L protein mutated recombinant foot-and-mouth disease virus strain and application thereof in vaccine preparation

Abstract

The invention provides an L protein mutated recombinant foot-and-mouth disease virus strain and application thereof in vaccine preparation, and belongs to the technical field of biological medicine. Firstly, it is found that overexpression of CISD2 protein in host cells can inhibit FMDV replication, and an inhibition mechanism is analyzed, specifically, the CISD2 inhibits FMDV replication by inhibiting expression of L protein, especially inducing degradation of the L protein through a proteasome pathway. The invention also identifies a key site for degrading the L protein by the CISD2 protein, the recombinant foot-and-mouth disease virus with the mutated key amino acid site of the L protein is successfully constructed and rescued by introducing amino acid mutation of the key site into the L protein by utilizing a reverse genetic technology, the capabilities of degrading the L protein and inhibiting FMDV replication by the CISD2 protein are eliminated, the virus titer is improved, and the recombinant foot-and-mouth disease virus can be used for preparing the recombinant foot-and-mouth disease virus with the mutated key amino acid site of the L protein. The strain has good production performance and can be used for preparing recombinant foot-and-mouth disease virus strains and recombinant vaccine strains.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to a recombinant foot-and-mouth disease virus strain with L protein mutation and its application in vaccine preparation. Background Art

[0002] Foot-and-mouth disease (FMD) is an acute, febrile, highly contagious disease of even-toed ungulates caused by foot-and-mouth disease virus (FMDV). Characteristic symptoms of infected animals are blisters on the mouth, nose, hoofs and nipples of female animals, which rupture to form ulcers or scabs, leading to lameness and lying on the ground, and a significant decline in productivity. In the case of infection in young animals or an epidemic in wild animals, FMD can cause a high mortality rate, which has a huge impact on the international trade of livestock.

[0003] FMDV belongs to the Picornaviridae family and the genus Foot-and-Mouth Disease Virus. Its genome is about 8.0 kb long and is translated into a 5' untranslated region, an open reading frame, and a 3' untranslated region. The open reading frame encodes the nonstructural protein L pro , 4 structural proteins VP4, VP2, VP3 and VP1, and 2A, 2B, 2C, 3A, 3B, 3C pro and 3D pol Nonstructural proteins. Among them, the leader protein L pro It is a papain that can cut itself off from polyproteins and can also cleave the host cell translation initiation factor eIF4G, inhibiting host protein synthesis and promoting viral protein translation; L protein is also a deubiquitinating protease that inhibits the type I interferon signaling pathway by inhibiting the ubiquitination of RIG-I, TBKI, TRAF6 and TRAF3; L protein is also an important virulence factor of FMDV. Its second translation initiation codon has a high utilization frequency. After deletion, the replication ability of the recombinant virus decreases, and the pathogenicity to the host animal is significantly reduced; therefore, the L protein of FMDV plays an important role in the regulation of viral replication, virulence and host cell response. A safer and more effective FMDV vaccine can be developed by deleting or mutating the L protein. In addition, there are also complex interactions between host proteins and FMDV proteins, which regulate viral replication and evade host immunity through different mechanisms. In-depth analysis of the interaction mechanism between viral proteins and host proteins and their role in viral replication and immune escape provides important targets for the development of new vaccines and antiviral drugs. Summary of the invention

[0004] The invention provides a recombinant foot-and-mouth disease virus strain with L protein mutation and application thereof in vaccine preparation. The recombinant foot-and-mouth disease virus strain can be stably propagated and has the characteristics of high virus titer and high antigen yield.

[0005] The first invention objective of the present invention is to provide a method for inhibiting the degradation of foot-and-mouth disease virus L protein by host protein CISD2 and its application in the preparation of improving foot-and-mouth disease virus titer and / or antigen yield.

[0006] In a preferred embodiment of the present invention, the method for inhibiting the degradation of foot-and-mouth disease virus L protein by host protein CISD2 comprises mutating or deleting a key site of foot-and-mouth disease virus L protein.

[0007] In a preferred embodiment of the present invention, the key sites include amino acids at positions 18 and / or 28.

[0008] In a preferred embodiment of the present invention, the mutation comprises mutating all the amino acids at the key sites to arginine.

[0009] The second inventive object of the present invention is to provide a method for constructing a recombinant foot-and-mouth disease virus strain, comprising mutating or deleting the amino acid at position 18 and / or 28 of the L protein in the parent foot-and-mouth disease virus to construct the recombinant foot-and-mouth disease virus strain.

