Application of tomato lncRNA-PEL8 in improving 2-phenylethanol content of fruit
By identifying and overexpressing lncRNA-PEL8 through GWAS, the problem of reduced 2-phenylethanol content during tomato domestication was solved, resulting in improved tomato fruit flavor and revealing the molecular mechanism of 2-phenylethanol synthesis and regulation.
Patent Information
- Application Number
- CN202510102212.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-01-22
AI Technical Summary
In existing technologies, the content of 2-phenylethanol is significantly reduced during the domestication of tomatoes, affecting the flavor of tomatoes, and the specific mechanism of lncRNA in regulating the metabolic pathway of 2-phenylethanol is unclear.
Genome-wide association analysis (GWAS) was used to identify tomato fruit metabolite-related lncRNAs, especially lncRNA-PEL8. Overexpression of lncRNA-PEL8 was used to increase the 2-phenylethanol content in tomato fruit, and genetic regulation was carried out by combining recombinant vector and recombinant bacteria technology.
A novel pathway related to the regulation of 2-phenylethanol content was rapidly and effectively identified, enriching the network of 2-phenylethanol synthesis and regulation, revealing the molecular mechanism of changes in 2-phenylethanol content during tomato evolution, and improving the flavor of tomato fruit.
Smart Images

Figure CN119979592B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, molecular biology and physiology, in particular to the application of lncRNA-PEL8 in improving the content of 2-phenylethanol in tomato fruits. BACKGROUND
[0002] 2-phenylethanol as an important volatile flavor compound, gives tomato a unique sweet and sweet characteristic, its content is significantly reduced in the domestication process, which is an important factor affecting the flavor of modern tomato.
[0003] Tomato is the most valuable vegetable / fruit in the world, it is the main model system for studying the ripening and flavor of fleshy fruits, involving many metabolic processes. In addition, with the in-depth study of tomato flavor quality, it is found that the domestication process significantly affects the flavor characteristics of tomato. In the process of domestication of tomato from wild species to modern cultivated varieties, although the yield and fruit size are improved, the diversity and concentration of flavor substances are significantly reduced. With the completion of tomato genome sequencing and fine assembly, it is of great significance to study the important traits of tomato yield and quality through biotechnology and genetic engineering means.
[0004] Long non-coding RNA (lncRNA) is a non-coding RNA with a length of more than 200 nucleotides. lncRNAs are considered to be important regulators of protein-coding gene expression, translation and function, which are involved in regulating biological processes such as signal transduction, organ / tissue differentiation and development, and responses to biological and non-biological stresses. Studies have shown that lncRNAs can be involved in the regulation of plant secondary metabolites by interacting with transcription factors, target genes or small RNA. However, the specific mechanism of lncRNA in regulating the 2-phenylethanol metabolic pathway has not been clearly defined. It is of great significance to study the potential role of lncRNA in the regulation of 2-phenylethanol metabolism and the molecular mechanism of its change in 2-phenylethanol content during domestication, which provides a new research direction for improving the flavor of tomatoes. The lncRNA MdLNC610 in apples can promote the release of ethylene and the accumulation of anthocyanins in apples by regulating the ethylene biosynthesis gene MdACO1, enhancing the promoter activity of MdACO1 and increasing the expression level. In addition, the identification of lncRNAs in the whole genome of melon found that lncRNAs (LNC_000987, LNC_000693, LNC_001323, LNC_003610 and LNC_003380) may have important regulatory effects on respiration and fruit ripening. However, the specific mechanism of lncRNA in regulating the 2-phenylethanol metabolic pathway has not been clearly defined. It is of great significance to study the potential role of lncRNA in the regulation of 2-phenylethanol metabolism and the molecular mechanism of its change in 2-phenylethanol content during domestication, which provides a new research direction for improving the flavor of tomatoes. SUMMARY
[0005] In view of the problems of the prior art, the purpose of the present application is to provide the application of tomato lncRNA-PEL8 in improving the content of 2-phenylethanol in fruits. The present application identifies 450 lncRNAs related to the content of metabolites in tomato fruits through genome-wide association analysis (GWAS). Based on the commonly used co-localization method in population genetics theory, the present application can more effectively identify genetic regulatory sites related to fruit flavor by combining mGWAs with lncRNA-eQTL, thereby identifying the major regulatory element lncRNA-PEL8 of 2-phenylethanol. The study of the domestication history of long non-coding RNA lncRNA-PEL8 not only helps to study more efficient genetic regulation of 2-phenylethanol accumulation, but also further understands the evolution rules and regulation mechanisms of plant aromatic synthesis metabolism. Overexpression of lncRNA-PEL8 obtains high 2-phenylethanol tomato fruits, which provides a theoretical basis for the synthesis and molecular assisted breeding of 2-phenylethanol in tomatoes, and has important significance for the research of high-quality tomato breeding and the improvement of tomato cultivation environment.
