Application method of multiple sites of SERPING1 gene in genetic disease detection

Abstract

An application method of multiple sites of an SERPING1 gene in genetic disease detection belongs to the technical field of detection, and comprises five steps of DNA extraction, DNA amplification, DNA purification, delivery sequencing and information analysis. DNA extraction comprises 12 sub-steps, and DNA amplification comprises two sub-steps; dNA purification comprises seven sub-steps, and delivery sequencing is as follows: a DNA solution is delivered to a sequencing service provider, a primer is used for DNA sequencing, and a sequence containing pathogenic SNP site base information on an SERPING1 gene in sample DNA is measured; and the raw information analysis comprises two sub-steps. According to the invention, the SNP sites can be subjected to first-generation sequencing, the site variation condition can be obtained, the result is applied to preparation of products for detecting or screening hereditary angioedema, the detection range is wide, the success rate is high, and the problems that in the prior art, a plurality of pathogenic SNP sites on the SERPING1 gene are not recorded by the existing pathogenic site information base, and the detection result is poor are solved. And misdiagnosis or treatment delay can be caused by the fact that the important pathogenic variation is not identified, so that the rehabilitation condition of the patient is influenced.

Description

Technical Field

[0001] The present invention relates to the field of biomedical application technology, and in particular to an application method of multiple sites of a SERPING1 gene in genetic disease detection. Background Art

[0002] Hereditary angioedema (HAE) is a rare genetic disease caused by a defective or insufficient complement C1 inhibitor (C1-inhibitor, C1-INH) in the human body. Specifically, it is mainly caused by mutations in the SERPING1 gene, which is responsible for encoding the C1-INH protein. HAE is characterized by paroxysmal, self-limited, and localized edema that can affect the skin, gastrointestinal tract, and respiratory mucosa. The most fatal of these is upper respiratory mucosal edema, which can cause dyspnea or suffocation due to rapid progression of laryngeal edema. If rescue is not timely, suffocation and death may occur, with a mortality rate of up to 11% to 40%. Globally, the incidence of HAE is low, with an estimated 1 in 50,000 people suffering from the disease. Because it is rare, doctors and patients still have a low level of awareness of hereditary angioedema. Therefore, the disease is often misdiagnosed and mistreated, which seriously affects the quality of life and life expectancy of patients and brings a heavy economic burden to families and society.

[0003] The protein encoded by the SERPING1 gene, C1-inhibitor (C1-INH), is a member of the serine protease inhibitor (serpins) family and plays an important regulatory role in the human body. This protein plays a key role in physiological and pathological processes. It has functions such as complement system regulation, coagulation system regulation, and fibrinolysis system regulation. As part of the serine protease inhibitor (serpins) family, C1-INH has a typical clover-shaped structure, which is essential for its ability to inhibit specific proteases. SERPING1 and its encoded product C1-INH constitute part of a complex and sophisticated biological network that is not limited to the regulation of the complement system, but also involves a wide range of physiological functions, including but not limited to immune regulation, inflammatory response control, and maintaining the homeostasis of various systems in the body. The realization of these functions depends on the precise interaction between C1-INH and other molecules. Any factors that disrupt this balance may lead to serious health problems, such as hereditary angioedema (HAE).

[0004] The existing SERPING1 gene encoding pathogenic site information database lacks records of the following pathogenic SNP sites on the SERPING1 gene: NM_000062.3:c.1396C>G, NM_000062.3:c.685+1G>A, NM_000062.3:c.794G>A, NM_000062.3:c.939T>A, NM_000062.3:c.1381G>C, NM_000062.3:c.1480C>T, NM_000062.3:c.1481G>C. The lack of these specific pathogenic SNP site information may cause clinical testing doctors to be unable to accurately identify certain types of HAE in patients, especially for those who carry the above mutations but are not covered by routine screening. This will not only lead to misdiagnosis, but may also delay the correct treatment time, thereby affecting the patient's prognosis. And with the development of precision medicine, understanding the specific genotype of an individual is crucial for developing personalized treatment plans. However, if these important pathogenic SNP sites are not included in the database, it will limit the ability of doctors to provide patients with the most appropriate treatment, including selecting the most suitable drugs and dose adjustments; and diagnostic kits, therapeutic drugs and other related products developed based on existing technologies may fail to fully consider these special SNP sites, thereby reducing their effectiveness and reliability. For example, some targeted therapeutic drugs may not work well for patients carrying these specific mutations. For the above reasons, failure to promptly diagnose and properly manage HAE cases may increase society's overall medical costs and put additional pressure on public health. In particular, considering the potentially fatal complications of HAE (such as laryngeal edema), this delay may have serious health and economic consequences. Summary of the invention

