Method for converting D-fructose in jujube into D-psicose by immobilized enzyme, jujube juice containing D-psicose and application of jujube juice

Abstract

The invention provides a method for converting D-fructose in jujubes into D-psicose by immobilized enzyme, jujube juice containing D-psicose and application, and particularly belongs to the technical field of beverage preparation. The method for converting the D-fructose in the jujubes into the D-psicose by the immobilized enzyme comprises the following steps: mixing the immobilized D-psicose-3-epimerase with jujube juice, carrying out sugar conversion, centrifuging and discarding precipitate to obtain jujube juice containing the D-psicose; the nucleotide sequence of the gene for coding the D-psicose-3-epimerase is as shown in SEQ ID NO. 1 (sequence identifier number 1). According to the method disclosed by the invention, the D-fructose in the jujubes can be effectively converted into the D-psicose.

Description

Technical Field

[0001] The invention belongs to the technical field of beverage preparation, and particularly relates to a method for converting D-fructose in jujube into D-psicose by using an immobilized enzyme, jujube juice containing D-psicose and application thereof. Background Art

[0002] Jujube, as a food that can be used as both medicine and food, has a good health-care effect. The main sugars in jujube are D-glucose (10-30%), D-fructose (12-27%) and sucrose (15-66%). The high sugar content makes it unsuitable for people with high blood sugar to eat. D-psicose is the C3 diastereomer of D-fructose, a non-natural sugar with a very low content in nature. It has 70% of the sweetness of sucrose and only 0.3% of the energy, making it a suitable sucrose substitute in food. Due to its extremely low content in nature, it is a feasible method to use enzymes to catalyze the conversion of D-fructose in jujube into D-psicose. However, there is currently a lack of a method that can effectively convert D-fructose into D-psicose. Summary of the invention

[0003] The purpose of the present invention is to provide a method for converting D-fructose in jujube into D-psicose using an immobilized enzyme, and jujube juice containing D-psicose and its application. The method of the present invention can effectively convert D-fructose in jujube into D-psicose.

[0004] The present invention provides a method for converting D-fructose in jujube into D-psicose by using an immobilized enzyme, comprising the following steps:

[0005] The immobilized D-psicose-3-epimerase is mixed with jujube juice, sugar conversion is performed, and the precipitate is discarded by centrifugation to obtain jujube juice containing D-psicose; the nucleotide sequence of the gene encoding the D-psicose-3-epimerase is shown in SEQ ID NO.1.

[0006] Preferably, the temperature of the sugar conversion is 45-60°C; and the time of the sugar conversion is 2-6 hours.

[0007] Preferably, the immobilized D-psicose-3-epimerase is expressed and immobilized based on a bacterial enhanced matrix and a Lactococcus lactis peptidoglycan hydrolase expression system.

[0008] Preferably, the method for immobilizing D-psicose-3-epimerase comprises the following steps:

[0009] constructing the gene encoding the D-psicose-3-epimerase into a plasmid with a Lactococcus lactis peptidoglycan hydrolase tag to obtain a recombinant plasmid;

[0010] The recombinant plasmid is transformed into Escherichia coli, cultured, induced, the bacteria are collected, ultrasonically disrupted, and centrifuged to obtain the supernatant to obtain a crude enzyme solution of D-psicose-3-epimerase;

[0011] The obtained crude D-psicose-3-epimerase enzyme solution was immobilized using a bacteria-enhanced matrix purification method to obtain immobilized D-psicose-3-epimerase.

[0012] Preferably, the plasmid comprises pET-32a.

[0013] Preferably, the immobilization method comprises: mixing the bacterial enhancement matrix with the crude D-psicose-3-epimerase enzyme solution, centrifuging to obtain a precipitate after combining, and washing.

[0014] Preferably, the binding time is 30 to 60 minutes.

[0015] Preferably, the temperature of the combination is 0-4°C.

