hcy to obtain a 10 mM Hcy stock solution; add 925 μL 2M HCl solution to 1.12 mg Cys to obtain a 10 mM Cys stock solution. Take 1 μL of each stock solution and add 999 μL 1×HEPES Buffer to prepare a 10 μM solution, store at 20°C for later use.

[0047] 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) solutions (both at a concentration of 10 mg / mL) were prepared using 0.1 M MES Buffer and were prepared before use.

[0048] 10×PBS Buffer: weigh 2 g KCl, 2.4 g KH 2 PO 4 , 36.3 g Na 2 HPO 4 12H 2 O, add 700 mL ultrapure water to 80 g NaCl, dissolve it by ultrasonic and make it up to 1 L. 1× PBS Buffer is made by diluting 10× PBS Buffer.

[0049] Preparation of single-stranded library and primer solution: Centrifuge the library and primer lyophilized powder at 12000rpm for 10min, add the corresponding amount of 1×HEPES Buffer according to the indicated volume to prepare 2μM initial library solution and 10μM primer solution.

[0050] Carboxyl magnetic beads: MCE Company, product number HY-K0225.

[0051] 2×Taq Pro HS Master Mix: Nanjing Novozymes Biotech Co., Ltd., catalog number P112-01.

[0052] Molecular weight standard Marker A (25~500 bp): Shanghai Sangon Biotech Co., Ltd., catalog number B600303.

[0053] Streptavidin agarose microspheres: Yisheng Company, catalog number 20512ES08.

[0054] Chromatography column: BIO-RAD, product number 732-6204.

[0055] (3) Activation of carboxyl magnetic beads

[0056] Take 10μL of carboxyl magnetic beads in an EP tube, centrifuge, and remove the supernatant by magnetic separation. Add 200μL of MESBuffer to the EP tube, wash the magnetic beads, centrifuge, remove the supernatant by magnetic separation, and repeat the washing twice. After washing, add 100μL of freshly prepared 10mg / mL EDC and NHS solutions to the EP tube respectively, and activate at room temperature for 1h.

[0057] (4) Library heat treatment

[0058] Dilute the ss DNA library in 500 μL of binding buffer (50 mM HEPES, 100 mM NaCl, 1 mM MgCl). 2 , 20mM KCl , 1mM CaCl 2 , 0.1% Tween-20, pH 7.4). Heat at 95°C for 10 min, cool rapidly on ice, keep for 5 min, and then place at room temperature for 5 min.

[0059] (5) Target binding to single-stranded library

[0060] 1) Positive screening

[0061] The initial library after heat treatment in step (4) was added to the magnetic bead solution activated in step (3) (excess magnetic beads), mixed and incubated at room temperature for 30 minutes, centrifuged, and magnetic separation was performed to collect the supernatant. A certain amount of Hcy (see Table 1) was added to the supernatant, incubated at room temperature for 1 hour, and then transferred to the newly activated magnetic bead solution, mixed and incubated at room temperature for 30 minutes, and magnetic separation was performed to discard the supernatant. The aptamer binding to Hcy was captured on the magnetic beads, 120 μL HEPES Buffer was added, heated at 95°C for 20 minutes, and the supernatant was collected, 20 μL of which was retained, and the rest was used for PCR amplification. The subsequent steps (6)-(8) were performed and repeated for 7 rounds (R1-R8).

[0062] 2) Reverse screening

[0063] Take a certain amount of Cys (see Table 1) and add it to the library after heat treatment in step (4) (library in round R8 screening), incubate at room temperature for 30 minutes, add it to the activated magnetic bead solution, mix and incubate at room temperature for 30 minutes, centrifuge, and collect the supernatant by magnetic separation. Add a certain amount of Hcy (see Table 1) to the supernatant, incubate at room temperature for 1 hour, transfer it to the newly activated magnetic bead solution, mix and incubate at room temperature for 30 minutes, and magnetically separate and discard the supernatant. The aptamer binding to Hcy is captured on the magnetic beads, add 120μL HEPES Buffer, heat at 95℃ for 20 minutes, collect the supernatant while it is hot, and keep 20μL of it as the template in step (9), and the rest is used for PCR amplification. Follow the subsequent steps (6)-(8) and repeat for another 4 rounds (CR9-CR13). Table 1 contains the targets and library feed amounts in 13 rounds of screening, where R1 represents the first round of positive screening, CR9 represents the ninth round of reverse screening, and so on.

