Primer and probe composition, kit and method for detecting polymorphic sites of key enzyme genes of folate metabolism

Abstract

The invention relates to a primer and probe composition, a kit and a method for detecting a polymorphic site of a folate metabolism key enzyme gene. The primer and probe composition comprises at least one of primers and probes aiming at a C677T site of an MTHFR (Methylene Tetrahydrofolate Reductase) gene, an A1298C site of the MTHFR gene and an A66G site of an MTRR (Methylene Tetrahydrofolate Reductase) gene. The primer and the probe can independently realize detection and can be combined in the same reaction system and reaction program for multiple PCR amplification, the primer and the probe aiming at different polymorphic sites do not interfere with each other, Tm values of amplification products aiming at different genotypes of the three polymorphic sites are obviously different, and the Tm values of the amplification products aiming at different genotypes of the three polymorphic sites are obviously different. Therefore, simultaneous detection of the three gene polymorphic sites can be realized, and the method has the advantages of short detection time, high detection sensitivity, good specificity and high accuracy.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to the detection of gene polymorphic sites, and specifically to a primer and probe composition, a kit and a method for detecting gene polymorphic sites of key enzymes of folate metabolism. Background Art

[0002] Studies have found that different individuals have different abilities to absorb and utilize folic acid, which is mainly affected by genetic factors. Genetic testing for folic acid metabolism is a method to evaluate an individual's folic acid metabolism ability by analyzing their genotype. At present, the two key enzymes MTHFR and MTRR genes are mainly tested for mutations: (1) MTHFR gene testing: mainly testing the C677T and A1298C sites. MTHFR C667T includes: wild type (CC), heterozygous mutant type (CT) and homozygous mutant type (TT); MTHFR A1298C site is divided into: wild type (AA), heterozygous mutant type (AC) and homozygous mutant type (CC). The wild type is the genotype without mutation. Mutations at these two sites will affect the activity of the MTHFR enzyme, thereby affecting the conversion efficiency of folic acid. (2) MTRR gene testing: Mainly tests the A66G site. The wild type (AA) of this site is the case where no mutation has occurred. However, if its genotype mutation is a heterozygous mutation (AG) or a homozygous mutation (GG), the enzyme activity of MTRR will be reduced, resulting in the inability to convert HCY into methionine, which will accumulate in the body.

[0003] The current genetic testing kits for evaluating folate metabolism capacity, whether using the fluorescent PCR method or the melting curve method, take more than 80 minutes to detect, with some products even taking close to 2 hours, and the detection specificity and sensitivity need to be further improved. Summary of the invention

[0004] Based on this, the purpose of the present invention is to provide a primer and probe composition, a kit and a method for detecting polymorphic sites of key enzyme genes of folate metabolism. The primer and probe composition can detect the MTHFR gene C677T site, the MTHFR gene A1298C site and the MTRR gene A66G site in the same reaction system, and has high amplification efficiency, short detection time, and good detection specificity and sensitivity.

[0005] The first aspect of the present invention is to provide a primer and probe combination for detecting polymorphic sites of key enzyme genes of folate metabolism, wherein the primer and probe combination comprises at least one set of the following primers and probes:

[0006] Group A: primers and probes targeting the C677T site of the MTHFR gene, the nucleotide sequences of which are the forward primer shown in SEQ ID NO: 5, the reverse primer shown in SEQ ID NO: 4, and the probe shown in SEQ ID NO: 9;

[0007] Group B: primers and probe targeting the A1298C site of the MTHFR gene, the nucleotide sequences of which are the forward primer shown in SEQ ID NO: 16, the reverse primer shown in SEQ ID NO: 13, and the probe shown in SEQ ID NO: 20;

[0008] Group C: primers and probe targeting the A66G site of the MTRR gene, whose nucleotide sequences are the forward primer shown in SEQ ID NO: 27, the reverse primer shown in SEQ ID NO: 24 and the probe shown in SEQ ID NO: 31.

[0009] In some embodiments, the primer and probe composition includes Group A, Group B, and Group C.

[0010] The second aspect of the present invention is to provide a kit for detecting polymorphic sites of key enzyme genes in folate metabolism, the kit comprising the primer and probe combination as described above.