[0005] In order to prevent the disadvantage of the existing detection methods for hereditary angioedema in that the detection scope is not comprehensive due to the lack of records of pathogenic SNP sites on some SERPING1 genes, the present invention provides a method for applying multiple sites of the SERPING1 gene in genetic disease detection, which can perform first-generation sequencing on the corresponding SNP sites through first-generation sequencing primers under the joint action of relevant technical schemes, obtain site variation, and apply the results to the preparation of medical detection or screening products for hereditary angioedema, and provides favorable technical support for the effective treatment of edema diseases.

[0006] The technical solution adopted by the present invention to solve the technical problem is:

[0007] The method for applying multiple loci of the SERPING1 gene in genetic disease detection includes five steps: DNA extraction, DNA amplification, DNA purification, external sequencing, and bioinformatics analysis. The DNA extraction includes the following steps: (1) preparing anticoagulated blood; (2) adding proteinase K to a centrifuge tube, and mixing the anticoagulated blood sample obtained in step (1) in a centrifuge tube containing proteinase K; (3) adding lysis buffer to the sample, inverting it for multiple times, vortexing it at high speed, and incubating it for a period of time; (4) adding anhydrous ethanol to the lysis solution of the product obtained in step (3), vortexing it for a period of time, and briefly centrifuging it to collect droplets on the tube wall; (5) placing the HiPure gDNA Mini Colum in a new collection tube, transferring all the mixed solution in step (3) to a column and centrifuging it for a period of time, and discarding the collection tube and the effluent; (6) placing the column in a new collection tube, adding Buffer DW1 to the column and centrifuging it for a period of time; (7) discarding the filtrate, placing the column back in the collection tube, adding Buffer GW2 to the column and centrifuge for a while; (8): discard the filtrate, put the column back into the collection tube, add Buffer GW2 to the column and centrifuge for a while; (9): discard the filtrate, put the column back into the collection tube and centrifuge for a while; (10): put the column in a new centrifuge tube, add preheated Buffer AE to the center of the column membrane, let it stand for a while and centrifuge for a while; (11): add the eluate and preheated Buffer AE to the center of the column membrane, let it stand for a while and centrifuge for a while; (12): discard the DNA binding column and store the DNA at low temperature. DNA amplification includes the following steps: (1): the amplification reaction system is as follows: DNA, 2×Hieff Gold PCR Master Mix, Forward primer, Reverse primer, ddH2O, (2): prepare PCR tubes, add ultrapure water, MIX, DNA, all primers in sequence, and then run the PCR program; DNA purification includes the following steps: (1): add balance solution BL to adsorption column CB2 and centrifuge for a period of time, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube; (2): estimate the volume of PCR reaction solution or enzyme digestion reaction solution, add multiple volumes of binding solution PB to it and mix thoroughly; (3): add the solution obtained in step (2) (4): add the rinse solution PW to the adsorption column CB2 and centrifuge for a while, then pour out the waste solution in the collection tube and place the adsorption column CB2 in the collection tube; (5): repeat the process of (4) to (6), put the adsorption column CB2 back into the collection tube, centrifuge for a while, remove the rinse solution, and place the adsorption column CB2 in the collection tube; (7): place the adsorption column CB2 in the collection tube. In a clean centrifuge tube, elution buffer EB is added dropwise to the middle position of the adsorption membrane, and the tube is placed at room temperature for a period of time, and then centrifuged for a period of time to collect the DNA solution; the external sequencing is to send the DNA solution to a sequencing service provider, use primers to perform DNA sequencing, and specifically use the Sanger sequencing method to measure the sequence containing the base information of the pathogenic SNP site on the SERPING1 gene in the sample DNA; the bioinformatics analysis includes the following steps: (1): receiving and storing the ab1 file of the sequencing result, and drawing the ab1 file into a waveform and sequence using a software program; (2): using the BWA-MEM algorithm to align the sequencing sequence with the reference genome GRCh37.p13, and check the sequencing sequence bases corresponding to the positions 57373591, 57382032, 57381947, 57369643, 57381932, 57373930, and 57382031 of chromosome 11 of the reference genome. If there is an abnormality between the reference genome base and the sequencing sequence base, it is a pathogenic SNP site.

