Application of rice GIF4 gene in regulating grain filling and grain weight

By cloning and overexpressing the rice GIF4 gene, and then transforming rice using a recombinant expression vector, the problem of grain filling regulation was solved, and grain weight and yield were increased.

CN119979562BActive Publication Date: 2026-04-17NANJING AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2025-02-28
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Few genes affecting rice grain filling have been discovered and studied in existing technologies, making it difficult to effectively improve grain weight regulation.

Method used

By cloning and overexpressing the rice GIF4 gene, a recombinant expression vector was constructed using a strong promoter and transformed into rice plants to enhance the expression of the GIF4 gene and promote grain filling.

Benefits of technology

It improved rice grain weight and yield, and achieved effective control of grain filling.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979562B_ABST
    Figure CN119979562B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering and relates to a rice grain-filling regulatory gene GIF4 and its applications. The cDNA sequence of the rice GIF4 gene is shown in SEQ ID NO.1, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.2. This invention discloses the rice GIF4 gene and the protein sequence it encodes. Overexpression of the rice GIF4 gene can significantly promote rice grain filling and increase grain weight, indicating that this gene has the potential to be introduced into rice varieties as a target gene to improve rice grain filling characteristics and help increase rice grain yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to a rice gene GIF4 and its application in regulating rice grain filling and grain weight. Background Technology

[0002] Rice grain shape and grain filling both influence grain weight. Many genes affecting rice grain shape have been identified and cloned, but genes affecting grain filling are still relatively few to be discovered and studied. TGW6 is a quantitative trait locus related to rice grain weight, encoding indoleacetic acid-glucose hydrolase. It affects the transformation of the endosperm from the syncytial to the cellular stage by controlling the auxin content in the endosperm; its loss of function promotes grain filling, thus affecting grain weight. The grain filling rate-related locus GFR1 encodes a membrane protein that interacts with the small subunit of ribulose diphosphate carboxylase, influencing grain weight through its participation in the Calvin cycle. By studying the grain incomplete filling (GIF) mutant, two genes positively regulating grain filling, GIF1 and GIF2, were identified. GIF1 encodes the cell wall invertase OsCIN2, which participates in the unloading of sucrose from the endosperm tissue in the early stages of grain filling; GIF2 encodes the large subunit of ADP-glucose pyrophosphorylase, OsAGPL2, which catalyzes the production of the starch precursor ADP-glucose. Another grain filling defect mutant, Ospho1;2, was studied, and it was found that the plasma membrane phosphorus transporter OsPHO1;2 affects the activity of ADP-glucose pyrophosphorylase through grain phosphorus homeostasis, thereby regulating grain starch synthesis.

[0003] Discovering genes that regulate rice grain filling is of great significance for promoting rice grain filling and improving rice yield and quality. Summary of the Invention

[0004] This invention reveals that the rice GIF4 gene encodes a functionally unknown protein containing DUF4408 and DUF761 domains. Mutants of this protein exhibit decreased grain filling rate, leading to reduced grain weight. However, overexpression of GIF4 significantly increases grain weight, which is of great importance for improving rice yield.

[0005] The first object of the present invention is to provide a rice GIF4 gene, the cDNA nucleotide sequence of which is shown in SEQ ID NO.1:

[0006] ATGCTGGAGGCCGTGATCCCGGCGGTGTGGAGCGCCGTCCACGGGTGGTTCACCCCCGCGGTGCTCTTCCTCGTCCTCAACATCGTCATCGGCACCATCGCGGTTACTTCCAAGGTCACCGCCTCCTCCTCGACGGCGGGCGGCGGCGGCGAGGGGGTTGGGTATGGAGCGTGGGCGGGTGGTGGTGGTGGTGGTGGAGGGGAGCAGAGGAGGTTCTCCCGCGTGCCGTCCATG GCGCTCGACCGGCTCCGGTCGTTTAATCTCTCCGGCCGGTTCTCCGCAGCCGCCTCTGCCCCTGCTGCTCCCGAGGCGGCCGCGGTGGTGGGCGGGGTGCTGGATCTGGGCGCCCGCGATGAGGCGACGACGGCGGCGGTGGTGAAGGATGTGGGGGGCGGGAGAGAGCGCGAGGAGGAGGTGGAGGATGAGCAGGAGCGCGCGCAGGCGGCGCATGTGGTGGAGAGGAGCAAGTCGGAGGCGACGGCGGCGGCGGCGGACCTCCCGCGGCTGCCGGCGCGGCTGCGCAAGTCGGCCAGCGACCAGTCGGCGTTCGCGCACTTCGAGGCCGAGAAGAAGGCGGCGGCGGCGGAGGTGGAACGCGAGGCGGTGGAGGCGCGGCGCCCCGCGACGACGAGGGAGCCGCCGCGCGTGTGGCTCCGCGTGGCCGACGAGGACCCGGAGCCGGAGGAGTTCGACGACGAGGCGGATGATGATGAGCCGGAGATGGACGACGACGACGCCGACGTCGGCGCCGGCGAGGTGGACGCGCGCGCCGACGACTTCATCAACAACTTCCGCCACCAGCTCAAGCTGCAGCGCATCGACTCCTACCTCCGCCACCGCGACATGCTCCGCCGCGGCCACGCCGCCGCCGCCGCCGCCGCGGTGGGCAGCGACTTGTGA

[0007] The second object of the present invention is to provide the encoded protein of the aforementioned rice GIF4 gene, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2:

[0008] MLEAVIPAVWSAVHGWFTPAVLFLVLNIVIGTIAVTSKVTASSSTAGGGGEGVGYGAWAGGGGGGGGEQRRFSRVPSMALDRLRSFNLSGRFSAAASAPAAPEAAAVVGGVLDLGARDEATTAAVVKDVGGGREREEEVEDEQERAQAAH VVERSKSEATAAAADLPRLPARLRKSASDQSAFAHFEAEKKAAAAEVEREAVEARRPATTREPPRVWLRVADEDPEPEEFDDEADDDEPEMDDDDADVGAGEVDARADDFINNFRHQLKLQRIDSYLRHRDMLRRGHAAAAAAAVGSDL*

[0009] A third objective of this invention is to provide a recombinant expression vector and expression cassette containing the aforementioned rice GIF4 gene.

[0010] In the process of cultivating fast-filling rice varieties using the rice GIF4 gene described above through genetic engineering, the GIF4 gene of this invention is usually used as the target gene to construct a plant expression vector, and then the recombinant expression vector containing the gene is transformed into the target rice variety.

[0011] Plant expression vectors are constructed using the GIF4 gene of this invention as the target gene. Any strongly expressed promoter can be used, such as the cauliflower mosaic virus (CaMV) 35S promoter, Ubiquitin promoter, or Actin promoter. The expression vector may include enhancers, whether transcriptional or translational, if necessary. Selective markers can be used to simplify the identification of transformants, including antibiotic-resistant enzymes, or enzymes that recognize compounds by color changes (e.g., β-glucuronidase GUS) or luminescence (e.g., luciferase). The expression vectors used can be Ti plasmids, Ri plasmids, plant virus vectors, etc. Transformation methods can include Agrobacterium-mediated transformation, gene gun transformation, or other methods to transform rice plants.

[0012] In a particular embodiment, the recombinant expression vector for the rice GIF4 gene is formed by ligating the cDNA sequence of the GIF4 gene between the restriction endonuclease sites KpnⅠ and BamHI of the expression vector pCAMBIA1300s.

[0013] A fourth objective of this invention is to provide or contain recombinant bacteria of the aforementioned rice GIF4 gene.

[0014] The fifth objective of this invention is to provide primers for amplifying the aforementioned rice GIF4 gene.