[0011] In some embodiments, the kit further comprises a PCR amplification enhancer, which comprises components at the following concentrations: 0.5 mg / mL to 8 mg / mL fetal bovine serum albumin, 1 M to 6 M KCl, 0.2 M to 2.5 M glucose, and 0.2 M to 2.5 M TMAC.

[0012] In some preferred embodiments, the PCR amplification enhancer comprises components at the following concentrations: 0.5 mg / mL to 5 mg / mL fetal bovine serum albumin, 1 M to 4 M KCl, 0.2 M to 1.5 M glucose, and 0.2 M to 1.5 M TMAC.

[0013] In some more preferred embodiments, the PCR amplification enhancer comprises components at the following concentrations: 1.0 mg / mL to 3 mg / mL fetal bovine serum albumin, 2M to 3M KCl, 0.5M to 1M glucose, and 0.5M to 1M TMAC.

[0014] The third aspect of the present invention is to provide a method for detecting polymorphic sites of key enzyme genes of folate metabolism for non-diagnostic purposes, comprising the following steps: obtaining nucleic acid of a sample to be tested, performing PCR amplification using the primer and probe combination as described above or the kit as described above, and obtaining a melting curve of the PCR amplification product.

[0015] In some embodiments, the PCR amplification reaction system includes the following components: DNA polymerase, UNG enzyme, the primer and probe combination, dNTPs, MgCl 2 .

[0016] In some embodiments, the concentration of the forward primers with nucleotide sequences such as SEQ ID NOs: 5, 16 and 27 in the reaction system is 5 nM to 10 nM, preferably 7 nM to 9 nM; and / or,

[0017] The concentration of the reverse primers with nucleotide sequences as shown in SEQ ID NOs: 4, 13 and 24 in the reaction system is 60 nM to 100 nM, preferably 70 nM to 90 nM; and / or,

[0018] The concentrations of the probes with nucleotide sequences as shown in SEQ ID NOs: 9, 20 and 31 in the reaction system are 15 nM to 35 nM, preferably 20 nM to 30 nM.

[0019] In some embodiments, the reaction system further comprises the PCR amplification enhancer; preferably, the volume ratio of the PCR amplification enhancer to the reaction system is (2-8):25, preferably (4-6):25.

[0020] In some embodiments, the PCR amplification program is: 95°C for 1 min; 95°C for 3s to 20s, 60°C for 5s to 30s, 72°C for 0s to 30s, for a total of 45 to 50 cycles; 98°C for 10s to 1min; 45°C for 1min to 3min; wherein, at 45°C to 75°C, the fluorescence signal is collected at 0.4°C to 0.5°C / 8s;

[0021] Preferably, the PCR amplification program is: 95°C for 1 min; 95°C for 3s-10s, 60°C for 5s-10s, for a total of 45-50 cycles; 98°C for 10s-1min; 45°C for 1min-3min; wherein, at 45°C-70°C, the fluorescence signal is collected at 0.5°C / 8s.

[0022] The present invention obtains a detection primer and probe combination for the MTHFR gene C677T site, the MTHFR gene A1298C site and the MTRR gene A66G site through a large amount of research and screening. The primers and probes for the three polymorphic sites can be detected separately, and can also be combined in the same reaction system and reaction procedure to perform multiple PCR amplification. The primers and probes for different polymorphic sites will not interfere with each other, and the Tm values ​​of the amplification products of different genotypes at the three polymorphic sites are obviously different, so that the three gene polymorphic sites can be detected simultaneously.

[0023] The detection primer and probe combination of the present invention has high amplification efficiency and can complete the simultaneous detection of the three polymorphic sites in about 60 minutes; and the amplified product has a higher melting curve peak, good detection accuracy, high sensitivity, and low detection limit (as low as 1.0 ng / μL).

[0024] Furthermore, the present invention has also optimized and obtained a PCR amplification enhancer for the primer and probe combination. By adding an appropriate amount of the PCR amplification enhancer to the PCR reaction system, the stability of the PCR reaction system can be effectively improved, and the melting curve peak of the amplified product can be increased, so that the resolution of the primer and probe combination is higher, thereby further improving the sensitivity. When the detection limit is as low as 0.1 ng / μL, the three polymorphic sites can still be stably and accurately detected simultaneously. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The melting curve of primer and probe set 2 targeting the C677T site of the MTHFR gene and a typical melting curve of primer and probe sets that do not meet the detection requirements.