[0010] In a preferred embodiment of the present invention, the parent foot-and-mouth disease virus includes a wild foot-and-mouth disease virus strain, a recombinant foot-and-mouth disease virus strain or a recombinant foot-and-mouth disease vaccine strain.

[0011] In a preferred embodiment of the present invention, the mutation comprises mutating the amino acid at position 18 and / or position 28 of the L protein in the parent foot-and-mouth disease virus to arginine.

[0012] The third invention objective of the present invention is to provide a recombinant foot-and-mouth disease virus strain constructed using the above construction method.

[0013] In a preferred embodiment of the present invention, when the parent foot-and-mouth disease virus is strain O / GD / CHA / 2015, the amino acid sequence of the L protein in the constructed recombinant foot-and-mouth disease virus strain is shown in SEQ ID No.6.

[0014] In a preferred embodiment of the present invention, when the parent foot-and-mouth disease virus is the O-type recombinant foot-and-mouth disease vaccine strain rO-FMDV, the amino acid sequence of the L protein in the constructed recombinant foot-and-mouth disease virus strain is shown in SEQ ID No.7.

[0015] The fourth invention object of the present invention is to provide a method for preparing the above-mentioned recombinant foot-and-mouth disease virus strain, comprising the following steps:

[0016] Point mutations are performed on key sites of the L protein of the full-length infectious clone of the parent foot-and-mouth disease virus; a eukaryotic transcription plasmid containing the point mutations is transfected into foot-and-mouth disease virus sensitive cells to obtain a recombinant foot-and-mouth disease virus strain.

[0017] In a preferred embodiment of the present invention, the key site includes amino acid at position 18 and / or amino acid 28 of the L protein.

[0018] In a preferred embodiment of the present invention, the point mutation comprises mutating the amino acid at position 18 and / or position 28 of the L protein in the parent foot-and-mouth disease virus to arginine.

[0019] In a preferred embodiment of the present invention, the foot-and-mouth disease virus-sensitive cells include BHK-21 cells or IBRS-2 cells.

[0020] The fifth invention objective of the present invention is to provide a recombinant foot-and-mouth disease vaccine strain screened from the above-mentioned recombinant foot-and-mouth disease virus strain.

[0021] In a preferred embodiment of the present invention, the amino acid sequence of the L protein in the recombinant foot-and-mouth disease vaccine strain includes any of the following sequences:

[0022] (1) the amino acid sequence shown in SEQ ID No.6;

[0023] (2) the amino acid sequence shown in SEQ ID No.7;

[0024] (3) retaining the amino acid sequence at position 18 and / or 28 of SEQ ID No. 6 unchanged, and having an amino acid sequence with more than 85% homology and similar functions after mutation, deletion or addition at other positions;

[0025] (4) The amino acid sequence at position 18 and / or 28 of SEQ ID No. 7 remains unchanged, and after mutation, deletion or addition at other positions, an amino acid sequence having a homology of more than 85% and a similar function is obtained.

[0026] The sixth invention object of the present invention is to provide a method for producing the above-mentioned recombinant foot-and-mouth disease vaccine strain, comprising the following steps:

[0027] The amino acid at position 18 and / or position 28 of the L protein of the full-length infectious clone of the parent foot-and-mouth disease virus is subjected to point mutation; the eukaryotic transcription plasmid containing the point mutation is transfected into foot-and-mouth disease virus sensitive cells to obtain a recombinant foot-and-mouth disease vaccine strain.

[0028] The seventh invention objective of the present invention is to provide the use of the above-mentioned recombinant foot-and-mouth disease vaccine strain in the preparation of a recombinant foot-and-mouth disease vaccine.

[0029] The eighth invention objective of the present invention is to provide a recombinant foot-and-mouth disease vaccine comprising the above-mentioned recombinant foot-and-mouth disease vaccine strain.

[0030] The ninth invention objective of the present invention is to provide the use of the above-mentioned recombinant foot-and-mouth disease virus strain in the preparation of drugs for preventing and / or controlling animal foot-and-mouth disease.

[0031] In a preferred embodiment of the present invention, the animal includes pigs, cattle or sheep.

[0032] The tenth invention object of the present invention is to provide a drug for preventing and / or controlling animal foot-and-mouth disease, which uses the above-mentioned recombinant foot-and-mouth disease virus strain as an active ingredient and also includes pharmaceutically acceptable excipients.

[0033] The eleventh invention objective of the present invention is to provide the use of the above-mentioned recombinant foot-and-mouth disease vaccine strain in the preparation of drugs for preventing and / or controlling animal foot-and-mouth disease.

