Stable passage recombinant foot-and-mouth disease virus strain as well as construction method and application thereof

Abstract

The invention provides a stable passage recombinant foot-and-mouth disease virus strain as well as a construction method and application thereof, and belongs to the technical field of biological medicines. According to the invention, point mutation is introduced into L protein according to the replication inhibition of host cell KRT31 protein on FMDV, so that the ability of the KRT31 protein to degrade the L protein and inhibit the replication of the FMDV is eliminated. The recombinant foot-and-mouth disease virus strain with mutation of the key amino acid site of the L protein is successfully constructed and saved, the mutation site can be stably inherited, the replication of the foot-and-mouth disease virus is not influenced, the virus titer is improved, and the recombinant foot-and-mouth disease virus strain has good production performance and can be used for preparing recombinant foot-and-mouth disease vaccine strains.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to a stably propagated recombinant foot-and-mouth disease virus strain and a construction method and application thereof. Background Art

[0002] Foot-and-mouth disease (FMD) is an acute, febrile and highly contagious disease of even-toed ungulates caused by foot-and-mouth disease virus (FMDV). Characteristic symptoms of infected animals are blisters on the mouth, nose, hoof and nipples of female animals, which rupture to form ulcers or scabs, leading to lameness and lying on the ground, and a significant decline in productivity. In the case of infection in young animals or an epidemic in wild animals, FMD can cause a high mortality rate, which has a huge impact on the international trade of livestock.

[0003] FMDV belongs to the Picornaviridae family and the genus Foot-and-Mouth Disease Virus. Its genome is about 8.0 kb long and is translated into a 5' untranslated region, an open reading frame, and a 3' untranslated region. The open reading frame encodes the nonstructural protein L pro , 4 structural proteins VP4, VP2, VP3 and VP1, and 2A, 2B, 2C, 3A, 3B, 3C pro and 3D pol Nonstructural proteins. Among them, the leader protein L pro It plays an important role in regulating viral replication, virulence and host cell response. By deleting or mutating the L protein, a safer and more effective FMDV vaccine can be developed. In addition, there are complex interactions between host proteins and FMDV proteins, which regulate viral replication and evade host immunity through different mechanisms. In-depth analysis of the interaction mechanism between viral proteins and host proteins and their role in viral replication and immune escape provides important targets for the development of new vaccines and antiviral drugs.

[0004] Reverse genetics technology provides an effective method for studying the genetic structure and function of viruses, viral replication and expression regulation mechanisms, and also provides new technology for reverse genetic vaccine research. Through reverse genetics technology, the transformation and modification of viral genes can be achieved, and strains with expected biological characteristics can be obtained, and production performance, antigen matching, immune response ability and biosafety can be improved. This changes the defects of domesticating epidemic strains into vaccine strains, which are limited by the natural properties of the virus, time-consuming, high-cost and low success rate, and achieves more active and effective vaccine strain construction and improvement, which is of great significance to the overall improvement of vaccine quality and efficacy. Summary of the invention

[0005] The invention provides a stably propagated recombinant foot-and-mouth disease virus strain and a construction method and application thereof. The recombinant foot-and-mouth disease virus strain is not inhibited by a host KRT31 protein, can be stably propagated, and has a high virus titer and antigen yield.

[0006] The invention provides a method for preparing a recombinant foot-and-mouth disease virus strain, comprising eliminating the degradation effect of host KRT31 protein on foot-and-mouth disease virus L protein, or mutating foot-and-mouth disease virus L protein.

[0007] In a preferred embodiment of the present invention, the host KRT31 protein comprises the amino acid sequence shown in SEQ ID No.1.

[0008] In a preferred embodiment of the present invention, the type of mutation includes point mutation or deletion.

[0009] In a preferred embodiment of the present invention, the point mutation comprises point mutation of key amino acid sites of the L protein of foot-and-mouth disease virus.

[0010] In a preferred embodiment of the present invention, the key site includes amino acids 28 and / or 38 of the L protein of foot-and-mouth disease virus.