[0015] Furthermore, the primers are primers P1 and P2 for amplifying the full-length cDNA of the GIF4 gene, or primers P3 and P4 for amplifying the complete coding reading frame of the GIF4 gene; the nucleotide sequences of P1 and P2 are shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of P3 and P4 are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0016] SEQ ID NO.3: ATGCTGGAGGCCGTGATCCCGGC;

[0017] SEQ ID NO. 4: TCACAAGTCGCTGCCCACCGCGG.

[0018] SEQ ID NO.5: CTTTCGCGAGCTCGGTACCATGCTGGAGGCCGTGATCCCGGC;

[0019] SEQ ID NO. 6: AGGTCGACTCTAGAGGATCCTCACAAGTCGCTGCCCACCGCG.

[0020] The sixth object of the present invention is to provide the application of the aforementioned rice GIF4 gene, or the aforementioned encoded protein, or the aforementioned recombinant expression vector, expression cassette, or the aforementioned recombinant bacteria, or the aforementioned primers in regulating rice grain filling and / or rice grain weight.

[0021] Furthermore, overexpression of the rice GIF4 gene can promote grain filling and / or increase rice grain weight.

[0022] Furthermore, increasing the expression level of the aforementioned encoded proteins in rice, or introducing the aforementioned recombinant expression vectors or expression cassettes into rice, or introducing the aforementioned recombinant bacteria into rice can promote grain filling and / or increase rice grain weight.

[0023] Furthermore, mutation or knockout of the rice GIF4 gene can slow down rice grain filling and / or reduce rice grain weight.

[0024] Furthermore, reducing the expression levels of the aforementioned encoded proteins in rice can slow down grain filling and / or reduce rice grain weight.

[0025] The application includes the following steps:

[0026] 1) Cloning of the rice GIF4 gene:

[0027] Primers P1 and P2 were designed at both ends of the full-length cDNA of the GIF4 gene. PCR amplification was performed on rice cDNA, and the PCR product was ligated into the pEASY-T1 Blunt vector. After sequencing verification, the cDNA sequence vector of the GIF4 gene was obtained.

[0028] 2) Construction of plant expression vectors:

[0029] Primers P3 and P4 were designed to encode the complete reading frame of the GIF4 gene, and restriction endonuclease sites KpnⅠ and BamHI were introduced. Using P3 and P4 as primers, the cDNA sequence vector of the GIF4 gene described in 1) was amplified by PCR. The PCR product was ligated into the expression vector pCAMBIA1300s and sequenced to verify the results, thus obtaining the plant expression vector of the GIF4 gene.

[0030] 3) Transform the expression vector into rice, screen plants with high GIF4 expression, and obtain homozygous lines with GIF4 overexpression through propagation and generation.

[0031] Beneficial effects

[0032] This invention provides the rice grain filling regulatory gene GIF4 and its encoded protein sequence. The rice GIF4 gene is reported for the first time in rice. Enhancing the expression of the GIF4 gene can promote grain filling and increase grain weight. Therefore, GIF4 holds promise as a target gene that can be introduced into rice varieties via a strong promoter to genetically improve grain filling and thus increase grain yield. Attached Figure Description

[0033] Figure 1 Mutation status of the GIF4 knockout line (A), appearance of caryopsis during the grain-filling stage (B), grain filling rate (C), thousand-grain weight and thousand-grain quantity of brown rice (D), relative starch and protein content (E). Scale bar is 5 mm, ** indicates P<0.01.

[0034] Figure 2 Grain appearance (A) and thousand-grain weight of grains and brown rice of transgenic lines overexpressing GIF4 (B). Scale bar is 5 mm, ** indicates P<0.01. Detailed Implementation

[0035] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0036] Example 1: Gene Cloning

[0037] (a) Extraction of total RNA:

[0038] Germinated seeds of the japonica rice variety Zhonghua 11 were selected, frozen in liquid nitrogen, and stored at -80℃. A portion of the sample was ground in a mortar and pestle, transferred into a 1.5 mL EP tube containing Trizol lysis buffer, shaken thoroughly, and total RNA was extracted. The quality of total RNA was identified by electrophoresis.