[0016] The present invention also provides jujube juice containing D-psicose prepared by the method described in the above technical scheme.

[0017] The present invention also provides the use of immobilized D-psicose-3-epimerase in increasing the D-psicose content in jujube juice. The nucleotide sequence of the gene encoding the D-psicose-3-epimerase is shown in SEQ ID NO.1.

[0018] The present invention provides a method for converting D-fructose in jujube into D-psicose by using an immobilized enzyme. The present invention develops a method for efficiently converting D-fructose into D-psicose, which reduces the sugar content and can be converted into D-psicose without affecting other nutrients, which helps to promote it among a wider population. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0020] Figure 1 A comparison diagram of the nucleotide sequences before and after codon optimization provided by the present invention;

[0021] Figure 2 A comparison diagram of the amino acid sequences before and after codon optimization provided by the present invention;

[0022] Figure 3The SDS-PAGE result diagram of protein expression before and after codon optimization provided by the present invention;

[0023] Figure 4 This is a diagram showing the results of SDS-PAGE analysis after induction of the recombinant bacteria provided by the present invention;

[0024] Figure 5 This is a diagram showing the results of SDS-PAGE analysis of the recombinant bacteria provided by the present invention;

[0025] Figure 6 A result graph of D-psicose generated by high performance liquid chromatography detection provided by the present invention;

[0026] Figure 7 This is a graph showing the effect of adding D-psicose-3-epimerase provided by the present invention to jujube juice on its sensory quality;

[0027] Figure 8 This is a graph showing the optimum temperature results for the immobilized enzyme provided by the present invention. DETAILED DESCRIPTION

[0028] The present invention provides a method for converting D-fructose in jujube into D-psicose by using an immobilized enzyme, comprising the following steps:

[0029] The immobilized D-psicose-3-epimerase is mixed with jujube juice, sugar conversion is performed, and the precipitate is discarded by centrifugation to obtain jujube juice containing D-psicose; the nucleotide sequence of the gene encoding the D-psicose-3-epimerase is shown in SEQ ID NO.1.The nucleotides of the D-psicose-3-epimerase gene of the present invention are codon-optimized according to the characteristics of Escherichia coli. The original sequence has a low expression level in Escherichia coli, and the expression level of the optimized sequence in Escherichia coli is significantly increased, as shown in the SDS-PAGE results. Figure 3 shown.

[0030] In a specific embodiment, the temperature of the sugar conversion is 45-60°C, specifically 55°C. Test results show that the relative enzyme activity can be maintained at more than 90% between 45-60°C, and the enzyme activity is highest at 55°C. In a specific embodiment, the time of the sugar conversion is 2-6h, specifically 4 or 6h. Test results show that the conversion rate is 20% at 2h, 26% at 4h, and 30% at 6h. In a specific embodiment, the concentration of the immobilized enzyme during the sugar conversion process is 0.01mg / ml.

[0031] In a specific embodiment, the immobilized D-psicose-3-epimerase is expressed and immobilized based on a bacterial enhanced matrix and a lactococcus lactis peptidoglycan hydrolase expression system. In a specific embodiment, the method for immobilizing D-psicose-3-epimerase comprises the following steps: constructing a gene encoding the D-psicose-3-epimerase into a plasmid with a Lactococcus lactis peptidoglycan hydrolase tag to obtain a recombinant plasmid; transforming the recombinant plasmid into Escherichia coli, culturing, inducing, collecting bacteria, ultrasonically disrupting, centrifuging and obtaining a supernatant to obtain a crude enzyme solution of D-psicose-3-epimerase; and immobilizing the obtained crude enzyme solution of D-psicose-3-epimerase using a bacterial enhanced matrix to purify the immobilized enzyme to obtain immobilized D-psicose-3-epimerase.