[0006] The technical scheme adopted by the present application to solve its technical problems is:
[0007] In a first aspect, the present application protects the application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in increasing the content of 2-phenylethanol in tomato fruits.
[0008] The coding sequence of lncRNA-PEL8 is shown in SEQ ID NO: 1.
[0009] In a second aspect, the present application protects the application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in preparing a product for increasing the content of 2-phenylethanol in tomato fruits.
[0010] In a third aspect, the application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in cultivating tomato fruits with high 2-phenylethanol content.
[0011] In a fourth aspect, the present application protects the application of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in the breeding of tomatoes with high 2-phenylethanol content.
[0012] In a fifth aspect, the present application protects the application of a recombinant bacterium containing lncRNA-PEL8 in increasing the content of 2-phenylethanol in tomato fruits.
[0013] In a sixth aspect, the present application protects the application of a recombinant bacterium containing lncRNA-PEL8 in preparing a product for increasing the content of 2-phenylethanol in tomato fruits.
[0014] In a seventh aspect, the present application protects the application of a recombinant bacterium containing lncRNA-PEL8 in cultivating tomato fruits with high 2-phenylethanol content.
[0015] In an eighth aspect, the present application also protects the application of a recombinant bacterium containing lncRNA-PEL8 in the breeding of tomatoes with high 2-phenylethanol content.
[0016] In a ninth aspect, the present application provides a method for increasing the content of 2-phenylethanol in tomato fruits, which is achieved by increasing the expression amount of lncRNA-PEL8 in the target plant.
[0017] In a specific embodiment, the method is achieved by introducing a recombinant vector containing lncRNA-PEL8 into the target plant.
[0018] Advantages
[0019] The application provides application of the tomato lncRNA-PEL8 in improving 2-phenylethanol content of fruits.
[0020] (1) The application discloses that the content of flavor metabolites in a natural population of tomatoes is rich in variation, thereby providing a material basis for breeding of tomato flavor quality.
[0021] (2) The application rapidly and effectively identifies lncRNAs related to metabolites of tomato fruits, including lncRNA-PEL8 related to 2-phenylethanol content, through GWAS association analysis and lncRNA differential expression analysis.
[0022] (3) According to the analysis of the expression of lncRNA-PEL8 in the natural population, combined with molecular biology technology, a new pathway related to the regulation of 2-phenylethanol content can be effectively identified. According to the expression of lncRNA-PEL8 in the natural population, germplasm resources with different 2-phenylethanol contents can be efficiently screened, thereby assisting tomato quality breeding.
[0023] (4) The identification of lncRNA-PEL8 enriches and perfects the existing 2-phenylethanol synthesis and regulation network, and reveals the molecular mechanism of the change of 2-phenylethanol content in the evolution of tomatoes. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 Identification of different types of lncRNAs in the fruit skin of 404 tomatoes.
[0025] Figure 2 Domestication analysis of lncRNAs. Among them, (a) PCA principal component analysis; (b) expression analysis of differentially expressed lncRNAs in the domestication improvement process; (c) number of potential selected lncRNAs in the domestication improvement process.
