Application of transcription factor CwbHLH27 in regulating and controlling content of sesquiterpenoids in curcuma wenyujin
By regulating the expression of the transcription factor CwbHLH27, the problem of low sesquiterpene compounds in Wenyuli was solved, and the effect of increasing or reducing its content was achieved, providing technical support for improving Wenyuli's quality.
Patent Information
- Application Number
- CN202510023251.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-07
- Publication Date
- 2025-05-13
AI Technical Summary
The low content of sesquiterpene compounds in Wentulips leads to high prices of drugs, and it is difficult for existing chemical synthesis and biosynthesis methods to achieve industrial production.
By overexpressing or silencing the transcription factor CwbHLH27, the accumulation of sesquiterpenes in the turlipid is regulated, and its content is increased or decreased.
Through the overexpression or silencing of CwbHLH27, the content of sesquiterpene in warm turbid is significantly increased or reduced, providing technical means to improve warm turbid quality.
Smart Images
Figure CN119979558A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of medicinal plant gene engineering, and in particular to application of transcription factor CwbHLH27 in regulating the content of sesquiterpene compounds in Curcuma aromatica. Background Art
[0002] Curcuma wenyujin (YHChen et C.Ling), a plant of the genus Curcuma in the Zingiberaceae family, is produced in Ruian, Wenzhou, Zhejiang Province. It is the source plant of the Chinese medicinal materials Curcuma zedoaria, Curcuma aromatica and Curcuma longa. Modern pharmacological studies have shown that Curcuma wenyujin has multiple pharmacological activities such as anti-tumor, antioxidant, antiviral, antibacterial, liver protection and anti-inflammatory.
[0003] Curcuma wenyujin is rich in volatile oils and has diverse chemical components. So far, 196 chemical components have been isolated and identified from Curcuma wenyujin, which can be divided into sesquiterpenes, monoterpenes, diterpenes, curcuminoids, polysaccharides, alkaloids, organic acids and various nutrients according to their structural types. Among them, sesquiterpenes account for the majority and are the main active ingredients (Li Xingchen et al. Research progress on chemical components, pharmacological effects, clinical applications of Curcuma wenyujin and prediction analysis of its quality markers. Chinese Journal of Traditional Chinese Medicine, 2023, 48(20): 5419-5437).
[0004] Germaine-type sesquiterpenes and their derivatives, including elemene, curzerene and curdione, are important active ingredients of Curcuma aromatica. Among them, elemene oral emulsion and elemene emulsion injection, which use elemene as the main raw material, have been widely used in the treatment of various cancers in clinic. However, the content of elemene in Curcuma aromatica is very low, accounting for only 4-10‰ of the dry weight, which makes the price of the drug high. At present, chemical synthesis and biosynthesis methods cannot realize the industrial production of elemene, and extraction and separation from Curcuma aromatica plants is still the only way to obtain elemene-related drug raw materials. Therefore, the discovery of a group of genes that can regulate the biosynthesis of the active ingredients of Curcuma aromatica will provide a molecular basis for the cultivation of high-quality new varieties of Curcuma aromatica using genetic engineering technology.
[0005] Reference (Zhang Kailun. Research progress on bHLH transcription factors regulating biosynthesis of terpenoids in medicinal plants. Modern Chinese Medicine, 2017, 19(01): 142-147) discloses that bHLH transcription factors can regulate the biosynthesis of plant terpenoids. Among them, MYC transcription factors are the most isolated and most thoroughly studied bHLH transcription factors, which have been proven to be involved in the regulation of sesquiterpenoid biosynthesis genes in plants such as Arabidopsis and Artemisia annua. Arabidopsis MYC2 transcription factor can bind to the promoter region of TPS21 and TPS11 synthase genes that catalyze the formation of sesquiterpenes, activate their expression, and increase the release of sesquiterpenes mainly composed of (E)-β-caryophyllene. Overexpression of AabHLH1 in Artemisia annua leaves can strongly activate the expression of key enzyme genes ADS and CYP71AV1 in the synthesis pathway of sesquiterpenoid compound artemisinin.