[0026] Figure 2 The melting curve of primer and probe set 2 targeting the A1298C site of the MTHFR gene and a typical melting curve of primer and probe sets that do not meet the detection requirements.

[0027] Figure 3 It is the melting curve of primer and probe set 5 targeting the A66G site of MTRR gene and the typical melting curve graph of primer and probe set that does not meet the detection requirements.

[0028] Figure 4 The melting curves of primer and probe combination 1 and primer and probe combinations 4 to 7 targeting the C677T site of the MTHFR gene, the A1298C site of the MTHFR gene and the A66G site of the MTRR gene are shown.

[0029] Figure 5 Melting curves with or without the addition of amplification enhancers.

[0030] Figure 6 This is the melting curve diagram of the sample in Example 4. DETAILED DESCRIPTION

[0031] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0032] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0033] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0034] In addition, as used in the present invention, the term "or" is an inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in..." includes "in..." and "on...".

[0035] Some embodiments of the present invention relate to a primer and probe combination for detecting polymorphic sites of key enzyme genes of folate metabolism, wherein the primer and probe combination comprises at least one set of the following primers and probes:

[0036] Group A: primers and probes targeting the C677T site of the MTHFR gene, the nucleotide sequences of which are the forward primer shown in SEQ ID NO: 5, the reverse primer shown in SEQ ID NO: 4, and the probe shown in SEQ ID NO: 9;

[0037] Group B: primers and probe targeting the A1298C site of the MTHFR gene, the nucleotide sequences of which are the forward primer shown in SEQ ID NO: 16, the reverse primer shown in SEQ ID NO: 13, and the probe shown in SEQ ID NO: 20;

[0038] Group C: primers and probe targeting the A66G site of the MTRR gene, whose nucleotide sequences are the forward primer shown in SEQ ID NO: 27, the reverse primer shown in SEQ ID NO: 24 and the probe shown in SEQ ID NO: 31.

[0039] In some embodiments, the primer and probe composition includes Group A, Group B, and Group C.

[0040] The present invention has obtained the primer and probe combination for the three polymorphic sites of the two key enzyme genes of folic acid metabolism after extensive research and screening. The primers and probes for the three polymorphic sites can be detected individually, and multiple PCR amplifications can be performed in the same reaction system and reaction procedure. The primers and probes for different polymorphic sites will not interfere with each other, and the Tm values ​​of the amplification products of different genotypes at the three polymorphic sites are obviously different, thereby realizing the simultaneous detection of the three gene polymorphic sites.

[0041] In addition, the detection primer and probe combination of the present invention has a higher amplification efficiency, and can complete the simultaneous detection of the three polymorphic sites in about 60 minutes. In addition, the amplified product has a higher melting curve peak, indicating that the primer and probe have high resolution, good detection accuracy, high sensitivity, and low detection limit (as low as 1.0 ng / μL).

[0042] In some embodiments, the 5' end and 3' end of the probe are modified with a fluorescent group and a quenching group, respectively, and the fluorescent groups modified on the probes for different polymorphic sites are different. The fluorescent group and the quenching group can be fluorescent groups and quenching groups commonly used in the art for modifying probes. For example, the fluorescent group includes but is not limited to FAM, VIC, ROX, and the quenching group includes but is not limited to BHQ1 and BHQ2.

[0043] Some embodiments of the present invention relate to a kit for detecting polymorphic sites of key enzyme genes in folate metabolism, wherein the kit comprises the primer and probe combination as described above.

[0044] In some preferred embodiments, the kit further comprises a PCR amplification enhancer, which comprises components in the following concentrations: 0.5 mg / mL to 8 mg / mL fetal bovine serum albumin, 1 M to 6 M KCl, 0.2 M to 2.5 M glucose, and 0.2 M to 2.5 M TMAC (tetramethylammonium chloride); preferably, the PCR amplification enhancer comprises components in the following concentrations: 0.5 mg / mL to 5 mg / mL fetal bovine serum albumin, 1 M to 4 M KCl, 0.2 M to 1.5 M glucose, and 0.2 M to 1.5 M TMAC; more preferably, the PCR amplification enhancer comprises components in the following concentrations: 1.0 mg / mL to 3 mg / mL fetal bovine serum albumin, 2 M to 3 M KCl, 0.5 M to 1 M glucose, and 0.5 M to 1 M TMAC.