[0034] In a preferred embodiment of the present invention, the animal includes pigs, cattle or sheep.

[0035] The twelfth invention object of the present invention is to provide a drug for preventing and / or controlling animal foot-and-mouth disease, the active ingredients of which include the above-mentioned recombinant foot-and-mouth disease vaccine strain and also include pharmaceutically acceptable excipients.

[0036] Beneficial effects: The present invention first discovered that overexpression of CISD2 protein in host cells inhibits the replication of FMDV, and analyzed the inhibition mechanism, which specifically includes that CISD2 inhibits the expression of L protein, especially causes the degradation of L protein through the proteasome pathway, thereby inhibiting the replication of FMDV. The present invention also identified the key sites for CISD2 protein to degrade L protein, and successfully constructed and rescued a recombinant foot-and-mouth disease virus strain with mutations in the key amino acid sites of L protein by using reverse genetic technology, by introducing amino acid mutations at key sites (amino acid sequences at positions 18 and 28) in L protein, eliminating the ability of CISD2 protein to degrade L protein and inhibit FMDV replication, and can be used to prepare recombinant foot-and-mouth disease virus strains and recombinant vaccine strains.

[0037] The present invention utilizes an established reverse genetic operating system with a strong cellular immune response strain as a framework, screens O / JSCZ / 2013 with cross-protection against different lineages of O-type FMDV as an antigen skeleton (disclosed in Chinese patents CN107029231A, CN106916832A and CN107041951A), and mutates key amino acid sites of the L protein to construct an O-type recombinant foot-and-mouth disease vaccine strain. The obtained vaccine strain eliminates the ability of CISD2 to inhibit FMDV replication, improves the virus titer, has good production performance, has the characteristics of high virus titer and good production performance, and has good application prospects, such as for FMDV vaccine preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a graph showing the effect of overexpression of CISD2 on FMDV replication;

[0039] Figure 2 This is the result diagram of the effect of CISD2 on the expression of FMDV L protein;

[0040] Figure 3 The result diagram of the pathway of CISD2 degradation of FMDV L protein;

[0041] Figure 4 Schematic diagram of the construction of a recombinant foot-and-mouth disease virus with mutations in key amino acid sites of the L protein;

[0042] Figure 5 This is a diagram showing the rescue results of recombinant foot-and-mouth disease virus with mutations in key amino acid sites of L protein; A in the figure: normal control BHK-21 cells; B: cytopathic effect caused by recombinant virus rO-mL(18+28)-FMDV infecting BHK-21 cells;

[0043] Figure 6 This is the result diagram of the effect of CISD2 on the expression of L protein with mutations at key amino acid sites;

[0044] Figure 7 This is a graph showing the effect of CISD2 on the replication of recombinant foot-and-mouth disease virus with mutations in key amino acid sites of L protein;

[0045] Figure 8 This is the result of the toxicity test of the recombinant foot-and-mouth disease virus with mutations at the key amino acid sites of the L protein. DETAILED DESCRIPTION

[0046] The invention provides an application of a method for inhibiting host protein CISD2 from degrading foot-and-mouth disease virus L protein in the preparation of improving foot-and-mouth disease virus titer and / or antigen yield.

[0047] In the embodiment of the present invention, Western-blot analysis was used to find that overexpression of CISD2 in host cells such as PK-15 cells would inhibit the abundance of FMDV viral proteins in a dose-dependent manner, that is, overexpression of CISD2 protein in host cells would inhibit the viral replication of FMDV, wherein the protein sequence of CISD2, in PK-15 cells, has an amino acid sequence as shown in SEQ ID No.2, and the nucleotide sequence encoding the protein shown in SEQ ID No.2 is shown in SEQ ID No.1.

[0048] Through further research, the present invention found that CISD2 can cause the degradation of L protein through the proteasome pathway, inhibit the expression of L protein, and thus inhibit the replication of FMDV in host cells, wherein the amino acid sequence of L protein in the parent strain, such as O / GD / CHA / 2015 strain, is shown in SEQ ID No. 4, and the nucleotide sequence encoding the amino acid shown in SEQ ID No. 4 is shown in SEQ ID No. 3. The foot-and-mouth disease virus used in the embodiment of the present invention can be O / GD / CHA / 2015 strain, which is preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Veterinary Bureau of the Ministry of Agriculture and Rural Affairs, and the public can obtain it through a letter of entrustment approved by the Veterinary Bureau of the Ministry of Agriculture and Rural Affairs.