[0026] Figure 3 eQTLs related to lncRNAs. Among them, (a) genomic distribution of lncRNA eQTLs in the genome; (b) number of lncRNA eQTLs for each lncRNA.
[0027] Figure 4 Metabolite-related lncRNAs. Among them, (a) identification method of metabolite-related lncRNAs; (b) proportion of lncRNAs co-localized with metabolites; (c) screening of differentially expressed selection-related lncRNAs co-localized with metabolites.
[0028] Figure 5LncRNA population expression profile. Among them, (a) LncRNA-PEL8 and 2-phenylethanol co-localize at chr08:60Mb; (b) LncRNA-PEL8 is differentially expressed in the breeding process; (c) expression of lncRNA-PEL8 in the process of tomato fruit ripening.
[0029] Figure 6 LncRNA-PEL8 overexpression improves 2-phenylethanol content. Among them, (a) relative expression level of LncRNA-PEL8 in wild type and overexpression strain plants; (b) 2-phenylethanol content in wild type and overexpression plants. DETAILED DESCRIPTION
[0030] The application will be further described in detail below in combination with examples. The reagents or instrument equipment used without specifying the manufacturer are all regarded as conventional products that can be purchased in the market.
[0031] Example 1: Discovery of the association between tomato lncRNA-PEL8 and 2-phenylethanol content
[0032] 1. LncRNA identification Classification Differential expression analysis:
[0033] The RNA sequencing data of 404 tomato fruit epidermis of PRJNA396272 was downloaded from the NCBI database, and the RNA-seq data was generated by the Illumina platform 150-bp double-end sequencing. After quality control and trimming of the FASTX toolkit, the RNA-seq data was aligned to the tomato Heinz1706 v3.0 reference genome by hisat2 alignment software and identified to uniquely aligned reads. The SAM file generated by alignment was sorted and converted into a BAM file by Samtools software. Then stringtie software was used based on the bam file generated in the previous step to assemble transcripts. After assembling the transcripts of 404 accessions, the final transcript database was obtained by the merging function of stringtie, and then the expression level of all transcripts was quantified. After identifying the whole genome transcripts of 404 tomato accessions, the transcripts with coding potential and shorter length were filtered based on the general process of lncRNA, and the filtering criteria were as follows:
[0034] (1) Transcripts less than 200 bp in length were filtered out.
[0035] (2) ORF-finder predicted open reading frame length greater than 100 amino acids was filtered out.
[0036] (3) Transcripts with P-value < 0.01 in transcript alignment P-value were filtered out by comparing Pfam and Swiss-Prot databases.
[0037] (4) CPC calculated the coding potential of transcripts, and transcripts with a value greater than 0.5 were filtered out.
[0038] (5) Reads with strand information were encoded as XS tags based on the genomic splicing site and splicing alignment, and then the strand information of lncRNA was predicted by stringtie software. For single exon transcripts lacking strand information, transcripts on both strands were considered to have no protein-coding potential.
[0039] Of all the lncRNAs, 10,089 lincRNAs were mainly located in the intergenic region and identified as lincRNAs, 1,372 lncRNAs and protein-coding transcripts overlapped on the same strand, 3,283 antisense lncRNAs overlapped with protein transcripts on the antisense strand, and 125 were located in the intron region of protein-coding genes Figure 1 ).
[0040] In order to identify the expression trend of lncRNA in tomato breeding, the expression variation and nucleotide polymorphism in the currant, cherry and large fruit tomato subpopulations were analyzed. First, the overall expression difference between subpopulations was evaluated by PCA analysis, and currant, cherry and large fruit tomatoes could be clearly divided into three respective groups by the expression level of lncRNA, indicating that lncRNA had significant expression difference between subpopulations, and the expression amount changed significantly in the process of tomato breeding Figure 2 a).