[0045] The present invention also optimizes and obtains a PCR amplification enhancer for the primer and probe combination. By adding an appropriate amount of the PCR amplification enhancer to the PCR reaction system, the stability of the PCR reaction system can be effectively improved, and the melting curve peak of the amplified product can be increased, so that the resolution of the primer and probe combination is higher, thereby further improving the sensitivity. When the detection limit is as low as 0.1 ng / μL, the three polymorphic sites can still be stably and accurately detected simultaneously.

[0046] Due to the greatly improved detection sensitivity, the primer and probe combination of the present invention can not only detect blood samples, but also detect oral exfoliated cell samples, thereby improving the experience of the test subject.

[0047] The present invention is further described in detail below with reference to specific embodiments.

[0048] Example 1

[0049] For the simultaneous detection of the C677T and A1298C sites of the MTHFR gene and the A66G site of the MTRR gene, the present invention has designed a large number of amplification primers and probes targeting the three polymorphic sites, and has conducted research and screening, which are illustrated by taking the following target sequences, primers and probes as examples.

[0050] 1. Primer and probe design

[0051] (1) MTHFR gene

[0052] 1) C677T site

[0053] Primers and probes were designed based on the sequence shown in SEQ ID NO: 34:

[0054] SEQ ID NO: 34: GGGCAAGTGATGCCCATGTCGGTGCATGCCTTCACAAAGCGGAA GAATGTGTCAGCCTCAAAGAAAAGCTGCGTGATGATGAAATCGGCTCCCGCAGACACCTTCTCCTTCAAGTGCTTCAGGTCAGCCTCAAAGCCTCCTGCTTCGGGGTGGCCTTTGGGGTAACCTGC.

[0055] The designed primer sequences are shown in Table 1:

[0056] Table 1

[0057]

[0058] The designed probe sequences are shown in Table 2:

[0059] Table 2

[0060]

[0061] 2) A1298C site

[0062] Primers and probes were designed based on the sequence shown in SEQ ID NO: 35:

[0063] SEQ ID NO: 35: GCCAGGGGCAGGGGATGAACCAGGGTCCCCACTCCAGCATCAC TCACTTTGTGACCATTCCGGTTTTGGTTCTCCCGAGAGGTAAAGAACGAAGACTTCAAAGACACTTTCTTCACTGGTCAGCTCCTCCCCCCACATCTTCAGCAGCTCCTCCTTGGGGGACTTGCTCTTCAGGTAGAAGAGGTAGTAGTCCTTCAGCTCCCCAAAGGCAGGGG.

[0064] The designed primer sequences are shown in Table 3:

[0065] Table 3

[0066]

[0067]

[0068] The designed probe sequences are shown in Table 4:

[0069] Table 4

[0070]

[0071] (2) MTRR gene

[0072] 1) A66C site

[0073] Primers and probes were designed based on the sequence shown in SEQ ID NO: 36:

[0074] SEQ ID NO: 36: ATGAGGAGGTTTCTGTTACTATATGCTACACAGCAGGGACAGGCAAAGGCCATCGCAGAAGAAATATGTGAGCAAGCTGTGGTACATGGATTTTCTGCAGATCTTCACTGTATTAGTGAATCCGATAAGTATGACCTAAAAACCGAAACAGCTCCTCTTGTTGTTGTGGTTTCT.

[0075] The designed primer sequences are shown in Table 5:

[0076] Table 5

[0077]

[0078]

[0079] The designed primer sequences are shown in Table 6:

[0080] Table 6

[0081]

[0082] 2. Primer and probe screening

[0083] The primers and probes designed as above were used to screen samples determined to be homozygous, heterozygous and wild-type, and the concentration of the detected nucleic acid samples was 1.0 ng / μL.

[0084] The universal amplification system for screening primers and probes is shown in Table 7.

[0085] Table 7

[0086]

[0087] The general amplification program is shown in Table 8.

[0088] Table 8

[0089]

[0090] (1) C677T site

[0091] 48 primer and probe sets were screened for the sequence of the C677T site, and 5 sets met the requirements, as shown in Table 9.