[0006] Therefore, developing a transcription factor involved in the positive regulation of the synthesis of sesquiterpenoid compounds in Curcuma aromatica is of great significance for improving the quality of Curcuma aromatica. Summary of the invention
[0007] In order to solve the above technical problems, the present invention provides the use of transcription factor CwbHLH27 in regulating the content of sesquiterpenoid compounds in Curcuma aromatica. Overexpression or silencing of CwbHLH27 can regulate the accumulation of sesquiterpenoid compounds in Curcuma aromatica.
[0008] The application of transcription factor CwbHLH27 in regulating the content of sesquiterpenoid compounds in Curcuma aromatica. The nucleotide sequence of CwbHLH27 is shown in SEQ ID No.1.
[0009] The present invention uses the transcriptome data of Curcuma aromatica treated with MeJA to identify and analyze CwbHLH family genes, screens out the CwbHLH27 gene, and further proves that overexpression of CwbHLH27 can promote the accumulation of Curcuma aromatica sesquiterpenoid compounds β-elemene, γ-elemene, β-caryophyllene, and curcumene, and silencing CwbHLH27 can reduce the accumulation of Curcuma aromatica sesquiterpenes; it can be used for genetic breeding to obtain high-quality Curcuma aromatica medicinal material varieties with high active ingredients, providing a favorable technology for improving the quality of Curcuma aromatica.
[0010] Preferably, the amino acid sequence of the transcription factor CwbHLH27 is shown as SEQ ID No.2.
[0011] Preferably, the sesquiterpene compound is β-elemene, γ-elemene, β-caryophyllene, and curcumene.
[0012] Preferably, the method for regulating the content of sesquiterpene compounds in Curcuma aromatica is:
[0013] (1) By overexpressing the CwbHLH27 gene, the content of sesquiterpenoid compounds in Curcuma aromatica was increased;
[0014] (2) By silencing the CwbHLH27 gene, the content of sesquiterpenoid compounds in Curcuma aromatica was reduced.
[0015] Preferably, the method for overexpressing the CwbHLH27 gene is: inserting the coding sequence of the transcription factor CwbHLH27 into a plant binary expression vector, constructing an overexpression vector, transforming the overexpression vector into Agrobacterium GV3101 to obtain an overexpressed recombinant GV3101 strain, and transferring the overexpressed recombinant GV3101 strain into Curcuma aromatica leaves by an infiltration method.
[0016] Further preferably, the method for constructing the overexpression vector comprises the following steps:
[0017] (1) Using the cDNA of Curcuma wenyujin as a template, PCR amplification was performed using the overexpressed recombinant primer set to obtain the gene of the transcription factor CwbHLH27;
[0018] (2) Connecting the transcription factor CwbHLH27 gene obtained in step (1) to the plant binary expression vector pBI121-GUS to obtain the overexpression vector pBI121-CwbHLH27-GUS.
[0019] More preferably, the sequences of the overexpression recombination primer set are shown as SEQ ID No.5 and SEQ ID No.6.
[0020] Preferably, the method for silencing the CwbHLH27 gene is: inserting a homologous interference fragment of the CwbHLH27 gene into the virus-induced gene silencing (VIGS) vector pTRV2 to construct a silencing expression vector, transforming the silencing expression vector into Agrobacterium GV3101 to obtain a recombinant GV3101 strain with silent expression, and transferring the recombinant GV3101 strain with silent expression into Curcuma aromatica leaves by the immersion method.
[0021] Further preferably, the method for constructing the silencing expression vector comprises the following steps:
[0022] (1) Using the cDNA of Curcuma wenyujin as a template, PCR amplification was performed using a primer set for silent expression to obtain a homologous interference fragment of the CwbHLH27 gene;
[0023] (2) Connecting the CwbHLH27 gene interference fragment obtained in step (1) with the virus-induced gene silencing vector pTRV2 to obtain the silencing expression vector pTRV2-CwbHLH27.
[0024] More preferably, the sequences of the primer set for silent expression are shown as SEQ ID No.7 and SEQ ID No.8.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] The coding sequence of the transcription factor CwbHLH27 provided by the present invention is combined with the plant binary expression vector pBI121-GUS to construct an overexpression vector, which can be expressed in Curcuma aromatica leaves to promote the accumulation of sesquiterpene compounds; the homologous interference fragment of the CwbHLH27 gene is combined with the VIGS vector pTRV2 to construct a silencing expression vector, which can reduce the accumulation of sesquiterpene compounds. Therefore, the Curcuma aromatica CwbHLH27 gene plays an important role in regulating the content of sesquiterpene compounds in Curcuma aromatica, enriches the regulation theory of sesquiterpene biosynthesis in Curcuma aromatica, and can also be used for genetic breeding to obtain Curcuma aromatica varieties with high sesquiterpene compound content. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Agarose gel electrophoresis of the PCR product of cloning CwbHLH27.