[0008] Furthermore, in the DNA extraction, the anticoagulated blood is less than 250 μl; and the amount of proteinase K used is 20 μl to 30 μl.

[0009] Furthermore, in the DNA extraction, the amount of the anticoagulated blood sample transferred to the centrifuge tube containing proteinase K is 10-250 μl. If the sample is less than 250 μl, the total volume is adjusted to 250 μl using one of phosphate buffer solution and elution buffer.

[0010] Furthermore, in the DNA extraction, the amount of lysis buffer is 200-300 μl; the amount of anhydrous ethanol is 200 μl-300 μl; the amount of Buffer DW1 is 400 μl-500 μl; the amount of Buffer GW2 is 600 μl-700 μl. Buffer and Buffer GW2 are diluted with ethanol in advance; the amount of Buffer AE is 50-100 μl; the short-term storage temperature of DNA is 2-8°C, and the long-term storage temperature needs to be below -20°C.

[0011] Furthermore, in the DNA purification, the amount of the balance solution BL is 400ul to 600ul; the amount of the rinse solution PW is 500ul to 700ul; and the amount of the elution buffer EB is 30-50ul.

[0012] Furthermore, in the bioinformatics analysis, the abnormal data of the reference genome bases and the sequencing sequence bases are 57369643->G>A, 57373591->G>A, 57373930->T>A, 57381932->G>C, 57381947->C>G, 57382031->C>T, and 57382032->G>C.

[0013] Compared with the prior art, the present invention has the following beneficial effects: under the joint action of relevant raw materials and steps, the present invention performs first-generation sequencing on SNP sites to obtain site variation, and applies the results to the preparation of detection or screening products for hereditary angioedema, with a wide detection range and a high success rate, and solves the problem of the prior art that multiple pathogenic SNP sites on the SERPING1 gene have not been recorded in the existing pathogenic site information database, and failure to identify these important pathogenic variations may lead to misdiagnosis or delayed treatment, thereby affecting the patient's recovery, and provides favorable technical support for the treatment of hereditary angioedema. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a flowchart of the work flow of the present invention. DETAILED DESCRIPTION

[0015] Figure 1As shown, the application method of SERPING1 gene multi-site in genetic disease detection includes five steps: DNA extraction, DNA amplification, DNA purification, external sequencing, and bioinformatics analysis. The DNA extraction includes the following steps. (1): Use the purchased anticoagulation tube to collect 2-3 ml of peripheral venous blood from the subject, and immediately invert and mix 5-8 times after collection; (2): Add 25μl Proteinase K to a 1.5-2.0ml centrifuge tube; (3): Transfer the 10-250μl anticoagulated blood sample obtained in step (1) to the centrifuge tube containing proteinase K, mix for 5 seconds, if the sample is <250μl, use Buffer PBS (phosphate buffer solution) or Buffer AE (elution buffer) to adjust the total volume to 250μl; (4): Add 250μl Buffer AL (lysis buffer) to the sample, invert 3-5 times, vortex at high speed for 10 seconds, and incubate at 70°C for 10 minutes; (5): Add 250 μl of anhydrous ethanol to the lysis solution of the product obtained in step (4), and vortex for 10 seconds; (6): Centrifuge briefly to collect droplets on the tube wall to ensure that all liquid is concentrated at the bottom of the centrifuge tube to prevent inaccurate liquid volume used in subsequent steps. ; (7): Put the purchased HiPuregDNA Mini Column (genomic DNA purification column) in a new collection tube, transfer all the mixed solution in step (6) to the purification column, centrifuge at 13,000xg for 1 minute, and discard the collection tube and effluent; (8): Put the column in a new collection tube and add 500 μl of Buffer DW1 to the column. 13,000×g centrifugation for 1 minute; (9): discard the filtrate, put the column back into the collection tube, add 650μl Buffer GW2 (diluted with ethanol) to the column, and centrifuge at 13,000×g for 1 minute; (10): discard the filtrate, put the column back into the collection tube, add 650μl Buffer GW2 (diluted with ethanol) to the column, and centrifuge at 13,000×g for 1 minute); (11): discard the filtrate, put the column back into the collection tube, and centrifuge at 13,000×g for 2 minutes; (12): put the column into a new 1.5ml centrifuge tube, add 50-100μl Buffer AE preheated to 70℃ to the center of the column membrane, let it stand for 3 minutes, and centrifuge at 10,000×g for 1 minute; (13): add 50-100μl of elution buffer or 50-100μl of Buffer Add AE to the center of the column membrane, let stand for 3 minutes, and centrifuge at 10,000×g for 1 minute. (14): Discard the DNA binding column and store the DNA at 2-8°C. For long-term storage, store at -20°C.