[0032] The present invention constructs the gene encoding the D-psicose-3-epimerase into a plasmid with a Lactococcus lactis peptidoglycan hydrolase tag to obtain a recombinant plasmid. In a specific embodiment, the plasmid includes pET-32a. In a specific embodiment, the plasmid with a Lactococcus lactis peptidoglycan hydrolase tag is constructed with reference to an article entitled "Study on Recombinant Protein Purification and Immobilization Method Based on BEM and AcmA Expression System" published by Zhao Fangkun in Tianjin University.

[0033] After obtaining the recombinant plasmid, the present invention transforms the recombinant plasmid into Escherichia coli, cultures, induces, collects the bacteria, ultrasonically breaks, and centrifuges to obtain the supernatant to obtain a crude enzyme solution of D-psicose-3-epimerase. In a specific embodiment, the induction temperature is 16 to 37°C, specifically 16°C, 25°C or 37°C. When the induction temperature is 16°C, the D-fructose reduction rate is the highest. In a specific embodiment, the culture conditions are 37°C, 200rpm. In a specific embodiment, the ultrasonic conditions are: power 60w, total ultrasonic time 15min, on 2s, off 2s, 4°C. In a specific embodiment, the centrifugation conditions are: 4°C, 8000rpm, 15min.

[0034] After obtaining the crude enzyme solution of D-psicose-3-epimerase, the present invention uses a method for purifying immobilized enzymes using a bacterial enhanced matrix to immobilize the obtained crude enzyme solution of D-psicose-3-epimerase to obtain immobilized D-psicose-3-epimerase. In a specific embodiment, the immobilization method includes: mixing the bacterial enhanced matrix with the crude enzyme solution of D-psicose-3-epimerase, centrifuging to obtain a precipitate after combining, and washing. In a specific embodiment, the combining time is 30 to 60 minutes. In a specific embodiment, the combining temperature is 0 to 4°C.

[0035] The method of the present invention uses an immobilized enzyme to synthesize and convert sugars, reduces the complexity of the isolated enzyme, and retains the catalytic efficiency of the enzyme. The obtained jujube juice has a reduced content of available sugars and a high content of rare sugar D-psicose, which ensures the sweetness of the jujube juice and enables the jujube juice to be promoted to a wider range of people.

[0036] The present invention also provides jujube juice containing D-psicose prepared by the method described in the above technical solution. The present invention uses an immobilized enzyme to convert D-fructose in the jujube juice into D-psicose, and removes the enzyme by centrifugation after the reaction. The jujube juice of the present invention reduces the available sugar and generates rare sugar, thereby ensuring the sweetness of the jujube juice and promoting it to a wider range of people.

[0037] The present invention also provides the use of immobilized D-psicose-3-epimerase in increasing the D-psicose content in jujube juice. The nucleotide sequence of the gene encoding the D-psicose-3-epimerase is shown in SEQ ID NO.1.

[0038] To further illustrate the present invention, a method for converting D-fructose in jujube into D-psicose using an immobilized enzyme, jujube juice containing D-psicose, and applications provided by the present invention are described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] The content of the enzyme reaction product was determined by high performance liquid chromatography, and then the recombinant enzyme activity was calculated. Chromatographic column model: NH2P-504E; column temperature: 30°C; detector: evaporative light scattering detector; mobile phase: acetonitrile: water 75:25; flow rate: 0.8 mL / min; injection volume: 8 μL.

[0040] Example 1

[0041] 1) Selection of D-psicose-3-epimerase (DFAP)

[0042] Suzhou Jinweizhi Co., Ltd. synthesized the DFAP encoding Sinorhizobium (protein sequence accession number: WP_010974125.1), codon optimized according to the characteristics of Escherichia coli, and added restriction sites EcoRI and HindIII to both ends of the target gene fragment during the synthesis process.