[0028] Figure 2 These are GUS staining images of Curcuma australis leaves, where A is the leaf infected with Agrobacterium GV3101, which is the negative control group; B is the leaf infected with Agrobacterium GV3101 containing the empty expression plasmid pBI121-GUS, which is the positive control group; C is the leaf infected with Agrobacterium GV3101 containing the recombinant expression plasmid pBI121-CwbHLH27-GUS, which is the experimental group.
[0029] Figure 3 This is a statistical graph of the relative expression level of CwbHLH27 in the leaves of Curcuma aromatica after overexpression of CwbHLH27 in Example 1, wherein EV is a leaf group containing an empty expression plasmid pBI121-GUS, which is the control group; bHLH27-OE is a leaf group containing a recombinant expression plasmid pBI121-CwbHLH27-GUS, which is the experimental group.
[0030] Figure 4 This is a statistical graph of the relative expression level of CwbHLH27 in Curcuma aromatica leaves after silencing the expression of CwbHLH27 in Example 2, wherein pTRV2 is a leaf group containing an empty expression plasmid pTRV2, which is the control group; pTRV2-bHLH27 is a leaf group containing a silent expression plasmid pTRV2-CwbHLH27, which is the experimental group.
[0031] Figure 5The figure shows the relative content of sesquiterpenoid compounds in the leaves of Curcuma aromatica with overexpression of CwbHLH27, where from left to right they are β-elemene, γ-elemene, curcumene and β-caryophyllene. EV is the leaf group containing the empty expression plasmid pBI121-GUS, which is the control group; bHLH27-OE is the leaf group containing the recombinant expression plasmid pBI121-CwbHLH27-GUS, which is the experimental group.
[0032] Figure 6 This is a graph showing the relative content of sesquiterpene compounds in the leaves of Curcuma aromatica with silent expression of CwbHLH27, where from left to right they are β-elemene, γ-elemene, curcumene and β-caryophyllene. pTRV2 is the leaf group containing the empty expression plasmid pTRV2, which is the control group; pTRV2-bHLH27 is the leaf group containing the silent expression plasmid pTRV2-CwbHLH27, which is the experimental group. DETAILED DESCRIPTION
[0033] The present invention will be further described in detail below in conjunction with the examples, but the embodiments of the present invention are not limited to the following examples.
[0034] The raw materials used in the present invention are all commercially available.
[0035] The present invention provides a cloning method for Curcuma australis CwbHLH27: using the full-length sequence of Curcuma australis CwbHLH27 as a template, PCR amplification is performed, and the cloning primers (synthesized by Youkang Biotechnology) are as follows:
[0036] Forward primer (5′-3′) (SEQ ID No. 3): CGGAGGGCGTTCGCATACTT;
[0037] Reverse primer (5'-3') (SEQ ID No. 4): GCAGCCTTCTTATGGTTGACTTT.
[0038] The PCR reaction system was: 2×Phanta Max Master Mix 25 μL, forward primer 2 μL, reverse primer 2 μL, Curcuma australis cDNA template <400 ng, and ddH2O was added to 50 μL.
[0039] The PCR reaction conditions were as follows: pre-deformation at 95°C for 3 min; denaturation at 95°C for 15 s, extension at 60°C for 15 s, and extension at 72°C for 2 min. After 35 cycles, the DNA was extended at 72°C for another 5 min and stored at 4°C.
[0040] The PCR products were detected by 1% agarose gel electrophoresis. Figure 1As shown, the product size is 1000 bp, which is similar to the full length of the target gene (1079 bp). The full length of the Wenyujin CwbHLH27 gene was obtained by sequencing, including the open reading frame.
[0041] Example 1: Construction of CwbHLH27 overexpression vector
[0042] (1) Preparation of linearized vector: The plant binary expression vector pBI121-GUS (purchased from Coollab Technology Co., Ltd.) was digested with BamHI endonuclease and the linearized vector was recovered from agarose gel.