[0049] The present invention can eliminate the inhibitory effect of host CISD2 protein on the replication of foot-and-mouth disease virus by mutating key sites of foot-and-mouth disease virus L protein, such as point mutation or deletion. In one embodiment of the present invention, the amino acid sequence shown in SEQ ID No.4 is mutated by point mutation, such as mutating the amino acid at position 18 and / or position 28 of the amino acid sequence shown in SEQ ID No.4 to arginine (K18R and / or K28R). In the embodiment, the amino acids at these two sites are mutated, and after the mutation occurs, the amino acid sequence of the mutated L protein is as shown in SEQ ID No.6 or SEQ ID No.7.

[0050] The present invention also provides a method for improving the titer and / or antigen production of foot-and-mouth disease virus, comprising mutating or deleting key sites of L protein in the parent foot-and-mouth disease virus, such as amino acids at positions 18 and / or 28, wherein the mutation comprises a point mutation, and the point mutation comprises mutating all of the above key sites to arginine.

[0051] The present invention does not specifically limit the type and strain of the parent foot-and-mouth disease virus, as long as the parent strain does not contain mutations at key amino acid sites, especially does not contain the K18R mutation, such as wild-type foot-and-mouth disease virus strains, recombinant foot-and-mouth disease virus strains or recombinant foot-and-mouth disease vaccine strains. The present invention does not specifically limit the construction method of the recombinant virus or recombinant vaccine strain, such as using conventional reverse genetics techniques in the art such as virus rescue for rescue.

[0052] In one embodiment of the present invention, a method for constructing and rescuing the recombinant virus or recombinant vaccine strain comprises the following steps: (1) constructing a full-length infectious clone of the parent foot-and-mouth disease virus;

[0053] (2) using gene mutation technology or gene synthesis technology, based on the full-length infectious clone of the parental foot-and-mouth disease virus, mutating the amino acids at positions 18 and 28 of the L protein to arginine;

[0054] (3) The obtained eukaryotic transcription plasmid containing the mutant amino acids of the L protein is transfected into FMDV-sensitive cells to obtain a recombinant FMDV strain or a recombinant vaccine strain.

[0055] The foot-and-mouth disease virus-sensitive cells of the present invention are BHK-21 cells or IBRS-2 cells.

[0056] The present invention also provides a recombinant foot-and-mouth disease virus strain or a recombinant foot-and-mouth disease vaccine strain comprising a point mutation L protein, wherein the point mutation L protein comprises mutating the amino acid at position 18 and / or position 28 of the L protein in the parent foot-and-mouth disease virus to arginine.

[0057] In a preferred embodiment of the present invention, the amino acid sequence of the L protein in the recombinant foot-and-mouth disease virus strain or the recombinant foot-and-mouth disease vaccine strain is shown as SEQ ID No.6 or SEQ ID No.7.

[0058] The present invention also provides a method for preparing the above-mentioned recombinant foot-and-mouth disease virus strain or recombinant foot-and-mouth disease vaccine strain, comprising the following steps:

[0059] The amino acid at position 18 and / or position 28 of the L protein of the full-length infectious clone of the parent foot-and-mouth disease virus is subjected to point mutation; the eukaryotic transcription plasmid containing the point mutation is transfected into foot-and-mouth disease virus sensitive cells to obtain a recombinant foot-and-mouth disease virus strain or a recombinant foot-and-mouth disease vaccine strain.

[0060] In one embodiment of the present invention, the gene fragment containing L in the recombinant plasmid prO-FMDV containing the L gene, P1 gene and P2 gene of the O / JSCZ / 2013 strain is digested with KpnI, and then the large vector fragment is recovered, and the gene fragment containing the mutation at the key site of the L gene is amplified by PCR using the plasmid as a template using a point mutation primer, wherein the recombinant plasmid prO-FMDV and its construction method have been disclosed in Chinese patents CN107029231A, CN106916832A, and CN107041951A, and the full text of the patent is incorporated into the present application by reference; then the PCR amplification products are recovered respectively, and homologous recombination is performed with the recovered vector fragment to obtain a recombinant plasmid in which positions 18 and 28 of the L gene are mutated to arginine, and the plasmid is extracted after transforming the competent Escherichia coli cells to obtain the recombinant plasmid prO-mL (18 + 28) -FMDV containing the L gene mutation.