[0011] In a preferred embodiment of the present invention, the point mutation comprises mutating a key site of the foot-and-mouth disease virus L protein to arginine.

[0012] The present invention also provides a recombinant foot-and-mouth disease virus strain obtained by the above preparation method.

[0013] In a preferred embodiment of the present invention, the amino acid sequence of the L protein in the recombinant foot-and-mouth disease virus strain is any one of the following:

[0014] (1) the amino acid sequence shown in SEQ ID No.6;

[0015] (2) the amino acid sequence shown in SEQ ID No.7;

[0016] (3) retaining the amino acid sequence at position 28 and / or 38 of SEQ ID No. 6 unchanged, and having an amino acid sequence with a homology of more than 85% and similar functions after mutation, deletion or addition at other positions;

[0017] (4) The amino acid sequence at position 28 and / or 38 of SEQ ID No. 7 remains unchanged, and after mutation, deletion or addition at other positions, an amino acid sequence having a homology of more than 85% and a similar function is obtained.

[0018] The present invention also provides a recombinant foot-and-mouth disease vaccine strain screened from the above recombinant foot-and-mouth disease virus strain.

[0019] The present invention also provides a method for preparing the above-mentioned recombinant foot-and-mouth disease virus strain, comprising the following steps:

[0020] (1) constructing a full-length infectious clone of a parent foot-and-mouth disease virus, and performing point mutation on the L protein of the full-length infectious clone of the foot-and-mouth disease virus;

[0021] (2) The obtained eukaryotic transcription plasmid containing L protein mutation is transfected into foot-and-mouth disease virus-sensitive cells to obtain a recombinant foot-and-mouth disease virus strain.

[0022] In a preferred embodiment of the present invention, the source of the parent foot-and-mouth disease virus includes a wild strain of foot-and-mouth disease virus, a recombinant foot-and-mouth disease virus strain or a recombinant foot-and-mouth disease vaccine strain.

[0023] In a preferred embodiment of the present invention, the foot-and-mouth disease virus-sensitive cells include BHK-21 cells or IBRS-2 cells.

[0024] In a preferred embodiment of the present invention, the following steps are included: constructing a full-length infectious clone of the recombinant foot-and-mouth disease vaccine strain, transfecting foot-and-mouth disease virus-sensitive cells, and obtaining the recombinant foot-and-mouth disease vaccine strain.

[0025] In a preferred embodiment of the present invention, the foot-and-mouth disease virus-sensitive cells include BHK-21 cells or IBRS-2 cells.

[0026] The present invention also provides the use of the recombinant foot-and-mouth disease vaccine strain in the preparation of a recombinant foot-and-mouth disease vaccine.

[0027] The present invention also provides the use of the above recombinant foot-and-mouth disease virus strain or the above recombinant foot-and-mouth disease vaccine strain in the preparation of a medicine for preventing and / or controlling animal foot-and-mouth disease.

[0028] In a preferred embodiment of the present invention, the animals include pigs, cattle and sheep.

[0029] Beneficial effects: The present invention first discovered that overexpression of KRT31 in host cells can inhibit the replication of FMDV, and identified the key sites where KRT31 protein degrades L protein and then inhibits viral replication. By introducing amino acid mutations at key sites in L protein, the ability of KRT31 protein to degrade L protein and inhibit FMDV replication can be eliminated. The present invention successfully constructed and rescued a recombinant foot-and-mouth disease virus strain with mutations at key amino acid sites of L protein, and the mutation site can be stably inherited and does not affect the replication of foot-and-mouth disease virus.