[0043] (2) Preparation of insert fragment: Using the CwbHLH27 gene sequence as a template, design recombination primers, perform PCR cloning, and recover the ORF gene fragment of CwbHLH27 using agarose gel. The recombination primers (synthesized by Youkang Biotechnology) are as follows:
[0044] Forward primer (5'-3') (SEQ ID No.5):
[0045] AGAACACGGGGGACTCTAGA ATGCCGCTTTTGTGCCCTTC
[0046] Reverse primer (5'-3') (SEQ ID No.6):
[0047] ATAAGGGACTGACCACCCGG TATTTCCACTTGGCATCGTG;
[0048] The recombination reaction system is: 2 ng of insert fragment, 300 ng of linearized vector, 4 μL of 5×CE II Buffer, 2 μL of Exnase II, and ddH2O to make up to 20 μL.
[0049] (3) Take 10 μL of the ligation product and transform it into E. coli DH5α cells. Pick a single clone for PCR detection and sequencing. Select the positive single clone and extract the recombinant overexpression plasmid pBI121-CwbHLH27-GUS and save it.
[0050] (4) The overexpression plasmid pBI121-CwbHLH27-GUS and the empty expression plasmid pBI121-GUS were transformed into Agrobacterium GV3101, respectively. The recombinant GV3101 strains were inoculated into 30 mL YEB medium (containing Kan and Str) and cultured at 28°C and 200 rpm for 8-12 h until the bacterial solution OD 600 When the density reaches 0.8, centrifuge at 4000 rpm for 10 min, discard the supernatant, resuspend the cells with an equal volume of 1 / 2MS (containing 10 mM MES, 200 μM AS and 10 mM MgCl2) resuspension buffer, and let stand for 3 to 5 h in the dark.
[0051] (5) Infection of Curcuma australis leaves: Take leaves from the same seedling, cut off the main veins and the edge parts, and the left and right halves of the leaves are the control group and the experimental group respectively. Use a knife to make wounds on the leaves to make it easier for Agrobacterium to infect; immerse the leaves in a container containing Agrobacterium and place them in a transfer decolorization shaker, shake at 10 rpm for 10 min, and vacuum at 0.09 MPa for 10 min; wash the leaves twice with sterile water, dry them with filter paper, place the leaves on 1 / 2MS culture medium (containing 100 μM AS), and culture them in the dark in an incubator for 3 days; after the culture is completed, wash the leaves twice with sterile water and dry them with filter paper for standby use.
[0052] GUS histochemical staining: First, soak the leaves in GUS staining solution and keep them at 37°C overnight. Then use 70% ethanol to decolorize the leaves to remove chlorophyll. The GUS enzyme expressed in the leaves can decompose the substrate in the staining solution and show blue. Therefore, the leaves show blue, such as Figure 2 As shown, it was shown that the CwbHLH27 gene fused with GUS was successfully expressed.
[0053] Example 2: Construction of CwbHLH27 silencing expression vector
[0054] (1) Preparation of linearized vector: The virus-induced gene silencing (VIGS) vector pTRV2 (purchased from Coollab Technology Co., Ltd.) was digested with BamHI endonuclease and the linearized vector was recovered by agarose gel.
[0055] (2) Preparation of insert fragments: Using the CwbHLH27 gene sequence as a template, design recombinant primers, perform PCR cloning, and recover the specific gene fragment of CwbHLH27 using agarose gel. The recombinant primers (synthesized by Youkang Biotechnology) are as follows:
[0056] Forward primer (5'-3') (SEQ ID No.7):
[0057] CTTAGATTCTGTGAGTAAGGTTACC ATGCCGCTTTTGTGCCCTTC GCG
[0058] Reverse primer (5'-3') (SEQ ID No.8):
[0059] CATGGAGGCCTTCTAGA CTGGCCACCGCCGCCAGT;
[0060] The recombination reaction system is: 2 ng of insert fragment, 300 ng of linearized vector, 4 μL of 5×CE II Buffer, 2 μL of Exnase II, and ddH2O to make up to 20 μL.
[0061] (3) Take 10 μL of the ligation product and transform it into E. coli DH5α cells, pick a single clone for PCR detection and sequencing, select the positive single clone, and extract the recombinant silent expression plasmid pTRV2-bHLH27 and save it.