[0061] The present invention uses the recombinant plasmid prO-mL (18 + 28) -FMDV to generate a polyplus Transfection reagent instructions: When BHK-21 cells grow to about 70%, transfect BHK-21 cells with the recombinant plasmid and place them in a 37°C, 5% CO2 incubator to observe the cell status. When the cells show about 90% cytopathic effect, harvest the virus. After repeated freezing and thawing for 3 times, inoculate BHK-21 cells again until the virus can stably produce cytopathic effect, that is, the cells become round and aggregate into a grape-like distribution, and finally the cells disintegrate, thereby obtaining the O-type recombinant foot-and-mouth disease virus strain named rO-mL(18+28)-FMDV.

[0062] The present invention also provides a recombinant foot-and-mouth disease vaccine comprising the recombinant foot-and-mouth disease virus strain or the recombinant foot-and-mouth disease vaccine strain.

[0063] In the recombinant virus or recombinant vaccine strain of the present invention, CISD2 in the host cell no longer affects the expression of L protein of the recombinant virus or recombinant vaccine strain, nor does it affect the replication of the recombinant virus or recombinant vaccine strain. Therefore, the recombinant virus or recombinant vaccine strain can be used as a seed virus for foot-and-mouth disease virus vaccine, improve the virus titer and antigen content, improve production performance, save costs and increase efficiency, and can be used as a candidate strain for foot-and-mouth disease virus vaccine. The present invention does not specifically limit the preparation method of the recombinant vaccine, and it can be prepared using conventional methods in the art.

[0064] The present invention also provides the use of the recombinant foot-and-mouth disease virus strain or the recombinant foot-and-mouth disease vaccine strain in the preparation of a medicine for preventing and / or controlling animal foot-and-mouth disease.

[0065] The animals described in the present invention include pigs, cattle and sheep.

[0066] To further illustrate the present invention, a recombinant foot-and-mouth disease virus strain with L protein mutation provided by the present invention and its application in vaccine preparation are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0067] The experimental methods in the examples of the present invention are all conventional methods unless otherwise specified; the experimental materials used in the examples are all purchased from conventional biochemical reagent companies unless otherwise specified.

[0068] The relevant experiments described in the embodiments of the present invention obtained biosafety licenses and foot-and-mouth disease laboratory activity licenses: The Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, in accordance with the relevant requirements of biosafety level 3 laboratories (BSL-3) and foot-and-mouth disease-related biosafety, has been reported step by step by the Biosafety Committee of the Lanzhou Veterinary Research Institute, the Biosafety Committee of the Chinese Academy of Agricultural Sciences, and the Experimental Animal Ethics Committee of the Lanzhou Veterinary Research Institute, and obtained the Ministry of Agriculture and Rural Affairs’ permission to conduct research on highly pathogenic FMDV pathogens and animals. It has been filed with the Ministry of Agriculture and Rural Affairs and meets the national biosafety level requirements.

[0069] The FMDV (O / BY / CHA / 2010 strain, O / GD / CHA / 2015 strain) used in the present invention is preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Ministry of Agriculture and Rural Affairs, and the public can obtain it through a letter of entrustment approved by the Veterinary Bureau of the Ministry of Agriculture and Rural Affairs; the O / JSCZ / 2013 strain and the recombinant plasmid prO-FMDV have been disclosed in Chinese patents CN107029231A, CN106916832A, and CN107041951A.

[0070] The eukaryotic expression plasmids p3×FLAG-CMV-7.1 and pcDNA3.1 / myc were commercial plasmids purchased from Miaoling Biotechnology, MG132 was purchased from Merck, and NH4Cl and Z-VAD-FMK were purchased from Sigma-Aldrich.

[0071] The CISD2 gene sequence described in the embodiment of the present invention is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2.

[0072] Example 1 Effect of overexpression of CISD2 on FMDV replication

[0073] 1.1 Construction of CISD2 eukaryotic expression plasmid

[0074] The CISD2 gene sequence was queried from the NCBI database and primers were designed. The underlined part in the primer sequence is the restriction site.

[0075] CISD2-NheI-F (SEQ ID No. 14): CGTCTA GCTAGC ATGGTGCTGGAGTGCGTGGCCCGGAT;

[0076] CISD2-BamHI-R(SEQ ID No.15):CGC GGATCC TACTTCTTTCTTCTTC AGTATTAGT.