[0043] The nucleotide sequence is shown in SEQ ID NO.1:

[0044] AAACACGGCATCTACTACTCCTACTGGGAGCACGAATGGTCCGCTAAATTCGGCCCGTACATTGAAAAAGTAGCGAAACTGGGCTTTGATATCATCGAGGTCGCAGCACATCACATCAATGAATACTCCGATGCCGAACTGGCTACCATTCGCAAGTCTGCCAAAGACAACGGTATCATCCTGACCGCGGGTATCGGCCCGAGCAAGACTAAAAACCTGTCCAGCGAAGACGCGGCGGTTCGTGCGGCTGGTAAAGCATTTTTCGAACGTACTCTGAGCAACGTTGCGAAACTGGACATTCATACCATCGGCGGTGCGCTGCACAGCTACTGGCCGATCGATTACTCCCAGCCAGTAGATAAAGCAGGTGACTACGCGCGTGGCGTGGAAGGCATCAACGGCATCGCAGATTTCGCTAACGACCTGGGCATCAACCTGTGCATCGAAGTTCTGAACCGTTTTGAAAACCACGTACTGAACACTGCCGCGGAGGGCGTTGCCTTTGTGAAAGACGTGGGCAAAAACAACGTCAAAGTCATGCTGGACACTTTTCACATGAACATCGAAGAAGATAGCTTCGGTGACGCCATCCGTACCGCGGGCCCGCTGCTGGGTCACTTCCATACGGGTGAATCCAACCGTCGTGTGCCGGGCAAAGGTCGTATGCCATGGCACGAAATCGGCCTGGCGCTGCGTGACATCAATTATACTGGTGCGGTAATTATGGAACCGTTCGTTAAAACCGGCGGTACCATCGGCTCCGATATCAAAGTTTGGCGTGATCTGTCTGGCGGCGCGGATATCGCTAAAATGGATGAAGATGCACGTAATGCCCTGGCATTCTCTCGTTTCGTGCT GGGCGGT。

[0045] The nucleotide sequence before optimization is shown in SEQ ID NO.2: AAACATGGTATTTATTATTCTTATTGGGAACATGAATGGTCTGCTAAATTTGGTCCATATATTGAAAAAGTTGCTAAGTTGGGTTTTGATATTATTGAAGTTGCTGCTCATCATATTAATGAATATTCTGATGCTGAATTGGCTACTATTAGAAAATCTGCTAAAGATAATGGTATTATTTTGACTGCTGGTATTGGTCCATCTAAAACTAAAAATTTGTCTTCTGAAGATGCTGCTGTTAGAGCTGCTGGTAAGGCTTTTTTTGAAAGAACTTTGTCTAATGTTGCTAAATTGGATATTCATACTATTGGTGGTGCTTTGCATTCTTATTGGCCAATTGATTATTCTCAACCTGTTGATAAAGCTGGTGATTATGCTAGAGGTGTTGAAGGTATTAATGGTATTGCTGATTTCGCTAATGATTTGGGAATCAATTTGTGTATTGAAGTTTTGAACAGATTTGAAAATCATGTTTTGAATACTGCTGCTGAAGGAGTTGCATTTGTCAAAGATGTTGGTAAAAACAATGTTAAAGTTATGTTAGATACTTTTCATATGAACATCGAAGAAGATTCTTTTGGTGATGCTATTAGAACTGCTGGTCCATTGTTGGGTCATTTTCATACTGGTGAATCTAATAGAAGAGTTCCTGGTAAAGGTAGAATGCCATGGCATGAAATTGGTTTGGCTTTGAGAGATATTAATTATACTGGTGCTGTTATTATGGAACCATTTGTTAAAACTGGTGGTACTATTGGTTCTGATATTAAAGTTTGGAGAGATTTGTCTGGTGGTGCTGATATTGCTAAAATGGATGAAGATGCTAGAAATGCTTTGGCTTTTTCTAGATTTGTTTTGGGTGGT. The amino acid sequences before and after optimization are the same, for example, SEQ ID NO.3: KHGIYYSYWEHEWSAKFGPYIEKVAKLGFDIIEVAAHHINEYSDAELATIRKSAKDNGIILTAGIGPSKTKNLSSEDAAVRAAGKAFFERTLSNVAKLDIHTIGGALHSYWPIDYSQPVDKAGDYARGVEGINGIADFANDLGINLCIEVLNRFENHVLNTAAEGVAFVKDVGKNNVKVMLDTFHMNIEEDSFGDAIRTAGPLLGHFHTGESNRRVPGKGRMPWHEIGLALRDINYTGAVIMEPFVKTGGTIGSDIKVWRDLSGGADIAKMDEDARNALAFSRFVLGG. Comparison of nucleotide sequences before and after optimization. Figure 1 As shown, the comparison of amino acid sequences before and after optimization is as follows Figure 2 shown.