[0062] (4) The silent expression plasmid pTRV2-CwbHLH27, the empty expression plasmid pTRV2, and the co-transformation plasmid pTRV1 were transformed into Agrobacterium GV3101, respectively. The recombinant GV3101 strains were inoculated into 30 mL YEB medium (containing Kan and Str) and cultured at 28°C and 200 rpm for 8 to 12 h until the bacterial solution OD 600 Reach 0.8; centrifuge at 4000rpm for 10min, and discard the supernatant. Resuspend the cells with an equal volume of 1 / 2MS (containing 10mM MES, 200μM AS and 10mM MgCl2) resuspension solution, and keep it in the dark for 3-5h. Mix the Agrobacterium GV3101 resuspension containing pTRV2 and the GV3101 resuspension containing the co-transformation plasmid pTRV1 in equal volumes as the control group, and mix the Agrobacterium GV3101 resuspension containing pTRV1 and pTRV2-CwbHLH27 in equal volumes as the test group.
[0063] (5) Infection of Curcuma australis leaves: Take leaves from the same seedling, cut off the main veins and the edge parts, and the left and right halves of the leaves are the control group and the experimental group respectively. Use a knife to make wounds on the leaves to make it easier for Agrobacterium to infect; immerse the leaves in a container containing Agrobacterium and place them in a transfer decolorization shaker, shake at 10 rpm for 10 min, and vacuum at 0.09 MPa for 10 min; wash the leaves twice with sterile water, dry them with filter paper, place the leaves on 1 / 2MS culture medium (containing 100 μM AS), and culture them in the dark in an incubator for 3 days; after the culture is completed, wash the leaves twice with sterile water and dry them with filter paper for standby use.
[0064] Sample Analysis:
[0065] 1. Detection of the expression level of CwbHLH27 using fluorescent quantitative PCR
[0066] Take half of the transformed Curcuma longifolia leaves (Example 1 and Example 2) respectively, extract total RNA, reverse transcribe to obtain cDNA, as a detection template. According to the CwbHLH27 template, the fluorescent quantitative PCR primers (synthesized by Youkang Biotechnology) are designed as follows:
[0067] Table 1: Primers for fluorescent quantitative PCR
[0068]
[0069] PCR reaction system: 2×ChamQ Universal SYBR qPCR Master Mix 5 μL, various groups of forward primers 0.4 μL, various groups of reverse primers 0.4 μL, template cDNA 0.8 μL, ddH2O supplemented to 3.4 μL.
[0070] PCR reaction conditions: denaturation at 95°C for 1 min; denaturation at 95°C for 5 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, and 44 cycles.
[0071] Pass 2 -△△Ct The relative expression levels of CwbHLH27 gene in the leaves of overexpressed and silenced Curcuma longifolia were calculated by the method. Figure 3 and Figure 4 As shown, leaves of Curcuma aromatica with overexpression or silenced expression of CwbHLH27 were successfully obtained.
[0072] 2. Analysis of the content of sesquiterpenoid compounds
[0073] Here are the steps:
[0074] (1) Extraction of sesquiterpenoid compounds from Curcuma australis: After successfully overexpressing and silencing the leaves of Curcuma australis, freeze them at -80°C for 1 day, and then freeze-dry them for 24 hours using a freeze dryer. Accurately weigh 10 mg of freeze-dried leaf powder and place it in a glass test tube with a lid. Add 4 mL of n-hexane for extraction. After shaking and extracting at 10 rpm for 12 hours, ultrasonic extraction was performed for another hour. Collect 1 mL of the supernatant, filter it with a 0.45 μm filter membrane, and store it at 4°C for later use.
[0075] (2) GC-MS detection of samples: The chromatographic column is HP-5, the carrier gas is nitrogen, the carrier gas flow rate is 3 mL / min, the injection port temperature is 260°C, the injection volume is 1 μL, and the sample is not split. The detection procedure is as follows: the initial temperature is 50°C and maintained for 4 min, then the temperature is increased to 140°C at a rate of 40°C / min and maintained for 2 min, then the temperature is increased to 260°C at a rate of 20°C / min and maintained for 1 min, then the temperature is increased to 300°C at a rate of 40°C / min and maintained for 1 min.
[0076] (3) Standard curve drawing: The standard curve was prepared by the external standard method.