[0030] The present invention constructs a recombinant foot-and-mouth disease virus by mutating the key amino acid sites of the L protein, eliminates the ability of KRT31 to inhibit FMDV replication, improves the virus titer, has good production performance, and can be used to prepare a recombinant foot-and-mouth disease vaccine strain. In the embodiment of the present invention, the established reverse genetic operating system with a strong cellular immune response strain is used as a framework, and O / JSCZ / 2013, which has cross-protection against different lineages of O-type FMDV, is screened as an antigen skeleton (disclosed in Chinese patents CN107029231A, CN106916832A and CN107041951A), and the key amino acid sites of the L protein are mutated to construct an O-type recombinant foot-and-mouth disease vaccine strain. The obtained vaccine strain eliminates the ability of KRT31 to inhibit FMDV replication, has the characteristics of high virus titer and good production performance, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the result of Western-blot analysis of the effect of overexpression of KRT31 on FMDV replication;

[0032] Figure 2 This is the result of Western-blot analysis of the effect of KRT31 on the expression of FMDV L protein;

[0033] Figure 3 This is the result of Western-blot analysis of the pathway of KRT31 degradation of FMDV L protein;

[0034] Figure 4 Schematic diagram of the construction of a recombinant foot-and-mouth disease virus with mutations in key amino acid sites of the L protein;

[0035] Figure 5 This is a diagram showing the rescue results of recombinant foot-and-mouth disease virus with mutations in key amino acid sites of L protein; A in the figure: normal control BHK-21 cells; B: cytopathic effect caused by recombinant virus rO-mL(28+38)-FMDV infecting BHK-21 cells;

[0036] Figure 6 This is the result of Western-blot analysis of the effect of KRT31 on the expression of mutant L protein;

[0037] Figure 7 This is a diagram showing the results of Western-blot analysis of the effect of KRT31 on the replication of recombinant foot-and-mouth disease virus. DETAILED DESCRIPTION

[0038] The invention provides a method for preparing a recombinant foot-and-mouth disease virus strain, comprising eliminating the degradation of L protein by host KRT31 protein, or mutating the L protein of FMDV, wherein the host KRT31 protein comprises the amino acid sequence shown in SEQ ID No.1.

[0039] In the embodiments of the present invention, it was found that overexpression of KRT31 in host cells inhibited the abundance of viral proteins of FMDV in a dose-dependent manner. Specifically, the KRT31 degraded the L protein through the proteasome pathway, thereby inhibiting viral replication. The present invention mutates the L protein of the foot-and-mouth disease virus, and the mutation can be a site-directed mutation or a deletion. In one embodiment, the L protein is modified by a site-directed mutation, and the site-directed mutation is a mutation of the 28 and / or 38 sites of the L protein, and one or both of the two sites can be mutated to arginine, expressed as K28R and / or K38R. In one embodiment of the present invention, the 28th K and 38th K of the L protein are all mutated to R, wherein the amino acid sequence of the parent foot-and-mouth disease virus L protein used is shown in SEQ ID No.4, and after the mutation, the amino acid sequence of the mutated L protein can be shown in SEQ ID No.6 or SEQ ID No.7.

[0040] In one embodiment of the present invention, the amino acid sequence of the host KRT31 protein is shown as SEQ ID No.1; the nucleotide sequence encoding the amino acids shown in SEQ ID No.1 is shown as SEQ ID No.2.

[0041] The invention provides a recombinant foot-and-mouth disease virus strain, comprising mutating the L protein of the foot-and-mouth disease virus, wherein the L protein comprises the amino acid sequence shown in SEQ ID No.4.

[0042] In the embodiment of the present invention, the key sites (positions 28 and 38) of KRT31 protein degradation of L protein were identified. By introducing point mutations K28R and K38R into L protein, the ability of KRT31 protein to degrade L protein and inhibit FMDV replication was eliminated. The L protein of the present invention may include the amino acid sequence shown in SEQ ID No.4, or other sequences, such as any amino acid sequence with more than 85% homology and similar functions after one or more amino acid mutations, deletions or additions are performed on the basis of SEQ ID No.4. Of course, because in the art, the amino acid at position 28 of L protein in some foot-and-mouth disease virus strains is not K, therefore, in the present invention, these foot-and-mouth disease virus strains only need to mutate position 38. Wherein SEQ ID No.4; the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.4 is shown in SEQ ID No.3.