[0064] Table 1 Feeding amount for forward and reverse screening

[0065]

[0066] (6) PCR amplification

[0067] Prepare 2 μL 10 μM FP; 2 μL 10 μM Bio-RP; 5 μL ssDNA-containing supernatant after screening in step (5); 25 μL 2× Taq Pro HS Master Mix; 16 μL ddH 2 O PCR solution system, take 5 μL of the supernatant containing ssDNA after each round of screening in step (5) and perform small-scale PCR amplification according to the instructions of 2×Taq Pro HS Master Mix reagent.

[0068] (7) Gel electrophoresis monitoring and screening process

[0069] 6 μL DNA molecular weight standard Marker A, 3 μL blank solution of 1×HEPES Buffer in step (2), and small-scale PCR product in step (6) were characterized by electrophoresis on 8% non-denaturing polyacrylamide gel, and the electrophoresis voltage was set to 120 V and the electrophoresis time was set to 25 min. The gel was stained with nucleic acid dye to image the blank solution and the small-scale PCR product in step (6). The clear bands obtained by the small-scale PCR product were monitored, and large-scale PCR was subsequently performed according to the 2×Taq Pro HSMaster Mix reagent instructions based on the number of PCR amplification cycles.

[0070] (8) Preparation of ssDNA

[0071] Place 200 μL of streptavidin agarose microspheres in the chromatography column, let stand for 5-10 minutes, wash 3 times with 1×PBS Buffer, combine and mix the double-stranded strands amplified in step (7) and add them to the chromatography column for fixation, add the effluent to the chromatography column again, repeat 5 times, and then wash 10 times with 200 μL 1×PBS Buffer. Add 400 μL 0.2M NaOH to the chromatography column for elution, collect the effluent, adjust the pH to neutral with HCl, concentrate by ultrafiltration to 100 μL, determine the concentration using Nano Drop-100, and store at -20°C as the library for the next round of screening.

[0072] (9) qPCR monitoring of enrichment

[0073] Prepare 0.2 μL 10 μM FP; 0.2 μL 10 μM RP; 1 μL template solution obtained in step (5); 5 μL Sybrgreen; 3.6 μL ddH 2 O qPCR solution system. Prepare the library calibration curve. Take the initial single-stranded library and dilute it with ultrapure water to prepare a series of concentrations. Take 1 μL for amplification according to the qPCR solution system. Draw the calibration curve with Ct value as the vertical axis and the logarithm of the series concentration (logC) as the horizontal axis. Take the supernatant retained after each round of screening as the template liquid for amplification. Calculate the amount of eluted ssDNA according to the calibration curve. Calculate the binding percentage by dividing the amount of eluted DNA by the amount of Hcy input to detect the binding rate of each round of enriched library. The results are shown in Figure 1 As shown in the figure, as the number of screening rounds increased, the library showed obvious enrichment in the 10th round and then the enrichment level tended to be stable.

[0074] (10) High-throughput analysis of enriched libraries

[0075] In the whole screening process, starting from the 9th round, the library was reversely screened, and the counter-screening object was cysteine. The binding rate results showed that the enrichment of the library was further improved, and the enriched libraries in the 10th and 13th rounds were subjected to high-throughput sequencing to determine the candidate nucleic acid aptamer sequences. The results of high-throughput sequencing showed that the total number of sequences was 119415 and 122178, respectively, containing 90050 and 32855 unique sequences. The data of high-throughput sequencing showed that the richness of the sequences in the 13th round was greatly reduced, and a high degree of enrichment had been achieved, so it was determined as the end point of the screening. The sequencing results of the 13th round were analyzed, and the sequences with the highest peak density were selected as candidate sequences.

[0076] In this embodiment, nucleic acid aptamer sequences are screened by systematic evolution of ligands by exponential enrichment (SELEX), specifically using homocysteine ​​as a positive screening target and cysteine ​​as a counter-screening target. After multiple rounds of repeated incubation, elution, amplification, and single-stranded preparation, multiple nucleic acid aptamer sequences are screened. By performing sequence alignment and homology analysis on these nucleic acid aptamer sequences, candidate nucleic acid aptamer sequences are determined and specificity and affinity are verified.