[0039] (II) Cloning of the rice GIF4 gene:

[0040] Primers P1 and P2 were designed to terminate the full-length cDNA of the GIF4 gene. The primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4. The total RNA obtained in step (I) was reverse transcribed to synthesize the first strand of cDNA. Using this as a template, and with P1 and P2 as primers, PCR amplification was performed using a high-fidelity enzyme. The PCR program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 20 sec, 56℃ annealing for 20 sec, 72℃ extension for 30 sec, 35 cycles, followed by a 72℃ extension for 5 min, and then ligation into the pEASY-T1 Blunt vector. The cDNA sequence of GIF4 was obtained by sequencing by Nanjing Sipujin Company, SEQ ID NO.1.

[0041] Example 2: Construction of GIF4 Knockout Mutant

[0042] (a) Identification of mutation targets:

[0043] Log in to http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen for GIF4 gene editing targets. Select two 19bp specific targets in exon 2 and exon 3. The corresponding target sequences are: sgRNA1 is CTGGAGGCCGTGATCCCGG (SEQ ID NO.7) and sgRNA2 is TGGGCGGGGTGCTGGATCT (SEQ ID NO.8). Four specific primers were designed for the specific targets of the two selected target fragments. The primer sequences are: AATATGGTCTCAGGCGCTGGAGGCCGTGATCCCGG (SEQ ID NO.9), GCTGGAGGCCGTGATCCCGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.10), AGATCCAGCACCCCGCCCACGCTTCTTGGTGCC (SEQ ID NO.11), and ATTATTGGTCTCTAAACAGATCCAGCACCCCGCCCA (SEQ ID NO.12).

[0044] Using the pCBC-MT1T2 vector as a template, PCR amplification was performed with four primers. The amplification products were purified and recovered, and the mutant target sequence of the GIF4 gene was cloned.

[0045] (II) Enzyme digestion and ligation reaction system:

[0046] Enzyme digestion and ligation reaction system: Target mutant DNA fragment, 2 μL; pBUE411 vector, 2 μL; 10x T4 Buffer, 1.5 μL; 10x BSA, 1.5 μL; BsaⅠ, 1 μL; T4 Ligase, 1 μL; ddH2O, 6 μL. Reaction program: 37℃, 5 hours; 50℃, 5 minutes; 80℃, 10 minutes.

[0047] (III) Creation of mutant lines:

[0048] Using the enzyme digestion and ligation system described in (II), the target sequence sgRNA of the GIF4 gene was ligated into the pHUE411 vector. The resulting vector was transformed into Agrobacterium, and the Agrobacterium carrying the transformation plasmid was used to transform callus tissue of the japonica rice variety Zhonghua 11 via Agrobacterium-mediated rice transgenic technology. Based on the target fragment sequences of two specific target sites of the GIF4 gene, PCR verification primers CATTCCCATCACCACACCTCTCA (SEQ ID NO.13) and...

[0049] ACTTGCTCCTCTCCACCACATGC (SEQ ID NO.14) was used to amplify the GIF4 target sequence in the mutant and perform sequencing. Homozygous mutant plants were then screened. Finally, mutant lines gif4-1, gif4-2, and gif4-3 were obtained. The mutation status of the GIF4 gene in these mutants is shown in the attached figure. Figure 1 As shown.

[0050] (iv) Seed phenotype of mutant lines:

[0051] Grain-related phenotypes of wild-type, gif4-1, gif4-2, and gif4-3 mutant lines were measured.