[0077] RNA of PK-15 cells was extracted and reverse transcribed into cDNA, and the cDNA was used as a template to amplify CISD2 gene (nucleotide sequence is shown in SEQ ID NO.1, and amino acid sequence is shown in SEQ ID NO.2), the amplified fragment was recovered by nucleic acid electrophoresis, double digested with NheI and BamHI restriction endonucleases, and the pcDNA3.1 / myc vector plasmid was double digested with the same restriction endonucleases, the CISD2 gene and the linearized vector fragment were purified and recovered respectively, connected at 4°C overnight with T4 ligase, transformed into DH5α competent cells, the plasmid was extracted and sequenced, and the successfully constructed plasmid was named CISD2-Myc.

[0078] 1.2 Effect of overexpression of CISD2 on FMDV replication

[0079] PK-15 cells were inoculated into 6-well plates and cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%. Different doses of CISD2 eukaryotic expression plasmid CISD2-Myc (0 μg, 1 μg and 3 μg) were transfected. After 24 hours, FMDV (O / BY / CHA / 2010 strain) was infected and Western-blot analysis was performed.

[0080] The results are as follows Figure 1 As shown, overexpression of CISD2 in PK-15 cells inhibited the abundance of FMDV viral proteins in a dose-dependent manner.

[0081] Example 2 Effect of CISD2 on FMDV L protein expression

[0082] 2.1 Construction of Flag-L plasmid

[0083] The FMDV L gene sequence was queried in the NCBI database and primers were designed. The underlined parts in the primers are restriction sites:

[0084] L-EcoRI-F (SEQ ID No. 8): CGC GAATTC AATGAACACGACTGACTGTTTCATC;

[0085] L-BamHI-R (SEQ ID No. 9): CGC GGATCC TTACCTGAGTCGTTTTTGAACCTTTG.

[0086] RNA of O / GD / CHA / 2015 strain was extracted and reverse transcribed to synthesize cDNA. L gene was amplified using cDNA as template. The nucleotide sequence was shown in SEQ ID No.3 and the amino acid sequence was shown in SEQ ID No.4. The amplified fragment was recovered by nucleic acid electrophoresis and double-digested with EcoRI and BamHI restriction endonucleases. At the same time, the p3×FLAG-CMV-7.1 vector plasmid was double-digested with the same restriction endonucleases, and the L gene and the linearized vector fragment were purified and recovered respectively. The fragments were connected at 4°C overnight with T4 ligase and transformed into DH5α competent cells. Single clones were picked, shaken, and the plasmid was extracted and sequenced. The successfully constructed plasmid was named L-Flag.

[0087] 2.2 Effect of CISD2 on FMDV L protein expression

[0088] HEK293T cells were seeded into 6-well plates and cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%. FMDV L protein eukaryotic expression plasmid L-Flag and different doses of CISD2 eukaryotic expression plasmid CISD2-Myc were transfected, and samples were collected for Western-blot analysis.

[0089] The results are as follows Figure 2 As shown, CISD2 decreased the expression of FMDV L protein in a dose-dependent manner, indicating that CISD2 inhibited FMDV replication by inhibiting the expression of L protein.

[0090] HEK293T cells were co-transfected with the L protein eukaryotic expression plasmid L-Flag and the CISD2 eukaryotic expression plasmid CISD2-Myc. After 16 hours of transfection, 20 μM of the proteasome inhibitor MG132, 20 μM of the lysosome inhibitor NH4Cl and 20 μM of the apoptosis inhibitor Z-VAD-FMK were added respectively. After culturing for another 8 hours, the cells were collected and analyzed by Western-blot.

[0091] The results are as follows Figure 3 The results showed that the degradation of L protein caused by CISD2 was inhibited by MG132, indicating that CISD2 caused the degradation of L protein through the proteasome pathway.

[0092] Example 3 Method for constructing a eukaryotic expression plasmid of a mutant of a key amino acid site of a L protein

[0093] On the basis of Example 1, the L protein of FMDV was mutated to construct a eukaryotic expression plasmid of the L protein mutant. The method described in this example can also be used to construct a eukaryotic expression plasmid of the L protein mutant of other foot-and-mouth disease virus strains. The specific process is as follows:

[0094] On the basis of the wild-type FMDV L protein eukaryotic expression plasmid L-Flag (the nucleotide sequence is shown in SEQ ID No.3, and the amino acid sequence is shown in SEQ ID No.4), the coding sequence of lysine at positions 18 and 28 of the L protein was mutated to arginine by gene synthesis technology or point mutation technology (the nucleotide sequence is shown in SEQ ID No.5, and the amino acid sequence is shown in SEQ ID No.6), DH5α competent cells were transformed, single clones were picked, the bacteria were shaken, the plasmid was extracted and sequenced, and it was confirmed that the mutations at positions 18 and 28 of the L protein were successful. The key amino acid mutation plasmid was named L-Flag-(18+28)R.