[0077] The specificity and affinity were determined by isothermal calorimetric titration technology to evaluate the binding ability of candidate nucleic acid aptamers to homocysteine ​​and cysteine. Among them, the nucleotide sequence of nucleic acid aptamer SEQCR13-2 is as shown in SEQ ID NO.1: 5'-TATAGCAATGGTACGGTACTTCCATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTACAAAAGTGCACGCTACTTTGCTAA-3', and the FAM group was modified at the 5' end after truncating the primer binding sites at both ends to obtain the APT-FAM sequence: 5'-FAM-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3'. Using 1×HEPES Buffer as the buffer solvent, the target Hcy and anti-target Cys solutions were diluted to 200μM, and the aptamer APT-FAM was prepared to 10μM. The Hcy and Cys solutions were respectively drawn with a titration needle, and the solution containing the candidate aptamer APT-FAM in the sample pool was titrated at 25°C. The data was analyzed by Microcal PEAQ ITC software, and the equilibrium dissociation constant (KD) of the candidate aptamer with Hcy or Cys was fitted. The test results are shown in Figure 2 and Figure 3 shown. Figure 2 It can be seen that the KD value of the aptamer for homocysteine ​​is 33±2.74nM. Figure 3 It can be seen that the KD value of the aptamer for cysteine ​​is 322±72.83nM. According to the KD value results, the affinity of the aptamer for homocysteine ​​is better than that of the reported homocysteine ​​aptamer, and it has excellent binding ability to Hcy, and the difference with cysteine ​​is nearly 10 times, which can specifically distinguish Hcy from Cys.

[0078] Example 2

[0079] Establishment of a fluorescence detection method for Hcy based on nucleic acid aptamers

[0080] (1) Sequence modifications include: APT-FAM sequence: 5'-FAM-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3'; cDNA-BHQ1 sequence: 5'-CAGGAGTGGAGCAAATGCCAT-BHQ1-3'; APT-FAM is the product of truncated primer binding regions before and after the sequence SEQ ID NO.1, and the FAM group is modified at the 5' end; the cDNA-BHQ1 sequence is the short complementary chain (cDNA) of the APT-FAM sequence, and the BHQ1 group is modified at the 3' end.

[0081] The above sequences were purchased from GenScript Biotech Co., Ltd.

[0082] (2) Preparation of experimental solution

[0083] Binding buffer: 20 mM Tris-HCl (pH 7.5), 50 mM NaCl (analytical grade), 0.5 mM MgCl 2 (Analytical grade), prepared with ultrapure water.

[0084] APT-FAM solution: Take 1 nmol APT-FAM and add 100 μL binding buffer, and dilute it to 250 nM solution using binding buffer as solvent.

[0085] cDNA-BHQ1 solution: Take 1 nmol of cDNA-BHQ1 and add 100 μL of binding buffer, and dilute it to a 250 nM solution using binding buffer as solvent.

[0086] Hcy solution: dilute the Hcy stock solution to a 50 μM working solution.

[0087] (3) Fluorescence detection method based on nucleic acid aptamers

[0088] Different concentrations of Hcy solution (final concentration range 10nM-1.5μM), nucleic acid aptamer APT-FAM with FAM label at 5' end and complementary DNA with BHQ1 label at 3' end (cDNA-BHQ1) were mixed in 20 mM Tris-HCl (pH7.5), 50 mM NaCl and 0.5 mM MgCl 2 The final concentration of APT-FAM was 25 nM, and the final concentration of cDNA-BHQ1 was 100 nM. All sample solutions were incubated at 25°C for 1 h. The sample solution (30 μL) was transferred to the wells of a 384-well non-binding microplate. The fluorescence intensity was measured using an ELISA reader (SpectraMaxi3x multi-function ELISA reader, Molecular Devices, USA) at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. Each group of samples was measured three times in parallel and the average value was taken. The detection principle is as follows Figure 4 As shown. Where F0 represents the fluorescence intensity of APT-FAM, F1 represents the fluorescence intensity of APT-FAM and cDNA-BHQ1, and F2 represents the fluorescence intensity of APT-FAM, cDNA-BHQ1 and Hcy solution. The fluorescence recovery rate is expressed as F2 / F1. The quenching efficiency is calculated as (1-F1 / F0) × 100%.

[0089] Test results such as Figure 5 As shown in the figure, with the increase of homocysteine ​​concentration, the fluorescence intensity of the system showed regular changes. The detection method showed excellent sensitivity, and the detection limit of the nucleic acid aptamer SEQCR13-2 for Hcy was 10nM. In the concentration range of 10-25 nM, the fluorescence intensity showed a good linear relationship with the homocysteine ​​concentration, and the linear regression equation was y = 16x + 6382 (R 2 = 0.9947).