[0043] After the point mutations K28R and K38R described in the present invention, the amino acid sequence of the mutated L protein can be as shown in SEQ ID No.6, or as shown in SEQ ID No.7, or any amino acid sequence having a homology of more than 85% and similar functions after one or more amino acid mutations, deletions or additions are made on the basis of SEQ ID No.6 or SEQ ID No.7. Among them, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.6 is shown in SEQ ID No.5.

[0044] The invention also provides a recombinant foot-and-mouth disease vaccine strain screened from the recombinant foot-and-mouth disease virus strain.

[0045] The present invention also provides a method for preparing the above-mentioned recombinant foot-and-mouth disease virus or recombinant foot-and-mouth disease vaccine strain, comprising the following steps: (1) constructing a full-length infectious clone of foot-and-mouth disease virus, and performing point mutation on the L protein of the full-length infectious clone of foot-and-mouth disease virus;

[0046] (2) The obtained eukaryotic transcription plasmid containing L protein mutation is transfected into foot-and-mouth disease virus-sensitive cells to obtain a recombinant foot-and-mouth disease virus strain.

[0047] The present invention does not specifically limit the method for constructing the full-length infectious clone of the foot-and-mouth disease virus, wherein the foot-and-mouth disease virus can be a wild strain of foot-and-mouth disease virus known in the art or a recombinant virus obtained by genetically modifying the wild strain of foot-and-mouth disease virus, especially the amino acid sequence of the L protein does not contain K38R.

[0048] The present invention obtains the recombinant foot-and-mouth disease virus or recombinant foot-and-mouth disease vaccine strain by reverse genetic technology, and the method for rescuing the virus is not particularly limited. The foot-and-mouth disease virus sensitive cells of the present invention include BHK-21 cells or IBRS-2 cells.

[0049] The present invention also provides the use of the recombinant foot-and-mouth disease virus or the recombinant foot-and-mouth disease vaccine strain in the preparation of a recombinant foot-and-mouth disease vaccine.

[0050] The present invention eliminates the ability of KRT31 protein to degrade L protein and inhibit FMDV replication by introducing point mutations K28R and K38R into L protein; a recombinant foot-and-mouth disease virus strain containing the mutant L protein is constructed and rescued by reverse genetic technology, and the mutation site can be stably inherited and does not affect the replication of foot-and-mouth disease virus. The recombinant foot-and-mouth disease virus or recombinant foot-and-mouth disease vaccine strain constructed by the method of the present invention has improved virus titer and antigen content, has good production performance, and can be used to prepare a recombinant foot-and-mouth disease vaccine.

[0051] The present invention also provides the use of the recombinant foot-and-mouth disease virus or the recombinant foot-and-mouth disease vaccine strain in the preparation of a medicine for preventing and / or controlling animal foot-and-mouth disease.

[0052] In a preferred embodiment of the present invention, the animals include pigs, cattle and sheep.

[0053] To further illustrate the present invention, a stably propagated recombinant foot-and-mouth disease virus strain, a construction method and an application provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0054] The experimental methods used in the examples of the present invention are conventional methods unless otherwise specified; the experimental materials used in the examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0055] The relevant experiments involved in the embodiments of the present invention have all obtained biosafety permits and foot-and-mouth disease laboratory activity permits: The Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences has obtained the Ministry of Agriculture and Rural Affairs' permission to conduct research on highly pathogenic FMDV pathogens and animals, in accordance with the relevant requirements of biosafety level 3 laboratories (BSL-3) and foot-and-mouth disease-related biosafety, and has been reported step by step by the Biosafety Committee of the Lanzhou Veterinary Research Institute, the Biosafety Committee of the Chinese Academy of Agricultural Sciences, and the Experimental Animal Ethics Committee of the Lanzhou Veterinary Research Institute. It has been filed with the Ministry of Agriculture and Rural Affairs and meets the national biosafety level requirements.