[0095] Example 4 Construction and identification of recombinant O-type foot-and-mouth disease virus with L protein mutation

[0096] 4.1 Construction of recombinant O-type foot-and-mouth disease virus infectious clone

[0097] The L gene fragment in the recombinant plasmid prO-FMDV containing the L gene, P1 gene and P2 gene of the O / JSCZ / 2013 strain was digested with KpnI to recover the large vector fragment, and the gene fragment containing the mutation of the key site of the L gene was amplified by PCR using the plasmid as a template. The homologous recombination mutation primers are:

[0098] KpnI-F (SEQ ID No. 10): 5'-TAAGGATGCCCTTCAGGTACCCTGAGGTA ACACGCGACACTCG-3';

[0099] mL1828-R (SEQ ID No. 11): 5'-GTGCTCGTGATAAGAACAGTGTTCTAATCTCTCTGAAAGCGTACAACAAAG-3';

[0100] mL1828-F (SEQ ID No. 12)5'-GTTCTTATCACGAGCACAAGGAAGGATGGAGTTCACACTTCACAACGG-3';

[0101] KpnI-R (SEQ ID No. 13) 5'-ATGGAACAAAGTTCAGGTACCATGGCCACC AGTAGGCAGC-3'.

[0102] The PCR amplification products were recovered and homologously recombined with the recovered vector fragments to obtain a recombinant plasmid in which the lysine at positions 18 and 28 of the L gene were mutated to arginine. HSDNA polymerase was used to prepare 50 μL reaction system according to the product manual. The amplification conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 1 min, 30 cycles, and 4°C for 5 min. Homologous recombination was performed using Novazon Ultra One Step Cloning Kit, 50℃ for 15min, transform DH5α competent cells, pick single clone colonies, shake to extract plasmids, and sequence to identify positive clones. Finally, the recombinant plasmid prO-mL(18+28)-FMDV containing L gene mutation was obtained. The construction diagram is shown in the figure. Figure 4 shown.

[0103] 4.2 Rescue of recombinant viruses

[0104] The recombinant plasmid prO-mL(18+28)-FMDV prepared in 4.1 was purified by Polyplus Transfection reagent instructions: When BHK-21 cells grow to about 70%, transfect BHK-21 cells with the recombinant plasmid, set up normal cell controls and transfection reagent controls at the same time, place in a 37°C, 5% CO2 incubator, observe the cell state, and harvest the virus when the cells show about 90% cytopathic effect. After repeated freezing and thawing 3 times, inoculate BHK-21 cells again until the virus can stably produce cytopathic effect, that is, the cells become round, aggregate into grape-like distribution, and finally the cells collapse. The obtained O-type recombinant foot-and-mouth disease virus strain was named rO-mL(18+28)-FMDV. Figure 5 shown.

[0105] 4.3 RT-PCR identification of recombinant virus

[0106] The supernatant of BHK-21 cells infected with the stably passaged recombinant virus rO-mL(18+28)-FMDV was used to extract total RNA using Trizol. After reverse transcription, the gene fragment containing L was amplified using KpnI-F (SEQ ID No.10) and KpnI-R (SEQ IDNo.13). After purification and recovery, it was sent for sequencing. The results showed that the L gene of the obtained recombinant O-type foot-and-mouth disease virus was consistent with the theoretical sequence, and the amino acids at positions 18 and 28 were arginine. The amino acids encoded by the mutated L gene were the amino acid sequence shown in SEQ ID No.7.

[0107] Example 5 Effect of CISD2 protein on the replication of recombinant foot-and-mouth disease virus with mutations in key amino acid sites of L protein

[0108] 5.1 Effect of CISD2 on the expression of L protein with key site mutations

[0109] HEK293T cells were seeded into 6-well plates and cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%. The FMDV L protein key site mutant eukaryotic expression plasmid L-Flag-(18+28)R and different doses of CISD2 eukaryotic expression plasmid CISD2-Myc were transfected and samples were collected for Western-blot analysis.

[0110] The results are as follows Figure 6 As shown, CISD2 overexpression did not affect the expression level of mutant L protein.

[0111] 5.2 Effect of CISD2 on the replication of recombinant FMDV with mutations at key sites of L protein

[0112] PK-15 cells were inoculated into 6-well plates, cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%, and transfected with different doses of CISD2 eukaryotic expression plasmid CISD2-Myc (0 μg, 1 μg and 3 μg). After 24 hours, they were infected with the wild-type and recombinant foot-and-mouth disease virus strain rO-mL(18+28)-FMDV with mutations in the key amino acid sites of the L protein, and Western-blot analysis was performed.