[0090] (4) Selectivity of aptamer-based fluorescence detection method

[0091] In order to confirm the selectivity of the fluorescence detection method based on the aptamer structure conversion, several other amino acids including Cys were tested, including alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), methionine (Met), phenylalanine (Phe), asparagine (Asn), glutamine (Gln), threonine (Thr), glutamic acid (Glu), lysine (Lys), arginine (Arg) and histidine (His). The blank sample was a solution containing 25 nM APT-FAM and 100 nM cDNA-BHQ1. The concentration of all tested amino acids was 5 μM, and the test method was the same as the above step (3). Figure 6 As shown, when Hcy is present, obvious fluorescence intensity is observed, while other amino acids do not cause obvious fluorescence intensity changes compared with the blank sample. The results show that the difference between Hcy and Cys signals in this method is more than 4 times, and it has excellent selectivity for Hcy.

[0092] Comparative Example 1

[0093] The existing patent CN116879370A discloses a nucleic acid aptamer: 5'-SH-(CH 2 )6-ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3′ (SEQ ID NO. 7), which has a sequence similarity of 52.04% with the nucleic acid aptamer SEQCR13-2 of the present invention. The electrochemical aptamer sensor for homocysteine ​​detection constructed therefrom has a detection limit of 0.112 μM for homocysteine, and it is difficult to specifically distinguish homocysteine ​​from cysteine.

[0094] Comparative Example 2

[0095] The existing document Development of a DNA aptamer for direct and selective homocysteine ​​detection in human serum, Rsc Advances, 2013, discloses a nucleic acid aptamer: 5'-ATACCAGCTTATTCAATTACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATTCAAAAGTGCACGCTACTTTGCTAA-3' (SEQ ID NO.8), which has a sequence similarity of 57.98% with the nucleic acid aptamer SEQCR13-2 of the present invention, has a detection limit of 0.5 μM for homocysteine, a KD value of 0.6 ± 0.3 μM, and a detection signal enhancement comparison of Hcy and Cys of less than 4 times.

[0096] The detection effect of the nucleic acid aptamers in comparative documents 1 and 2 on Hcy is obviously inferior to that of the nucleic acid aptamer SEQCR13-2 provided by the present invention.

[0097] In summary, the nucleic acid aptamer SEQCR13-2 provided by the present invention exhibits strong specific binding ability to Hcy, and the detection method established based on the aptamer has excellent sensitivity for Hcy detection, and can specifically distinguish Hcy from its structural analog Cys. The aptamer of the present invention can be used as a specific detection reagent for Hcy in the blood or urine of patients with hyperhomocysteinemia, and can also be used for the prevention and control of cardiovascular diseases, nervous system diseases, etc.

Claims

1. A nucleic acid aptamer that specifically binds to homocysteine, characterized in that: The nucleic acid aptamer is nucleic acid aptamer SEQCR13-2, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A nucleic acid aptamer that specifically binds to homocysteine, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.

2.

3. The nucleic acid aptamer that specifically binds to homocysteine ​​according to claim 2, characterized in that: The nucleic acid aptamer is modified with a marker at the 5' end or the 3' end of the sequence shown in SEQ ID NO.

2.

4. The nucleic acid aptamer that specifically binds to homocysteine ​​according to claim 3, characterized in that: The marker is a biotin marker, a digoxigenin marker, a fluorescent marker, a nanoluminescent material marker or an enzyme marker.

5. The nucleic acid aptamer that specifically binds to homocysteine ​​according to claim 3, characterized in that: The nucleic acid aptamer is modified with a FAM group at the 5' end of the sequence shown in SEQ ID NO.

2.

6. Use of the nucleic acid aptamer that specifically binds to homocysteine ​​according to any one of claims 1 to 5 in the preparation of a homocysteine ​​detection reagent or tool.

7. Use of the nucleic acid aptamer that specifically binds to homocysteine ​​according to any one of claims 1 to 5 in the preparation of a homocysteine ​​diagnostic reagent, a test paper or a biosensor.

8. Use of the nucleic acid aptamer that specifically binds to homocysteine ​​according to any one of claims 1 to 5 in the preparation of a reagent or tool for assisting in the diagnosis of hyperhomocysteinemia or assessing the risk of cardiovascular disease.

9. A homocysteine ​​diagnostic reagent, test paper or biosensor, characterized in that: The homocysteine ​​diagnostic reagent, the active ingredient of the test paper or the biosensor comprises the nucleic acid aptamer specifically binding to homocysteine ​​according to any one of claims 1 to 5.

10. A reagent for assisting in the diagnosis of hyperhomocysteinemia or evaluating the risk of cardiovascular disease, characterized in that: The active ingredient of the reagent includes the nucleic acid aptamer specifically binding to homocysteine ​​according to any one of claims 1 to 5.

Images