[0056] The FMDV (O / BY / CHA / 2010 strain, O / GD / CHA / 2015 strain) used in the embodiments of the present invention is preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Ministry of Agriculture and Rural Affairs, and the public can obtain it through a letter of entrustment approved by the Veterinary Bureau of the Ministry of Agriculture and Rural Affairs; MG132 was purchased from Merck, and NH4Cl and Z-VAD-FMK were purchased from Sigma-Aldrich; and the amino acid sequence of the KRT31 protein involved in the experiment is shown in SEQ ID No.1, and its nucleotide sequence is shown in SEQ ID No.2.

[0057] In the examples of the present invention, the construction method of the recombinant plasmid prO-FMDV used has been disclosed in Chinese patents CN106916832A, CN106916832A and CN107041951A, and the entire contents of the patents are incorporated into the present invention by reference.

[0058] Example 1 Effect of overexpression of KRT31 on FMDV replication

[0059] 1.1 Construction of KRT31 eukaryotic expression plasmid

[0060] The KRT31 gene sequence was queried in the NCBI database and primers were designed. The underlined parts in the primers are restriction sites:

[0061] KRT31-NheI-F (SEQ ID NO. 14): CGTCTA GCTAGC ATGCCTTACAGCTT CTGCCTGCCC;

[0062] KRT31-HindIII-R(SEQ ID NO.15):CCC AAGCTT GCGCACAAAGGAGC TGCAGGG.

[0063] RNA of PK-15 cells was extracted and reverse transcribed into cDNA, and the cDNA was used as a template to amplify the KRT31 gene (the nucleotide sequence is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.1), the amplified fragment was recovered by nucleic acid electrophoresis, double-digested with NheI and HindIII restriction endonucleases, and the pcDNA3.1 / myc vector plasmid was double-digested with the same restriction endonucleases, the KRT31 gene and the pcDNA3.1 / myc linearized vector fragment were purified and recovered respectively, connected at 4°C overnight with T4 ligase, transformed into DH5α competent cells, the plasmid was extracted and sequenced, and the successfully constructed plasmid was named KRT31-Myc.

[0064] 1.2 Effect of KRT31 overexpression on FMDV replication

[0065] PK-15 cells were inoculated into 6-well plates and cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%. Different doses of KRT31 eukaryotic expression plasmid KRT31-Myc (0 μg, 1 μg and 2 μg) were transfected. After 24 hours, FMDV (O / BY / CHA / 2010 strain) was infected and Western-blot analysis was performed.

[0066] The results are as follows Figure 1 As shown, overexpression of KRT31 in PK-15 cells inhibited the abundance of FMDV viral proteins in a dose-dependent manner.

[0067] Example 2 Effect of KRT31 on FMDV L protein expression

[0068] 2.1 Construction of Flag-L plasmid

[0069] The FMDV L gene sequence was queried from the NCBI database (the nucleotide sequence is shown in SEQ ID No.3, and the amino acid sequence is shown in SEQ ID No.4), and primers were designed. The underlined parts in the primers are restriction sites:

[0070] L-EcoRI-F (SEQ ID No. 8): CGC GAATTC AATGAACACGACTGACTGTTTCATC;

[0071] L-BamHI-R (SEQ ID No. 9): CGC GGATCC TTACCTGAGTCGTTTTTGAACCTTTG.

[0072] RNA of O / GD / CHA / 2015 strain was extracted and synthesized into cDNA by reverse transcription. The L gene shown in SEQ ID No.3 was amplified using cDNA as a template. The amplified fragment was recovered by nucleic acid electrophoresis and double-digested with EcoRI and BamHI restriction endonucleases. At the same time, the p3×FLAG-CMV-7.1 vector plasmid was double-digested with the same restriction endonucleases, and the L gene and the linearized vector fragment were purified and recovered respectively. The fragments were ligated at 4°C overnight with T4 ligase and transformed into DH5α competent cells. A single clone was picked, the cells were shaken, the plasmid was extracted and sequenced, and the successfully constructed plasmid was named L-Flag.