[0092] Table 9

[0093] Group F R P 1 MTHFR(C677T)-F11 MTHFR(C677T)-R11 MTHFR(C677T)-P1 2 MTHFR(C677T)-F13 MTHFR(C677T)-R12 MTHFR(C677T)-P1 3 MTHFR(C677T)-F13 MTHFR(C677T)-R13 MTHFR(C677T)-P1 4 MTHFR(C677T)-F13 MTHFR(C677T)-R13 MTHFR(C677T)-P2 5 MTHFR(C677T)-F14 MTHFR(C677T)-R12 MTHFR(C677T)-P3

[0094] Typical melting curves of primers and probe sets that meet the detection requirements (taking primer and probe set 2 as an example) and primers and probe sets that do not meet the detection requirements are as follows: Figure 1 shown.

[0095] (2) A1298C site

[0096] 48 primer and probe sets were screened for the sequence of the A1298C site, and 5 sets met the requirements, as shown in Table 10.

[0097] Table 10

[0098] Group F R P 1 MTHFR(A1298C)-F12 MTHFR(A1298C)-R11 MTHFR(A1298C)-P1 2 MTHFR(A1298C)-F13 MTHFR(A1298C)-R11 MTHFR(A1298C)-P1 3 MTHFR(A1298C)-F14 MTHFR(A1298C)-R11 MTHFR(A1298C)-P1 4 MTHFR(A1298C)-F13 MTHFR(A1298C)-R12 MTHFR(A1298C)-P2 5 MTHFR(A1298C)-F13 MTHFR(A1298C)-R13 MTHFR(A1298C)-P3

[0099] Typical melting curves of primers and probe sets that meet the detection requirements (taking primer and probe set 2 as an example) and primers and probe sets that do not meet the detection requirements are as follows: Figure 2 shown.

[0100] (3) A66G site

[0101] 48 primer and probe sets were screened for the sequence of the A66G site, and 7 sets met the requirements, as shown in Table 10.

[0102] Table 10

[0103] Group F R P 1 MTRR(A66C)-F11 MTRR(A66C)-R11 MTRR(A66C)-P1 2 MTRR(A66C)-F11 MTRR(A66C)-R12 MTRR(A66C)-P2 3 MTRR(A66C)-F12 MTRR(A66C)-R13 MTRR(A66C)-P3 4 MTRR(A66C)-F12 MTRR(A66C)-R11 MTRR(A66C)-P1 5 MTRR(A66C)-F13 MTRR(A66C)-R11 MTRR(A66C)-P1 6 MTRR(A66C)-F13 MTRR(A66C)-R12 MTRR(A66C)-P1 7 MTRR(A66C)-F13 MTRR(A66C)-R13 MTRR(A66C)-P2

[0104] Typical melting curves of primers and probe sets that meet the detection requirements (taking primer and probe set 5 as an example) and primers and probe sets that do not meet the detection requirements are as follows: Figure 3 shown.

[0105] (4) C677T, A1298C and A66G site combination

[0106] Next, the primer and probe groups that were qualified by separate detection and screening of the MTHFR gene C677T site, the MTHFR gene A1298C site, and the MTRR gene A66G site were screened for the primer and probe combination for simultaneous detection of the three polymorphic sites, and samples covering the wild type, homozygous mutant type, and heterozygous mutant type of the three sites were selected; primers and probes for the three polymorphic sites were added to the reaction system at the same time, and the concentrations of each primer and probe in the system were the same as the primer and probe concentrations in Table 7. A total of 5*5*7=175 groups were screened, and the results of the 7 combinations in Table 11 are used as examples for illustration.

[0107] Table 11

[0108]

[0109] The combined screening results show that primer and probe combination 1 has the best amplification specificity and the highest melting curve peak, which can achieve simultaneous detection of three sites, with high detection specificity, sensitivity and accuracy. Although primer and probe combinations 2 to 3 can also achieve multiplex PCR amplification of three sites, the melting curve peak is lower than that of primer and probe combination 1, and the detection accuracy and sensitivity are not as good as primer and probe combination 1. Other primer and probe combinations cannot effectively achieve simultaneous detection of three sites. For example: C677T was not detected in primer and probe combination 4, the signal of the C677T site in primer and probe combination 5 was relatively weak, and the peak height difference was large. The signals of the A1298C site and the A66G site in primer and probe combination 6 were relatively weak, and there was non-specific amplification of the A66G site in primer and probe combination 7. Primer and probe combinations 4 to 7 cannot detect all three sites, and have poor specificity and sensitivity, and cannot effectively achieve simultaneous detection of three polymorphic sites. Representative melting curves of primer and probe combination 1 and primer and probe combinations 4 to 7 are shown in Figure 2. Figure 4 shown.