[0077] Take the standard samples of β-elemene, γ-elemene, β-caryophyllene, and curcumene, dilute each standard sample into different concentration gradients, and use the same method as the experimental sample detection to detect the different concentrations of the standard samples. According to the peak area and the concentration of the standard sample, a standard curve is made to obtain a univariate linear regression equation.
[0078] (4) According to the linear regression equation and the peak area obtained by GC-MS analysis of the samples, the contents of β-elemene, γ-elemene, β-caryophyllene and curcumene in the samples were calculated, and the relative contents were calculated compared with those of the control group (Curcuma longifolia leaves infected with the empty expression plasmid), as shown in the following table: Figure 5 and 6 shown.
[0079] Figure 5 This is a graph showing the relative content of sesquiterpene compounds in the leaves of Curcuma australis with overexpression of CwbHLH27. As shown in the figure, after overexpression of CwbHLH27, the contents of β-elemene, γ-elemene, β-caryophyllene and curcumene in the leaves of Curcuma australis were higher than those in the control group (plasmid pBI121-GUS).
[0080] Figure 6 This is a graph showing the relative content of sesquiterpene compounds in the leaves of Curcuma aromatica with silenced expression of CwbHLH27. As shown in the figure, after silencing expression of CwbHLH27, the contents of β-elemene, γ-elemene, β-caryophyllene and curcumene in the leaves of Curcuma aromatica were lower than those in the control group (plasmid pTRV2).
[0081] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. The application of transcription factor CwbHLH27 in regulating the content of sesquiterpenoid compounds in Curcuma aromatica, characterized in that: The nucleotide sequence of CwbHLH27 is shown in SEQ ID No.
1.
2. The use according to claim 1, characterized in that: The amino acid sequence of the transcription factor CwbHLH27 is shown in SEQ ID No.
2.
3. The use according to claim 1, characterized in that: The sesquiterpene compounds are beta-elemene, gamma-elemene, beta-caryophyllene and curcumene.
4. The use according to claim 1, characterized in that: The method for regulating the content of sesquiterpenoid compounds in Curcuma aromatica is: (1) By overexpressing the CwbHLH27 gene, the content of sesquiterpenoid compounds in Curcuma aromatica was increased; (2) By silencing the CwbHLH27 gene, the content of sesquiterpenoid compounds in Curcuma aromatica was reduced.
5. The use according to claim 4, characterized in that: The method for overexpressing the CwbHLH27 gene is as follows: inserting the coding sequence of the transcription factor CwbHLH27 into a plant binary expression vector, constructing an overexpression vector, transforming the overexpression vector into Agrobacterium GV3101 to obtain an overexpressed recombinant GV3101 strain, and transferring the overexpressed recombinant GV3101 strain into Curcuma aromatica leaves by an infiltration method.
6. The use according to claim 5, characterized in that: The method for constructing the overexpression vector comprises the following steps: (1) Using the cDNA of Curcuma wenyujin as a template, PCR amplification was performed using the overexpressed recombinant primer set to obtain the gene of the transcription factor CwbHLH27; (2) Connecting the transcription factor CwbHLH27 gene obtained in step (1) to the plant binary expression vector pBI121-GUS to obtain the overexpression vector pBI121-CwbHLH27-GUS.
7. The use according to claim 5, characterized in that: The sequences of the overexpression recombination primer set are shown in SEQ ID No.5 and SEQ ID No.
6.
8. The use according to claim 4, characterized in that: The method for silencing the CwbHLH27 gene is as follows: inserting a homologous interference fragment of the CwbHLH27 gene into a virus-induced gene silencing vector pTRV2 to construct a silencing expression vector, transforming the silencing expression vector into Agrobacterium GV3101 to obtain a silencing expression recombinant GV3101 strain, and transferring the silencing expression recombinant GV3101 strain into Curcuma aromatica leaves by an infiltration method.
9. The use according to claim 4, characterized in that: The method for constructing the silencing expression vector comprises the following steps: (1) Using the cDNA of Curcuma wenyujin as a template, PCR amplification was performed using a recombinant primer set with silent expression to obtain a homologous interference fragment of the CwbHLH27 gene; (2) Connecting the CwbHLH27 gene interference fragment obtained in step (1) with the virus-induced gene silencing vector pTRV2 to obtain the silencing expression vector pTRV2-CwbHLH27.
10. The use according to claim 9, characterized in that: The silent expression recombination primer set is shown in SEQ ID No.7 and SEQ ID No.8.