[0046] The target gene fragment was then connected to the vector pET-32a-AcmA using a restriction endonuclease to obtain a recombinant plasmid (the specific method is the same as in Example 2). Referring to the article "Research on the purification and immobilization method of recombinant protein based on BEM and AcmA expression system" published by Zhao Fangkun in Tianjin University, pET-32a-AcmA was constructed. The protein expression method was the same as in Example 2, and the induction temperature was 16°C.

[0047] SDS-PAGE of protein expression before and after codon optimization Figure 3 As shown: the left figure shows the expression of DFAP before optimization, 1 is the whole bacteria before induction, 2 is the whole bacteria after induction. It can be seen from the figure that the expression of DFAP is low before the codon is optimized; the right figure shows the expression of DFAP after optimization, 1 is the whole bacteria before induction, 2 is the whole bacteria after induction, Figure 3 It can be seen that after codon optimization, the expression level of DFAP was significantly increased at around 50KDa.

[0048] After being immobilized with BEM (the immobilization method was the same as in Example 3, and the BEM granule precipitate was combined with the crude enzyme solution on ice for 30 minutes), the jujube juice was added for sugar conversion, and the contents of D-fructose and D-psicose before and after the conversion were determined. At 55°C, the D-fructose content in the jujube was reduced by 30% after 6 hours of reaction.

[0049] Example 2

[0050] Construction of pET-32a-AcmA-DFAP recombinant plasmid

[0051] The gene optimized in Example 1 and plasmid pET-32a-AcmA were cut with restriction endonucleases EcoRI and HindIII, ligated and transformed to obtain pET-32a-AcmA-DFAP.

[0052] Recombinant expression of D-psicose-3-epimerase with AcmA tag

[0053] The recombinant plasmid pET-32a-AcmA-DFAP was transformed into Escherichia coli BL21 competent cells and cultured in LB medium containing 50 mg / L of ampicillin. IPTG was used to induce expression, and 37°C, 25°C, and 16°C were selected as the induction temperature for optimization. After the expression, the bacteria were collected for ultrasonic disruption and centrifugation to collect the supernatant to obtain a crude enzyme solution. Figure 4 The figure shows the results of SDS-PAGE analysis after induction of recombinant bacteria; M: Marker; 1: bacterial solution before induction; 2: bacterial solution after induction; 3: ultrasonic precipitation; 4: ultrasonic supernatant. Figure 4 It can be seen that after induction, DFAP was successfully expressed, and after ultrasonic disruption, DFAP was mainly present in the ultrasonic supernatant, that is, the crude enzyme solution, which can be used for subsequent immobilization purification.

[0054] After immobilization with BEM (the specific method is the same as in Example 3, and the binding time is 30 minutes), sugar conversion in jujube juice was carried out (sugar conversion conditions are 55°C, 6 hours), and the D-fructose and D-psicose contents before and after conversion were measured. The results showed that D-fructose in jujube decreased by 15% at an induction temperature of 37°C, decreased by 22% at 25°C, and decreased by 30% at 16°C.