[0110] 3. Amplification Program Optimization

[0111] In order to further shorten the detection time of the simultaneous detection of three polymorphic sites using primers and probe combinations, the reaction program was optimized. In addition to the original program, three multiplex PCR amplification programs in Table 12 were designed. According to the screening results of the primer and probe combination, the three primer and probe combinations 1 to 3 in Table 11 were selected to detect the wild-type, homozygous mutant and heterozygous mutant samples covering the three sites. The multiplex PCR amplification program system is the same as Table 7. Primers and probes for the three polymorphic sites are added to the reaction system at the same time, and the concentrations of each primer and probe in the system are the same as the primer and probe concentrations in Table 7.

[0112] Table 12

[0113]

[0114]

[0115] The primer and probe compositions 1 to 3 were simultaneously subjected to multiplex PCR amplification in three programs. The results showed that the amplification efficiency and stability of the primer and probe composition 1 were the best, and there was no significant difference in the detection effect in the three programs; followed by the primer and probe composition 2, and finally the primer and probe composition 3. The amplification efficiency and stability of the primer and probe compositions 2 and 3 were relatively poor compared to the primer and probe composition 1.

[0116] Based on the above results, it is preferred to use primer and probe combination 1 to detect C677T, A1298C and A66G sites according to procedure 3, and the detection time is as low as about 60 minutes.

[0117] IV. PCR Amplification Enhancer

[0118] In order to further improve the detection sensitivity of the primer and probe combination 1 in Table 11 and reduce the detection limit, we further studied the PCR amplification enhancer for the primer and probe combination 1.

[0119] Samples of wild type, homozygous mutant and heterozygous mutant covering three loci were selected for detection. The multiplex PCR amplification system was the same as above, with different amplification enhancement reagents added to the system, and multiplex PCR amplification was performed using the above procedure 3.

[0120] This example studies the amplification enhancement effect of various reagents on the primer and probe combination 1, and takes the following reagents as examples for illustration: fetal bovine serum albumin, KCl, glucose, TMAC and peg2000.

[0121] First, a gradient test was performed on the individual reagent components. The results showed that: Fetal bovine serum albumin: 1mg / mL, adding 1-8μL can increase the melting curve peak, and the best effect is achieved when 5μL is used. KCl: 2M, adding 1-3μL can increase the melting curve peak, and the best effect is achieved when 2μL is used. Glucose: 0.5M, adding 1-5μL can increase the melting curve peak, and the best effect is achieved when 3μL is used. TMAC: 0.5M, adding 1-5μL can increase the melting curve peak, and the best effect is achieved when 3μL is used. PEG2000: 20%, adding 1-5μL, has no significant effect on the melting curve peak height.

[0122] Based on the experimental results of single-component, a multi-component amplification enhancer was studied, and an amplification enhancer that can effectively improve the amplification efficiency of the primer and probe composition 1 was obtained, which includes the following components: 0.5mg / mL~8mg / mL fetal bovine serum albumin, 1M~6M KCl, 0.2M~2.5M glucose, and 0.2M~2.5M TMAC.

[0123] The effect of the following amplification enhancer on improving the amplification efficiency of the primer and probe composition 1 is used as an example to illustrate: fetal bovine serum albumin (1.0 mg / mL), KCl (2M), glucose (0.5M) and TMAC (0.5M). Gradient detection found that adding the amplification enhancer to the multiplex PCR amplification system can effectively increase the melting curve peak, and the peak shape is significantly better than the peak shape corresponding to a single component. It is preferred to add 2 to 8 μL of amplification enhancer to a 25 μL multiplex PCR amplification system, and more preferably 4 to 6 μL, with 5 μL having the best effect. Figure 5 is a melting curve diagram with and without the addition of the amplification enhancer, Figure 5It can be seen that after adding the amplification enhancer, the melting curve peak shape is higher, the resolution is higher, the sensitivity is better, the detection limit can be as low as 0.1 ng / μL, and the detection stability is good.