[0016] Figure 1As shown, DNA amplification includes the following steps: (1): Construction of an amplification reaction system. The amplification reaction system is as follows: DNA (input DNA, i.e., the product obtained by DNA extraction step, DNA ultrasound and purification) Xul, 2×Hieff Gold PCR Master Mix (2x Taq high-fidelity premix) 15ul, Forward primer (forward primer) 1ul, Reverse primer (reverse primer) 1ul, ddH2O (double distilled water) 1ul; (2): Prepare a 0.2ml PCR tube and add ultrapure water, MIX, DNA, and all primers in sequence; (3): Run the PCR program under the following conditions: temperature 95℃ time 5min, (96℃ 30sec, 60℃ 15sec, 72℃ 1min) × 30 cycles, 72℃ 10min, 4℃ hold. In the above 30 cycles, theoretically, the number of target DNA fragments will double at the end of each cycle, achieving DNA amplification.

[0017] Figure 1 As shown, DNA purification includes the following steps: (1): add 500ul of balancing solution BL to adsorption column CB2, centrifuge at 12,000rpm (~13,400×g) for 1min, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube; (2): estimate the volume of PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB thereto, and mix thoroughly; (3): add the solution obtained in step (2) to an adsorption column CB2, place it at room temperature for 2min, centrifuge at 12,00rpm (~13,400×g) for 30-60sec, pour out the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube; (4): add 500ul of balancing solution BL to adsorption column CB2, centrifuge at 12,000rpm (~13,400×g) for 30-60sec, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube; (5): add 500ul of balancing solution BL to adsorption column CB2, centrifuge at 12,000rpm (~13,400×g) for 30-60sec, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube; (6): add 500ul of balancing solution BL to adsorption column CB2, centrifuge at 12,000rpm (~13,400×g) for 30-60sec, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube; (7): add 500ul of balancing solution BL to adsorption column CB2, centrifuge at 12,000rpm (~13,400×g) for 30-60sec, pour out Add 600ul of rinse solution PW, centrifuge at 12,000rpm (~13,400×g) for 30-60sec, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube; (5): Repeat (4)-(6): Place the adsorption column CB2 back in the collection tube, centrifuge at 12,000rpm (~13,400×g) for 2min, remove the rinse solution as much as possible, and place the adsorption column CB2 at room temperature for several minutes; (7): Place the adsorption column CB2 in a clean centrifuge tube, add 30-50ul of elution buffer EB to the middle of the adsorption membrane, place at room temperature for 2min, and centrifuge at 12,000rpm (~13,400×g) for 2min to collect the DNA solution.

[0018] Figure 1As shown, the outsourced sequencing is to send the above-mentioned purified DNA sample to a dedicated first-generation sequencing service provider to perform DNA sequencing using the above-mentioned primers. Specifically, the Sanger sequencing method is used to measure the sequence containing the base information of the above-mentioned pathogenic SNP site on the SERPING1 gene in the sample DNA. The anger sequencing method usually includes the following steps. (1): Prepare a single-stranded DNA template, a primer complementary to the template, four conventional deoxynucleoside triphosphates (dNTPs), a small amount of dideoxynucleoside triphosphates (ddNTPs), and DNA polymerase. (2): The primer will pair with the single-stranded DNA template. Starting from the 3' end of the primer, the DNA polymerase will add the corresponding dNTPs according to the base sequence on the template to synthesize a new DNA chain. (3): The randomly added ddNTPs will replace dNTPs at a specific position. Since ddNTPs lack a 3'-OH group, once they are added to the growing DNA chain, the extension reaction will stop, thereby forming a series of DNA fragments of different lengths, and the end of each fragment is terminated by a specific ddNTP. (4): Separate DNA fragments of different lengths according to their size through gel electrophoresis; during the electrophoresis process, shorter DNA fragments move faster, while longer fragments move slower; each ddNTP can be labeled with a different fluorescent dye, so that when the DNA fragment passes through the detection window, it can be excited by laser and read with the corresponding color fluorescent signal to determine the end base of each fragment, and then infer the sequence of the original DNA template.