[0073] 2.2 Effect of KRT31 on FMDV L protein expression

[0074] HEK293T cells were inoculated into 6-well plates and cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%. The cells were transfected with the FMDV L protein eukaryotic expression plasmid L-Flag and different doses of the KRT31 eukaryotic expression plasmid KRT31-Myc (0 μg, 0.5 μg and 1 μg), and the samples were collected for Western-blot analysis.

[0075] The results are as follows Figure 2 As shown, KRT31 decreased the expression of FMDV L protein in a dose-dependent manner, indicating that KRT31 inhibited the expression of L protein and thus inhibited the replication of FMDV.

[0076] HEK293T cells were co-transfected with the L protein eukaryotic expression plasmid L-Flag and the KRT31 eukaryotic expression plasmid KRT31-Myc. After 16 hours of transfection, the proteasome inhibitor MG132, the lysosome inhibitor NH4Cl and the apoptosis inhibitor Z-VAD-FMK were added respectively. After culturing for another 8 hours, the cells were harvested and analyzed by Western-blot.

[0077] The results are as follows Figure 3 The results showed that the degradation of L protein induced by KRT31 was inhibited by MG132, indicating that KRT31 caused the degradation of L protein through the proteasome pathway.

[0078] Example 3 Method for constructing a eukaryotic expression plasmid of a mutant of a key amino acid site of a L protein

[0079] On the basis of Example 1, the L protein of FMDV was mutated to construct a eukaryotic expression plasmid of the L protein mutant. The method described in this example can also be used to construct a eukaryotic expression plasmid of the L protein mutant of other foot-and-mouth disease virus strains. The specific process is as follows:

[0080] On the basis of the wild-type FMDV L protein eukaryotic expression plasmid L-Flag (nucleotide sequence as shown in SEQ ID No.3), the coding sequence of lysine at positions 28 and 38 of the L protein was mutated to arginine (nucleotide sequence as shown in SEQ ID No.5, amino acid sequence as shown in SEQ ID No.6) by gene synthesis technology or point mutation technology, DH5α competent cells were transformed, single clones were picked, the bacteria were shaken, the plasmid was extracted and sequenced, and it was confirmed that the mutation of amino acid sites at positions 28 and 38 of the L protein was successful, and the key amino acid mutation plasmid was named L-Flag-(28+38)R.

[0081] Example 4 Construction and identification of recombinant O-type foot-and-mouth disease virus with L protein mutation

[0082] 4.1 Construction of recombinant O-type foot-and-mouth disease virus infectious clone

[0083] The L gene fragment in the recombinant plasmid prO-FMDV containing the L gene, P1 gene and P2 gene of the O / JSCZ / 2013 strain was digested with KpnI to recover the large vector fragment, and the gene fragment containing the mutation of the key site of the L gene was amplified by PCR using the plasmid as a template. The homologous recombination mutation primers are:

[0084] KpnI-F (SEQ ID No. 10): 5'-TAAGGATGCCCTTCAGGTACCCTGAGGT AACACGCGACACTCG-3';

[0085] mL2838-R (SEQ ID No. 11): 5'-CGTTGTGAAGTGTGAACTCCATCCTTCCTTGTGCTCGTGATAAGAACA-3';

[0086] mL2838-F (SEQ ID No. 12): 5'-GTTCACACTTCACAACGGTGAGAGGAAAACATTCTACTCCAGGCCCA-3';

[0087] KpnI-R (SEQ ID No. 13): 5'-ATGGAACAAAGTTCAGGTACCATGGCCACC AGTAGGCAGC-3'.

[0088] The PCR amplification products were recovered and homologously recombined with the recovered vector fragments to obtain a recombinant plasmid in which both positions 28 and 38 of the L gene were mutated to arginine. HSDNA polymerase was used to prepare 50 μL reaction system according to the product manual. The amplification conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 1 min, 30 cycles; 4°C for 5 min. Homologous recombination was performed using Novazon Ultra One Step Cloning Kit, 50℃ for 15min, transform DH5α competent cells, pick single clone colonies, shake to extract plasmids, and sequence to identify positive clones. Finally, the recombinant plasmid prO-mL(28+38)-FMDV containing L gene mutation was obtained. The construction diagram is shown in the figure. Figure 4 shown.