[0124] Example 2

[0125] This embodiment provides a kit for detecting polymorphic sites of key enzyme genes for folate metabolism, and the main components of the kit are shown in Table 13:

[0126] Table 13

[0127]

[0128] The primer and probe combination in the kit includes primers and probes as shown in Table 14 below for the C677T and A1298C sites of the MTHFR gene and the A66G site of the MTRR gene (i.e., the primer and probe combination 1 in Table 11 of Example 1):

[0129] Table 14

[0130]

[0131] The PCR lyophilized powder in the kit is prepared by the following method: the components with the concentrations shown in Table 15 are mixed evenly according to the dosage, and lyophilized to obtain the PCR lyophilized powder.

[0132] Table 15

[0133]

[0134]

[0135] Example 3

[0136] This example provides a method for detecting polymorphic sites of key enzyme genes for folate metabolism, using the kit described in Example 2 to perform melting curve detection, and the specific steps are as follows:

[0137] 1. Sample preparation (specimen preparation area)

[0138] 1. Use Wondfo magnetic bead nucleic acid extraction reagent (Guangzhou Medical Equipment No. 20220364) to extract DNA from blood samples and oral swabs.

[0139] 2. Preparation of amplification reagents (specimen preparation area)

[0140] 1. PCR reagent preparation (prepare in the reagent preparation area)

[0141] (1) Take out each component from the kit, place it at room temperature, wait for the temperature to equilibrate to room temperature, and then centrifuge it for later use;

[0142] (2) Add 210 μL of the reconstitution solution to the PCR freeze-dried powder (freezing tube), shake thoroughly to mix, and centrifuge instantly;

[0143] (3) Dispense the reconstituted PCR amplification reagent into N PCR reaction wells at a volume of 15 μL / well;

[0144] (4) Transfer the prepared reagents to the sample processing area for later use.

[0145] Note: N = [positive quality control product] + [negative quality control product] + number of samples to be tested.

[0146] 2. Sample processing (carried out in the sample processing area)

[0147] (1) Take out 200 μL of each sample to be tested and extract nucleic acid simultaneously according to the recommended nucleic acid extraction or purification reagent operating instructions.

[0148] (2) Take 10 μL of the above extraction reaction and 10 μL of [positive quality control] and [negative quality control] and add them to the PCR reaction wells prepared in the preparation stage, cover the lid tightly and centrifuge thoroughly, then transfer to the nucleic acid amplification area for detection.

[0149] 3. PCR amplification detection (performed in the amplification detection area)

[0150] (1) Place the reaction tubes into the fluorescent PCR amplification instrument according to the experimental layout for amplification detection. Set the reaction system to 25 μL.

[0151] (2) Cycle parameter setting

[0152] Using the Macrostone fully automated medical PCR analysis system SLAN-96P / S, set the multiplex PCR amplification and melting curve program as shown in Table 16 below:

[0153] Table 16

[0154]

[0155]

[0156] 4. Result determination

[0157] The results are judged as follows:

[0158] (1) MTHFR gene C677T site

[0159] Wild peak (CC): 64.45℃±2.00℃;

[0160] Mutation peak (TT): 53.90℃±2.00℃;

[0161] Heterozygous peak (CT): double peaks, namely wild peak (CC): 64.45℃±2.00℃ and mutant peak (TT): 53.90℃±2.00℃.

[0162] (2) MTHFR gene A1298C site

[0163] Wild peak (AA): 65.45℃±2.00℃;

[0164] Mutation peak (CC): 60.55℃±2.00℃;

[0165] Heterozygous peak (AC): double peaks, namely wild peak (C): 65.45℃±2.00℃ and mutant peak (T): 60.55℃±2.00℃.

[0166] (3) MTRR gene A66G site

[0167] Wild peak (AA): 61.45℃±2.00℃;

[0168] Mutation peak (GG): 54.36℃±2.00℃;

[0169] Heterozygous peak (AG): double peaks, namely wild peak (AA): 61.45℃±2.00℃ and mutant peak (GG): 54.36℃±2.00℃.

[0170] Example 4

[0171] This example verifies the detection accuracy and sensitivity of the kit described in Example 2.

[0172] 1. Accuracy

[0173] 25 DNA samples with known genotypes were tested using the kit described in Example 2 and the detection method described in Example 3. The results are shown in Table 17. The melting curves are shown in Figure 6 shown.

[0174] Table 17

[0175]

[0176]

[0177] As shown in Table 17, the detection results of the kit of the present invention are completely consistent with the known genotypes, with an accuracy rate of up to 100%.