[0019] Figure 1 The bioinformatics analysis includes the following steps. (1): Receive and store the ab1 file of the sequencing result. (2): Use a special software program to draw the ab1 file into a waveform graph and sequence. (3): Use the BWA-MEM algorithm to align the sequencing sequence with the reference genome GRCh37.p13 (4): Check the sequencing sequence bases corresponding to positions 57373591, 57382032, 57381947, 57369643, 57381932, 57373930, and 57382031 of chromosome 11 of the reference genome. (4): If the reference genome base and the sequencing sequence base are as shown below, it is a pathogenic SNP site.

[0020] 57369643->G>A, 57373591->G>A, 57373930->T>A, 57381932->G>C, 57381947->C>G, 57382031->C>T, 57382032->G>C. The following are the nucleotide sequences involved in the primers used in the present invention (15ul, Forward primer (forward primer) 1ul, Reverse primer (reverse primer):

[0021] SERP-2-F:CCCACCCTCACCCTGTATTG

[0022] SERP-2-R:GGTTAGTGGCTGCGACCTTA

[0023] SERP-4-F:TGTGATCCCCTCCAAAGCAG

[0024] SERP-4-R:ACCTAATGCTCCTGCCAAGG

[0025] SERP-5-F:TAAGAGGAGTGGGCTGGACC

[0026] SERP-5-R:ACACGACTCACATTTTGCCA

[0027] SERP-6-F:AGCAAGAAGTACCCTGTGGC

[0028] SERP-6-R:GCCTTTGTTTCTCAGCCAGG

[0029] SERP-7-F:CCGTGCATGACCAAAAGTCC

[0030] SERP-7-R:CTGGGTCGGTGTTCTGGTTT

[0031] SERP-8-F:TCTGGCAAACAAGGGAAGAG

[0032] SERP-8-R:GCAGCTGATATTCAAAGGCAAA

[0033] SERP-11-F:CCCACCTACCAGGGGATTTG

[0034] SERP-11-R:GCCTATAGAGACCCCCGAGA

[0035] SERP-12-F:GGAGTAGGTTTGGTGCTGGG

[0036] SERP-12-R:TTCCACCATCTACGAGTGCG。

[0037] Figure 1As shown above, the present invention, under the joint action of relevant raw materials and steps, performs first-generation sequencing on SNP sites to obtain site variation, and applies the results to the preparation of detection or screening products for hereditary angioedema, with a wide detection range and a high success rate. It solves the problem of the prior art that multiple pathogenic SNP sites on the SERPING1 gene have not been recorded in the existing pathogenic site information library, and failure to identify these important pathogenic variations may lead to misdiagnosis or delayed treatment, thereby affecting the patient's recovery. It provides favorable technical support for the treatment of hereditary angioedema.

[0038] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes that fall within the meaning and scope of the equivalent elements of the claims are included in the present invention.