[0089] 4.2 Rescue of recombinant viruses

[0090] The recombinant plasmid prO-mL(28+38)-FMDV prepared in 4.1 was purified by Polyplus Transfection reagent instructions: When BHK-21 cells grow to about 70%, transfect BHK-21 cells with the recombinant plasmid. At the same time, set up normal cell controls and transfection reagent controls, place them in a 37°C, 5% CO2 incubator, observe the cell status, and harvest the virus when the cells show about 90% cytopathic effect. After repeated freezing and thawing for 3 times, inoculate BHK-21 cells again until the virus can stably produce cytopathic effect, that is, the cells become round, aggregate into grape-like distribution, and finally the cells collapse. The cytopathic effect caused by the O-type recombinant foot-and-mouth disease virus strain is as follows: Figure 5 As shown, it was named rO-mL(28+38)-FMDV.

[0091] 4.3 RT-PCR identification of recombinant virus

[0092] The supernatant of BHK-21 cells infected with the stably passaged recombinant virus rO-mL(28+38)-FMDV was used to extract total RNA using Trizol. After reverse transcription, the gene fragment containing L was amplified using KpnI-F (SEQ ID No.10) and KpnI-R (SEQ ID No.13). After purification and recovery, it was sent for sequencing. The results showed that the L gene of the obtained recombinant O-type foot-and-mouth disease virus was consistent with the theoretical sequence, and the amino acids at positions 28 and 38 were arginine. The amino acids encoded by the mutated L gene were the amino acid sequence shown in SEQ ID No.7.

[0093] Example 5 Effect of KRT31 protein on the replication of recombinant foot-and-mouth disease virus with mutations in key amino acid sites of L protein

[0094] 5.1 Effect of KRT31 on the expression of L protein with key site mutations

[0095] HEK293T cells were inoculated into 6-well plates and cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%. The cells were co-transfected with the FMDV L protein key site mutant eukaryotic expression plasmid L-Flag-(28+38)R and different doses of KRT31 eukaryotic expression plasmid KRT31-Myc (0 μg, 1 μg, 2 μg), and the samples were collected for Western-blot analysis.

[0096] The results are as follows Figure 6 As shown, KRT31 overexpression did not affect the expression level of mutant L protein.

[0097] 5.2 Effect of KRT31 on the replication of recombinant foot-and-mouth disease virus with mutations at key sites of L protein

[0098] PK-15 cells were inoculated into 6-well plates, cultured in a 37°C, 5% CO2 cell culture incubator to a cell density of about 70%, and transfected with different doses of KRT31 eukaryotic expression plasmid KRT31-Myc (0 μg, 1 μg, 2 μg). After 24 hours, they were infected with the recombinant foot-and-mouth disease virus strain rO-mL(28+38)-FMDV with mutations in the key amino acid sites of the L protein, and Western-blot analysis was performed.

[0099] The results are as follows Figure 7 As shown, overexpression of KRT31 in PK-15 cells has no effect on the abundance of viral proteins of the recombinant virus rO-mL(28+38)-FMDV. Combined with Example 1, it is shown that overexpression of KRT31 inhibits the replication of wild-type FMDV in a dose-dependent manner, but cannot inhibit the replication of the recombinant virus rO-mL(28+38)-FMDV with L protein mutation. Therefore, the recombinant foot-and-mouth disease virus can be used as a seed virus for foot-and-mouth disease virus vaccine, improve the virus titer and antigen content, and improve the virus production performance.