[0178] 2. Sensitivity

[0179] A DNA sample of a heterozygous MTHFR gene C677T site, MTHFR gene A1298C site and MTRR gene A66G site was tested using the kit described in Example 2 and the detection method described in Example 3. The concentration of the sample nucleic acid was determined after extraction, and then diluted to the following gradient concentrations for detection: 1.0 ng / μL, 0.5 ng / μL, 0.1 ng / μL, 0.05 ng / μL. Each concentration of nucleic acid sample was repeated 10 times, and the results are shown in Table 18.

[0180] Table 18

[0181]

[0182] The above results show that when the nucleic acid sample concentration is 0.1 ng / μL, the kit of the present invention can still stably and accurately detect three polymorphic sites at the same time, indicating that the kit of the present invention has a high detection sensitivity, and the detection limit can be as low as 0.1 ng / μL while ensuring detection accuracy and stability.

[0183] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer and probe combination for detecting polymorphic sites of key enzyme genes in folate metabolism, characterized in that: The primer and probe combination comprises at least one of the following primers and probes: Group A: primers and probes targeting the C677T site of the MTHFR gene, the nucleotide sequences of which are the forward primer shown in SEQ ID NO: 5, the reverse primer shown in SEQ ID NO: 4, and the probe shown in SEQ ID NO: 9; Group B: primers and probe targeting the A1298C site of the MTHFR gene, the nucleotide sequences of which are the forward primer shown in SEQ ID NO: 16, the reverse primer shown in SEQ ID NO: 13, and the probe shown in SEQ ID NO: 20; Group C: primers and probe targeting the A66G site of the MTRR gene, whose nucleotide sequences are the forward primer shown in SEQ ID NO: 27, the reverse primer shown in SEQ ID NO: 24 and the probe shown in SEQ ID NO:

31.

2. The primer and probe combination according to claim 1, characterized in that The primer and probe combination includes Group A, Group B and Group C.

3. A kit for detecting polymorphic sites of key enzyme genes in folate metabolism, characterized in that: The kit comprises the primer and probe combination as described in claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also includes a PCR amplification enhancer, which includes components with the following concentrations: 0.5 mg / mL to 8 mg / mL fetal bovine serum albumin, 1 M to 6 M KCl, 0.2 M to 2.5 M glucose, and 0.2 M to 2.5 M TMAC.

5. The kit according to claim 4, characterized in that The PCR amplification enhancer comprises components with the following concentrations: 0.5 mg / mL to 5 mg / mL fetal bovine serum albumin, 1 M to 4 M KCl, 0.2 M to 1.5 M glucose, and 0.2 M to 1.5 M TMAC.

6. The kit according to claim 5, characterized in that The PCR amplification enhancer comprises components with the following concentrations: 1.0 mg / mL to 3 mg / mL fetal bovine serum albumin, 2M to 3M KCl, 0.5M to 1M glucose, and 0.5M to 1M TMAC.

7. A method for detecting polymorphic sites of key enzyme genes of folate metabolism for non-diagnostic purposes, characterized in that: The following steps are involved: The nucleic acid of the sample to be tested is obtained, and PCR amplification is performed using the primer and probe combination described in any one of claims 1 to 2 or the kit described in any one of claims 3 to 6 to obtain a melting curve of the PCR amplification product.

8. The detection method according to claim 7, characterized in that The PCR amplification reaction system includes the following components: DNA polymerase, UNG enzyme, the primer and probe combination, dNTPs, and MgCl2.

9. The detection method according to claim 8, characterized in that: The concentration of the forward primers with nucleotide sequences as shown in SEQ ID NOs: 5, 16 and 27 in the reaction system is 5 nM to 10 nM respectively; and / or, The concentration of the reverse primers with nucleotide sequences as shown in SEQ ID NOs: 4, 13 and 24 in the reaction system is 60 nM to 100 nM respectively; and / or, The concentrations of the probes with nucleotide sequences as shown in SEQ ID NOs: 9, 20 and 31 in the reaction system are 15 nM to 35 nM respectively.

10. The detection method according to claim 8 or 9, characterized in that: The reaction system also includes the PCR amplification enhancer; preferably, the volume ratio of the PCR amplification enhancer to the reaction system is (2-8):25.

Images