[0039] In addition, it should be understood that although the present specification is described according to the implementation mode, the implementation mode does not only include an independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in the embodiments can also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. The method for applying multiple loci of SERPING1 gene in genetic disease detection is characterized by: The method comprises five steps: DNA extraction, DNA amplification, DNA purification, external sequencing and bioinformatics analysis. The DNA extraction comprises the following sub-steps: (1) preparing anticoagulated blood; (2) adding proteinase K to a centrifuge tube and mixing the anticoagulated blood sample obtained in step (1) into the centrifuge tube containing proteinase K; (3) adding lysis buffer to the sample, inverting it several times and vortexing it at high speed, and incubating it for a period of time; (4): Add anhydrous ethanol to the lysate obtained in step (3), vortex for a while, and centrifuge briefly to collect droplets on the tube wall; (5): Place the HiPure gDNA Mini Colum in a new collection tube, transfer all the mixed solution in step (3) to the column and centrifuge for a while, then discard the collection tube and the effluent; (6) Place the column in a new collection tube, add Buffer DW1 to the column and centrifuge for a while; (7): Discard the filtrate, put the column back into the collection tube, add Buffer GW2 to the column and centrifuge for a while; (8): Discard the filtrate, put the column back into the collection tube, add Buffer GW2 to the column and centrifuge for a while; (9): Discard the filtrate, put the column back into the collection tube and centrifuge for a while; (10): Place the column in a new centrifuge tube, add preheated Buffer AE to the center of the column membrane, leave it for a while and centrifuge it for a while; (11): Add the elution solution and preheated Buffer AE to the center of the column membrane, leave it for a while and centrifuge it for a while; (12): Discard the DNA binding column and store the DNA at low temperature. DNA amplification includes the following steps: (1): The amplification reaction system is as follows: DNA, 2×Hieff Gold PCR Master Mix, Forward primer, Reverse primer, ddH2O, (2): prepare PCR tubes, add ultrapure water, MIX, DNA, all primers in sequence, and then run the PCR program; DNA purification includes the following steps: (1): add balance solution BL to adsorption column CB2 and centrifuge for a period of time, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube; (2): estimate the volume of PCR reaction solution or enzyme digestion reaction solution, add multiple volumes of binding solution PB to it and mix thoroughly; (3): add the solution obtained in step (2) (4): add the rinse solution PW to the adsorption column CB2 and centrifuge for a while, then pour out the waste solution in the collection tube and place the adsorption column CB2 in the collection tube; (5): repeat the process of (4) to (6), put the adsorption column CB2 back into the collection tube, centrifuge for a while, remove the rinse solution, and place the adsorption column CB2 in the collection tube; (7): place the adsorption column CB2 in the collection tube. In a clean centrifuge tube, elution buffer EB is added dropwise to the middle position of the adsorption membrane, and the tube is placed at room temperature for a period of time, and then centrifuged for a period of time to collect the DNA solution; the external sequencing is to send the DNA solution to a sequencing service provider, use primers to perform DNA sequencing, and specifically use the Sanger sequencing method to measure the sequence containing the base information of the pathogenic SNP site on the SERPING1 gene in the sample DNA; the bioinformatics analysis includes the following steps: (1): receiving and storing the ab1 file of the sequencing result, and drawing the ab1 file into a waveform and sequence using a software program; (2): using the BWA-MEM algorithm to align the sequencing sequence with the reference genome GRCh37.p13, and check the sequencing sequence bases corresponding to the positions 57373591, 57382032, 57381947, 57369643, 57381932, 57373930, and 57382031 of chromosome 11 of the reference genome. If there is an abnormality between the reference genome base and the sequencing sequence base, it is a pathogenic SNP site.

2. The method for applying the SERPING1 gene multi-site in genetic disease detection according to claim 1, characterized in that: During DNA extraction, the anticoagulated blood is less than 250 μl; the amount of proteinase K used is 20 μl to 30 μl.

3. The method for applying the SERPING1 gene multi-site in genetic disease detection according to claim 1, characterized in that: For DNA extraction, the amount of anticoagulated blood sample transferred to the centrifuge tube containing proteinase K is 10-250 μl. If the sample is <250 μl, adjust the total volume to 250 μl with one of the phosphate buffer solution and elution buffer.

4. The method for applying the SERPING1 gene multi-site in genetic disease detection according to claim 1, characterized in that: In DNA extraction, the volume of lysis buffer is 200-300 μl; The amount of anhydrous ethanol is 200μl~300μl; the amount of Buffer DW1 is 400μl~500μl; the amount of Buffer GW2 is 600μl~700μl. Buffer and Buffer GW2 are diluted with ethanol in advance; the amount of Buffer AE is 50~100μl; the short-term storage temperature of DNA is 2~8℃, and the long-term storage temperature needs to be below -20℃.

5. The method for applying the SERPING1 gene multi-site in genetic disease detection according to claim 1, characterized in that: In DNA purification, the amount of balance solution BL is 400ul~600ul; the amount of rinse solution PW is 500~700ul; the amount of elution buffer EB is 30-50ul.

6. The method for applying the SERPING1 gene multi-site in genetic disease detection according to claim 1, characterized in that: In the bioinformatics analysis, the abnormal data between the reference genome bases and the sequencing sequence bases are 57369643->G>A, 57373591->G>A, 57373930->T>A, 57381932->G>C, 57381947->C>G, 57382031->C>T, and 57382032->G>C.

Images