[0055] Example 3

[0056] Enzyme immobilization

[0057] The crude enzyme solution of D-psicose-3-epimerase was purified using the BEM purification technology for immobilized enzymes. The synthesis of BEM particle precipitates refers to the article "Study on the purification and immobilization method of recombinant proteins based on BEM and AcmA expression system" published by Zhao Fangkun in Tianjin University. BEM preparation method: Lactococcus lactis NZ9000 was divided into three zones on the M17G plate and cultured at 30°C for 24 hours; the monoclonal colonies on the plate were picked into 5mL of M17G liquid culture medium for activation (30°C for 24 hours); the seed liquid was inoculated into 100mL of M17G liquid culture medium at a 2% inoculation rate and cultured under the same conditions. The bacteria were collected by centrifugation at 8000rpm for 15min, and the bacterial precipitate was resuspended with 50mM Tris-HCl, centrifuged again, and the bacterial precipitate was resuspended with 0.1M HCl (according to 100mL bacterial solution, 5mL buffer was added), and the boiling water bath was 35min. After cooling to room temperature, centrifuge, resuspend and wash the precipitate with 50mM Tris-HCl buffer, repeat this three times to obtain BEM, and store at 4°C. After combining an appropriate amount of BEM particle precipitate with the crude enzyme solution obtained in Example 2 on ice for 10min, 30min, and 60min, centrifuge at 12000×g for 10min at 4°C to remove the supernatant, and wash the precipitate of D-psicose-3-epimerase after BEM combination with 50mM Tris-HCl to obtain immobilized D-psicose-3-epimerase, use the immobilized D-psicose-3-epimerase to convert sugar in jujube juice, and measure the D-fructose and D-psicose contents before and after the conversion. The measurement results show that the D-fructose in jujube is reduced by 15% after 10min combination, 30% after 30min combination, and 30% after 60min combination.

[0058] Figure 5 The SDS-PAGE analysis result of the immobilized enzyme is shown in Figure 1. M: Marker; 1: Ultrasonic supernatant; 2: BEM; 3: Precipitation after BEM binding; 4: Supernatant after BEM binding. Figure 5 It can be seen that: 1 is the supernatant after ultrasonic disruption, which is the above-mentioned crude enzyme solution; 2 is BEM. BEM itself does not carry any protein and can be combined with DFAP with an AcmA label for enzyme immobilization; 3 is the precipitate after combining with BEM. DFAP is successfully immobilized after combining with BEM, and the obtained protein is relatively pure and contains almost no impurities; 4 is the supernatant after immobilization. After the DFAP crude enzyme solution is immobilized by BEM, the remaining impurities contain almost no DFAP, indicating that the immobilization efficiency is high. Figure 5 This showed that the immobilization and purification of DFAP was successfully achieved using BEM.

[0059] Example 4

[0060] Conversion of D-fructose in jujube juice to D-psicose

[0061] Immobilized D-psicose (binding time is 30 minutes) and 3-dimerase were added to jujube juice, and D-fructose in the jujube juice was converted at 30-70°C. The reaction time was 2h, 4h, and 6h. The reaction temperature was 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, and 70°C. After the reaction, the immobilized enzyme was removed by centrifugation at 12000×g for 10 minutes. The supernatant was boiled and centrifuged. After impurities were removed through a 0.22μm water filter membrane, it was added to a liquid phase tube for detection.

[0062] The content of D-fructose and D-psicose before and after conversion was determined. The results of high performance liquid chromatography detection of the generated D-psicose were as follows Figure 6 As shown, the retention time of D-psicose is 8.14 min, and the retention time of D-fructose is 9.615 min. Figure 8 The results of the optimal temperature of the immobilized enzyme are shown in Figure 2. The results show that the immobilized enzyme has the best effect at 55°C, and the enzyme activity is more than 90% at 45-60°C. The results of the reaction time are that the D-fructose in the jujube decreases by 20% after 2 hours of reaction, 26% after 4 hours of reaction, and 30% after 6 hours of reaction.