[0041] In order to further identify the expression difference of lncRNA in the process of domestication and improvement, ballgown software was used to detect the differentially expressed lncRNAs between currant, cherry and large fruit tomatoes. LncRNAs with p-value less than 0.01 and fold change greater than or equal to 1.5 between the two groups were identified as differentially expressed lncRNAs, and a total of 265, 77 and 384 lncRNAs were differentially expressed in the process of domestication, improvement and selection, respectively Figure 2 b,c).
[0042] 2. GWAS analysis:
[0043] Using 404 tomato core germplasm resources fruit metabolite data, combined with lncRNA expression profile, whole genome association analysis was carried out. Through the FaST-mixed linear model software, the expression of lncRNA and metabolites were subjected to whole genome association analysis and Bonferroni correction (p-value<4.15e-08) threshold to screen eQTL. Based on the mixed linear model, 2,115 high-confidence lncRNAs were subjected to GWAs analysis, and 695 lncRNAs were identified to 1383 loci, with an average of 1.99 eQTLs per lncRNA, of which 387 lncRNAs (55.60%) had only one eQTL Figure 3 ).
[0044] Co-localization is a commonly used method in population genetics theory. In this study, co-localization was used to identify important candidate genes related to metabolites and expressed lncRNAs. Through co-localization analysis, 638 eQTLs of 450 lncRNAs were identified to have common linkage disequilibrium blocks with mQTLs of 578 metabolites, and the linkage disequilibrium r 2 > between eQTL and mQTL was 0.28 and the physical distance was less than 1 Mb. Among them, 145 lncRNAs related to metabolites were differentially expressed in breeding Figure 4 ), including the important metabolite phenyldiol lncRNA-PEL8 related to flavor, which was also located in the eQTL and mQTL co-localization linkage block Figure 5 a).
[0045] Example 2: Application of tomato lncRNA-PEL8 in improving fruit 2-phenylethanol content
[0046] (1) LncRNA-PEL8 expression analysis
[0047] Firstly, by analyzing the RNA-seq data, it was found that the expression level of lncRNA-PEL8 was significantly different in the three subpopulations of currant, cherry and large fruit tomatoes Figure 5 b). Further, total RNA of modern tomato variety ‘MoneyMaker’ (MM) fruit at the mature stage was extracted, and after reverse transcription into cDNA, the relative expression level of LncRNA-PEL8 at each stage was determined with CAC gene as an internal reference, and it was found that the expression level of lncRNA-PEL8 increased rapidly after the fruit color breaking stage Figure 5 c). The qPCR reaction system is as follows:
[0048]
[0049]
[0050] (2) Overexpression vector construction
[0051] The lncRNA-PEL8 was amplified with cDNA as a template and specific primers F1 and R1 as primers, and the amplified fragment was connected to the overexpression vector pCM2300; the nucleotide sequences of the primers F1 and R1 are shown as SEQ ID NO: 2 and 3;
[0052] The overexpression vector was introduced into AGL1 Agrobacterium competent cells, PP (S. pimpinellifolium) was used as the receptor material for genetic transformation, and 35S::lncRNA-PEL8 was used to transform tomato by Agrobacterium tumefaciens mediation, and positive transgenic plants were screened and identified by qPCR Figure 6 a);
[0053] SEQ ID NO 2: aagctccaatgttgtactgca;
[0054] SEQ ID NO 3: tactctattcattatgactgtgt.