[0113] The results are as follows Figure 7 As shown in the figure, overexpression of CISD2 in PK-15 cells had no effect on the abundance of viral proteins of the recombinant virus rO-mL(18+28)-FMDV, indicating that overexpression of CISD2 inhibited the replication of wild-type FMDV in a dose-dependent manner, but could not inhibit the replication of the recombinant virus rO-mL(18+28)-FMDV with L protein mutation. Therefore, the recombinant foot-and-mouth disease virus can be used as a seed virus for foot-and-mouth disease virus vaccine, to increase the virus titer and antigen content, improve the virus production performance, and save costs and increase efficiency.

[0114] Example 6 Pathogenicity test of recombinant foot-and-mouth disease virus on BHK-21 cells

[0115] The control FMDV and the recombinant FMDV with L protein mutation were used to infect BHK-21 cells at the same MOI. The virus solution was collected after 8 hours and repeated freezing and thawing for 3 times. The samples were diluted 10 times in DMEM medium and inoculated into 96-well culture plates with a monolayer of BHK-21 cells. Each dilution had 8 wells and was cultured in a 37°C, 5% CO2 incubator for 3 days. The cytopathic effect was observed and the TCID of the virus was calculated according to the Reed-Muench method. 50 The Reed-Muench method can be carried out with reference to the literature method, which is: "Reed, LJ and Muench, H. (1938). "A Simple Method of Estimating Fifty Percent Endpoints". The American Journal of Hygiene 27: 493-497".

[0116] The results are as follows Figure 8 As shown, compared with the control FMDV, the viral titer of the recombinant FMDV with mutations in the key amino acid sites of the L protein was significantly increased, indicating that mutations in the key amino acid sites of the L protein can increase the viral titer of FMDV.

[0117] The above results show that the replication level of the recombinant foot-and-mouth disease virus with mutations in the key amino acid sites of the L protein will not be inhibited by the host protein CISD2, and the mutation at this key site increases the viral titer and antigen production of the foot-and-mouth disease virus, improves the production performance of the virus, and can be used as a candidate strain for the foot-and-mouth disease virus vaccine.

[0118] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for inhibiting the degradation of foot-and-mouth disease virus L protein by host protein CISD2 and its application in the preparation of improving foot-and-mouth disease virus titer and / or antigen production.

2. A method for constructing a recombinant foot-and-mouth disease virus strain, characterized in that: The method comprises mutating or deleting the amino acid at position 18 and / or position 28 of the L protein in the parent foot-and-mouth disease virus to construct the recombinant foot-and-mouth disease virus strain.

3. The recombinant foot-and-mouth disease virus strain constructed using the construction method described in claim 2.

4. A recombinant foot-and-mouth disease vaccine strain obtained by screening from the recombinant foot-and-mouth disease virus strain according to claim 3.

5. A method for preparing the recombinant foot-and-mouth disease virus strain according to claim 3 or the recombinant foot-and-mouth disease vaccine strain according to claim 4, characterized in that: The following steps are involved: Point mutations are performed on key sites of the L protein of the full-length infectious clone of the parent foot-and-mouth disease virus; a eukaryotic transcription plasmid containing the point mutations is transfected into foot-and-mouth disease virus sensitive cells to obtain a recombinant foot-and-mouth disease virus strain or a recombinant foot-and-mouth disease vaccine strain.

6. Use of the recombinant foot-and-mouth disease vaccine strain according to claim 4 in the preparation of a recombinant foot-and-mouth disease vaccine.

7. A recombinant foot-and-mouth disease vaccine comprising the recombinant foot-and-mouth disease vaccine strain according to claim 4.

8. Use of the recombinant foot-and-mouth disease virus strain according to claim 3 in the preparation of a medicament for preventing and / or controlling animal foot-and-mouth disease.

9. A drug for preventing and / or controlling animal foot-and-mouth disease, characterized in that: The invention comprises the recombinant foot-and-mouth disease virus strain according to claim 3 or the recombinant foot-and-mouth disease vaccine strain according to claim 4 as an antigen component, and also comprises pharmaceutically acceptable excipients.

10. Use of the recombinant foot-and-mouth disease vaccine strain according to claim 4 in the preparation of a medicament for preventing and / or controlling animal foot-and-mouth disease.

Images