[0063] Sensory evaluation of jujube juice samples

[0064] The sensory evaluation of jujube juice samples was carried out with sensory score as the evaluation index. 30 sensory evaluators were invited to score the jujube juice samples from five aspects, including tissue state, surface color, taste, aroma, and acceptability. The score was scored on a 100-point scale. The sensory evaluators were evaluated according to the evaluation criteria in Table 1 before the sensory evaluation. The results were collected, and the average value was taken as the final sensory evaluation result after removing the highest and lowest scores.

[0065] Table 1 Sensory evaluation standards for jujube juice samples

[0066]

[0067] Sensory evaluation of two groups of jujube juice samples was conducted, and the results of the effect of adding D-psicose-3-epimerase to jujube juice on its sensory quality were as follows: Figure 7As shown in the figure, there were no significant differences in the tissue state, surface color, aroma and taste between the jujube juice control group (no DFAP added group) and the jujube juice experimental group (DFAP added group), and the sensory evaluators' acceptance of the two jujube juice samples was basically the same. This shows that compared with the jujube juice in the control group, there were no significant changes in the morphology, color, smell and taste of the original jujube juice in the experimental group, and the sweetness of the experimental group was slightly reduced. In addition, the D-fructose content in the jujube juice in the experimental group was reduced, and the content of the rare sugar D-psicose increased. In this experiment, D-psicose-3-epimerase was successfully applied to jujube juice without affecting the original flavor of jujube juice, so that D-psicose that is not easily absorbed and utilized by the human body was produced in jujube juice, which expanded its edible range and laid a solid foundation for the future industrial large-scale production of jujube juice containing D-psicose.

[0068] In summary, the present invention uses immobilized enzyme to convert D-fructose in jujube into D-psicose, and removes the enzyme by centrifugation after the reaction is completed. The available sugar is reduced while rare sugar is generated, and the sweetness of jujube juice is ensured while making it available to a wider range of people.

[0069] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for converting D-fructose in jujube into D-psicose using an immobilized enzyme, characterized in that: The following steps are involved: The immobilized D-psicose-3-epimerase is mixed with jujube juice, sugar conversion is performed, and the precipitate is discarded by centrifugation to obtain jujube juice containing D-psicose; the nucleotide sequence of the gene encoding the D-psicose-3-epimerase is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that: The temperature of the sugar conversion is 45-60°C; the time of the sugar conversion is 2-6h.

3. The method according to claim 1, characterized in that The immobilized D-psicose-3-epimerase is expressed and immobilized based on a bacterial enhanced matrix and a Lactococcus lactis peptidoglycan hydrolase expression system.

4. The method according to claim 1 or 3, characterized in that: The method for immobilizing D-psicose-3-epimerase comprises the following steps: constructing the gene encoding the D-psicose-3-epimerase into a plasmid with a Lactococcus lactis peptidoglycan hydrolase tag to obtain a recombinant plasmid; The recombinant plasmid is transformed into Escherichia coli, cultured, induced, the bacteria are collected, ultrasonically disrupted, and centrifuged to obtain the supernatant to obtain a crude enzyme solution of D-psicose-3-epimerase; The obtained crude D-psicose-3-epimerase enzyme solution was immobilized using a bacteria-enhanced matrix purification method to obtain immobilized D-psicose-3-epimerase.

5. The method according to claim 4, characterized in that The plasmids include pET-32a.

6. The method according to claim 4, characterized in that The immobilization method comprises: mixing the bacterial enhancement matrix with the crude enzyme solution of D-psicose-3-epimerase, centrifuging to obtain a precipitate after combining, and washing.

7. The method according to claim 6, characterized in that The binding time is 30 to 60 minutes.

8. The method according to claim 6, characterized in that The temperature of the combination is 0-4°C.

9. Jujube juice containing D-psicose prepared by the method according to any one of claims 1 to 8.

10. Use of immobilized D-psicose-3-epimerase in increasing the D-psicose content in jujube juice. The nucleotide sequence of the gene encoding the D-psicose-3-epimerase is shown in SEQ ID NO.1.

Images