[0052] As stated in the appendix Figure 1 As shown, compared to the wild type, the grain-filling rate of the three mutant lines was significantly reduced during the grain-filling stage; the thousand-grain weight of the grains at maturity was significantly reduced, and the thousand-grain weight of brown rice was also significantly reduced; the relative total starch content of the grains was significantly reduced, but the relative protein content of the grains was significantly increased. This indicates that the rice GIF4 gene positively regulates grain filling and grain weight, while the mutant GIF4 gene negatively affects rice grain filling and grain weight.

[0053] Example 3 GIF4 Construction of overexpression lines

[0054] (I) Construction of plant expression vectors:

[0055] Based on the cDNA sequence of the rice GIF4 gene (SEQ ID NO.1), primers were designed to amplify the complete coding reading frame. Restriction endonuclease sites KpnⅠ and BamHI were introduced into the upstream primer P3 and downstream primer P4. The primer sequences P3 and P4 are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. Using the vector obtained in Example 1 (II) as a template, and with primers P3 and P4, PCR amplification was performed. The cDNA of the GIF4 gene was then ligated into the expression vector pCAMBIA1300s using recombination. Sequencing confirmed the correct reading frame of the coding region in the expression vector, resulting in the overexpression vector pCAMBIA1300s-GIF4.

[0056] (II) Creation of overexpression lines:

[0057] The expression vector pCAMBIA1300s-GIF4 obtained in step (I) was transformed into Agrobacterium, and then further transformed into the rice variety Zhonghua 11. The expression level of the GIF4 gene in the obtained transgenic plants was verified by real-time qPCR, and plants with high GIF4 expression were selected. Through propagation and multiple generations, homozygous lines GIF4-OE-1 and GIF4-OE-2 with GIF4 overexpression were obtained.

[0058] (III) Grain phenotype of overexpression lines:

[0059] Grain-related phenotypes of wild-type, GIF4-OE-1, and GIF4-OE-2 overexpressing lines were measured. (See attached diagram.) Figure 2 As shown, compared to the wild type, the thousand-grain weight of mature rice was significantly increased in both overexpression lines, and the thousand-grain weight of brown rice was also significantly increased. This indicates that overexpressing GIF4 to upregulate its expression level can increase rice grain weight.

[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A rice plant GIF4 gene or a rice plant GIF4 application of a protein encoded by the gene in regulating grain filling and / or increasing grain weight of the rice plant GIF4 cDNA nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the protein is shown as SEQ ID NO. 2; overexpression of the rice plant GIF4 gene, or increasing the expression amount of the protein in the rice plant can promote grain filling and / or increase grain weight of the rice plant; Mutation or knockout of the rice GIF4 Reducing the expression of the gene, or lowering the expression level of the protein in rice, can slow down grain filling and / or reduce grain weight.

2. The application according to claim 1, characterized in that, The application includes the following steps: 1) Rice GIF4 Gene cloning: design GIF4 Primers P1 and P2 at both ends of the full-length cDNA of the gene were used to amplify the rice cDNA by PCR, and the PCR product was ligated into the pEASY-T1 Blunt vector. After sequencing verification, the following was obtained. GIF4 cDNA sequence vector of a gene; 2) Construction of plant expression vectors: design GIF4 Primers P3 and P4, which define the complete coding reading frame of the gene, introduce restriction endonuclease sites. Kpn I and BamH Ⅰ; Using P3 and P4 as primers, the mixture described in 1) GIF4 The cDNA sequence of the gene was amplified by PCR, the PCR product was ligated into the expression vector pCAMBIA1300s, and sequenced for verification. GIF4 Plant expression vectors for genes; 3) Transform the expression vector into rice and screen for its effects. GIF4 Plants with high expression levels, after propagation and multiple generations, obtained GIF4 Homozygous lines that overexpress; The nucleotide sequences of primers P1 and P2 are shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of primers P3 and P4 are shown in SEQ ID NO.5 and SEQ ID NO.6.

Citation Information

Patent Citations

  • Methods and compositions for modulating alkaloids in tobacco

    CN119948047A