[0100] Example 6 Pathogenicity test of recombinant foot-and-mouth disease virus on BHK-21 cells

[0101] BHK-21 cells were inoculated into 12-well culture plates, and the virus titer of the recombinant FMDV with L protein mutation was measured when the cells grew into a monolayer. The virus solution was diluted 10 times in a row with DMEM medium, and each dilution (10 -4.0 ~10 -9.0) The virus solution was added to the culture plate, 4 wells for each dilution, and the plate was placed in a 37°C, 5% CO2 incubator for 3 days to observe the cytopathic effect. The TCID of the virus was calculated using the Reed-Muench method (Reed, LJ and Muench, H. (1938). "A Simple Method of Estimating Fifty Percent Endpoints". The American Journal of Hygiene 27: 493-497) described in the literature. 50 .

[0102] After calculation, the TCID 50 For 10 -8.5 / mL, indicating that the recombinant FMDV with mutations in key amino acid sites of L protein has the characteristic of high virus titer.

[0103] The above results show that the replication level of the recombinant foot-and-mouth disease virus with mutations in the key amino acid sites of the L protein will not be inhibited by the host protein KRT31, and the mutation at this key site significantly increases the viral titer and antigen production of the foot-and-mouth disease virus, improves the production performance of the virus, and can be used as a candidate strain for the foot-and-mouth disease virus vaccine.

[0104] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for preparing a recombinant foot-and-mouth disease virus strain, characterized in that: The method includes eliminating the degradation effect of the host KRT31 protein on the foot-and-mouth disease virus L protein, or mutating the foot-and-mouth disease virus L protein.

2. The preparation method according to claim 1, characterized in that: The types of mutations include point mutations or deletions.

3. A recombinant foot-and-mouth disease virus strain obtained by the preparation method according to claim 1 or 2.

4. The recombinant foot-and-mouth disease virus strain according to claim 3, characterized in that: The amino acid sequence of the L protein in the recombinant foot-and-mouth disease virus strain is any one of the following: (1) the amino acid sequence shown in SEQ ID No.6; (2) the amino acid sequence shown in SEQ ID No.7; (3) retaining the amino acid sequence at position 28 and / or 38 of SEQ ID No. 6 unchanged, and having an amino acid sequence with a homology of more than 85% and similar functions after mutation, deletion or addition at other positions; (4) The amino acid sequence at position 28 and / or 38 of SEQ ID No. 7 remains unchanged, and after mutation, deletion or addition at other positions, an amino acid sequence having a homology of more than 85% and a similar function is obtained.

5. A recombinant foot-and-mouth disease vaccine strain selected from the recombinant foot-and-mouth disease virus strain according to claim 3 or 4.

6. The method for preparing the recombinant foot-and-mouth disease virus strain according to claim 3 or 4, characterized in that: The following steps are involved: (1) constructing a full-length infectious clone of a parent foot-and-mouth disease virus, and performing point mutation on the L protein of the full-length infectious clone of the foot-and-mouth disease virus; (2) The obtained eukaryotic transcription plasmid containing L protein mutation is transfected into foot-and-mouth disease virus-sensitive cells to obtain a recombinant foot-and-mouth disease virus strain.

7. The preparation method according to claim 6, characterized in that: The sources of the parent foot-and-mouth disease virus include wild strains of foot-and-mouth disease virus, recombinant foot-and-mouth disease virus strains or recombinant foot-and-mouth disease vaccine strains.

8. The method for preparing the recombinant foot-and-mouth disease vaccine strain according to claim 5, characterized in that: The following steps are involved: The full-length infectious clone of the recombinant foot-and-mouth disease vaccine strain is constructed and transfected into foot-and-mouth disease virus-sensitive cells to obtain the recombinant foot-and-mouth disease vaccine strain.

9. Use of the recombinant foot-and-mouth disease vaccine strain according to claim 5 in the preparation of a recombinant foot-and-mouth disease vaccine.

10. Use of the recombinant foot-and-mouth disease virus strain according to claim 3 or 4 or the recombinant foot-and-mouth disease vaccine strain according to claim 5 in the preparation of a medicament for preventing and / or controlling animal foot-and-mouth disease.

Images