[0055] (3) Determination of 2-phenylethanol content in tomato fruit
[0056] The wild type and overexpression lncRNA-PEL8 tomato fruit (500 mg) was transferred to a TFE-silica gel septum bottle (Thermo Fisher Scientific, Waltham, MA, USA) containing 1 mL of termination buffer (containing 4.6 M CaCl2 and 100 mM EDTA) and 20 ng of internal standard 2-heptanone and heptane (Merck, Darmstadt, Germany). Each sample bottle was incubated at 80°C for 10 minutes and absorbed at 80°C for 10 minutes. The Thermo Exactive GC Orbitrap mass spectrometer was used in combination with a Tace1310 GC (Thermo Fisher Scientific) equipped with a 30 m x 0.25 mm x 1.0 μm DB-5 capillary column to identify and quantify the compounds. The gas chromatography program is as follows: the temperature is initially set to 40°C, maintained for 5 minutes, then increased to 300°C at a rate of 5°C / min, and finally maintained for 5 minutes. Metabolites were identified using our internal database and NIST 2020 mass spectrometry database, and quantified using internal standards. Then the content of 2-phenylethanol was calculated according to the calibration curve prepared using standard compounds. The results show that the content of 2-phenylethanol in lncRNA-PEL8 overexpression plants is significantly higher than that in wild type plants Figure 6 b)。
[0057] SEQ ID NO: 1
[0058] GGTGAACTCTTGCTCTAAATTTAAGAATAGACGCAAACAAAATTATTAAAGACATAACGA
[0059] ATAAATATATATTTACCATGTTAATGAGGGGGAAAATGATCAATAAATTGATTTTACATAAA
[0060] TTTATAGGAATTATAAGATGATGAAATACAAAGGTGAAGTGAACTTATATTTTTTGTTCAC
[0061] TTATACAAGAGATCATCACCAAAAAATCTATTAAAAGACAAAAATAATTATAACCCAAAA
[0062] AAATTATAATAAAATATAAAATCAGTAAATAAGGTGCAAATATATGCACACACAAAAGAA
[0063] GGATCATTTGAGCAAGATAACTAACAAATATTAGTAAAAAAAATACACAAATAATGATAT
[0064] CACCGACTTTGAAAGAAGTTTCATTATATAAATTGAAAAACTATTAAAAATATTTATACAT
[0065] AAATATTGTTTTCGGCTATTCTTTATACTAAAATAAAGACATTATCGAAATTGAAAGAAGG
[0066] GTCTTTATATGTTTTGTCTCCAACATTTCCACGATGAATCAATATAACTCTTAAAATCAAA
[0067] ACTCAATAATAGATTATTTGACTATGTGATTGAATAATATGAATTTTTTTTCAAATTTATAG
[0068] AATCCTTTAAAGAATATGAAAAGGTCATGATTTCATGGAAGATGAATGGAATTAAACATT
[0069] TTAATTAAAG
[0070] The protection scope of the present application is not limited to the above-mentioned embodiments. Changes and advantages that can be thought of by those skilled in the art without departing from the spirit and scope of the present application are included in the present application and are protected by the appended claims.
Claims
1. Use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in increasing the content of 2-phenylethanol in tomato fruits, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
2. Use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in preparing a product for increasing the content of 2-phenylethanol in tomato fruits, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
3. Use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in cultivating tomato fruits with high content of 2-phenylethanol, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
4. Use of tomato lncRNA-PEL8 or a recombinant vector containing lncRNA-PEL8 in breeding tomato plants with high content of 2-phenylethanol in fruits, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
5. Use of a recombinant bacterium containing lncRNA-PEL8 in increasing the content of 2-phenylethanol in tomato fruits, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
6. Use of a recombinant bacterium containing lncRNA-PEL8 in preparing a product for increasing the content of 2-phenylethanol in tomato fruits, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
7. Use of a recombinant bacterium containing lncRNA-PEL8 in cultivating tomato fruits with high content of 2-phenylethanol, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
8. Use of a recombinant bacterium containing lncRNA-PEL8 in breeding tomato plants with high content of 2-phenylethanol in fruits, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
9. A method for increasing the content of 2-phenylethanol in tomato fruits, wherein the method is achieved by increasing the expression amount of lncRNA-PEL8 in a target plant, wherein the coding gene sequence of the lncRNA-PEL8 is shown as SEQ ID NO:
1.
10. The method of claim 9, wherein, The method is achieved by introducing a recombinant vector containing lncRNA-PEL8 into a target plant.