Primers and kits for identifying animal-derived components based on third-generation sequencing technology

By designing primers and primer sets based on third-generation sequencing technology, combined with magnetic bead method and multi-sample library construction technology, the problem of high-resolution identification of animal-derived components was solved, realizing rapid and accurate identification of animal-derived components, especially the identification of closely related species and different populations within the same species.

CN119979715BActive Publication Date: 2025-11-14THE FIRST RES INST OF MIN OF PUBLIC SECURITY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510088199.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-21
Publication Date
2025-11-14
Estimated Expiration
2045-01-21

AI Technical Summary

Technical Problem

Existing technologies struggle to rapidly and at high resolution identify animal-derived components, particularly in the identification of closely related species or different populations within the same species.

Method used

Primer design based on third-generation sequencing technology was used, employing primers F: GTATGACCGCGGTGGCTGGCAC and R: CCAAACTGGGATTAGATACCC, combined with magnetic bead method and multi-sample library construction technology, to amplify and sequence the full-length mitochondrial genome, and sequence alignment was performed using the NCBI database.

Benefits of technology

It enables high-resolution identification of animal-derived components, and can identify closely related species with similar sequences or different populations within the same species, thus improving the efficiency and accuracy of food safety testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979715B_ABST
    Figure CN119979715B_ABST
Patent Text Reader

Abstract

This invention discloses primers for identifying animal-derived components based on third-generation sequencing technology. The primers are primer F (SEQ ID No. 1): GTATGACCGCGGTGGCTGGCAC, and primer R (SEQ ID No. 2): CCAAACTGGGATTAGATACCC. Compared to conventional DNA barcoding or quantitative real-time PCR methods, the primers designed in this invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, enabling the identification of animal-derived components through a single primer pair, thus improving the detection efficiency of counterfeit animal-derived components in the public security, food, drug, and environmental protection fields. The primer pairs designed in this invention amplify all mitochondrial loci, including D-LOOP, COX1, COX2, COX3, and CYTB, providing higher species resolution compared to shorter fragments.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a kit for identifying animal-derived components, specifically a primer and kit for identifying animal-derived components based on third-generation sequencing technology. Background Technology

[0002] In recent years, food safety issues such as adulteration with animal-derived substances have seriously affected consumers' interests and aroused widespread public concern. In criminal cases involving counterfeiting, the examination and identification of physical evidence is particularly important; however, current methods for identifying animal-derived evidence suffer from cumbersome procedures and the difficulty of using traditional DNA barcoding technology to identify unknown species.

[0003] Chinese invention patent ZL 202311523425.6 discloses a primer composition and detection kit for identifying animal-derived components in food. The primer pair in this patent targets a gene sequence located in the mitochondrial 12S rRNA+tRNA Val+16S rRNA region, amplifying a fragment length of 1400–1700 bp. However, the full-length mitochondrial genome is approximately 16000–17000 bp. The selected fragment in this patent is relatively short, resulting in low resolution and making it difficult to distinguish between closely related species or different populations within the same species.

[0004] In conclusion, developing a reagent kit capable of rapidly and with high resolution identifying animal-derived components is a current research hotspot in the field of food safety testing, which will provide stronger technical support for combating adulteration. Summary of the Invention

[0005] The primary technical problem to be solved by this invention is to provide a primer for identifying animal-derived components based on third-generation sequencing technology.

[0006] Another technical problem to be solved by the present invention is to provide a kit for identifying animal-derived components containing the above-mentioned primers.

[0007] Another technical problem to be solved by the present invention is to provide a method for identifying animal-derived components using the above-mentioned reagent kit.

[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0009] A primer for identifying animal-derived components based on third-generation sequencing technology, wherein the primer is primer F shown in SEQ ID No. 1: GTATGACCGCGGTGGCTGGCAC, and primer R shown in SEQ ID No. 2: CCAAACTGGGATTAGATACCC.

[0010] A kit for identifying animal-derived components based on third-generation sequencing technology, including the aforementioned primers.

[0011] A method for identifying animal-derived components based on third-generation sequencing technology includes the following steps:

[0012] 1) Extraction of genomic DNA from samples: Genomic DNA is extracted using magnetic bead extraction or column extraction.

[0013] 2) Sample amplification: Prepare the amplification system according to the following system: 2x KeyPo SE Master 25μL, primer F10uM 1.5μL as shown in SEQ ID No.1, primer R10uM 1.5μL as shown in SEQ ID No.2, DNA 10~200ng, and sterile double-distilled water to make up to 50μL;

[0014] 3) Agarose gel electrophoresis detection: Take the amplification product from step 2) and perform agarose gel electrophoresis detection to detect the quality of the amplification product. The amplification band should be about 16k in size, the amplification band should be single, and there should be no non-specific amplification bands.

[0015] 4) Sample pretreatment: The MμLtiple samples dsDNA Library Prep Kit for ONTLigation Sequencing kit was used to construct a multi-sample library using the ligation method, and the multi-sample library construction and sequencing of genomic DNA and double-stranded DNA such as amplification products were performed using the amplification-free barcode kit (EXP-NBD104, EXP-NBD114).

[0016] 5) Sequencing chip preparation and installation;

[0017] 6) Data analysis: The DNA sequencing results are compared with the NCBI database using BLAST sequence comparison. The species with the highest similarity is the species to which the DNA belongs.

[0018] Preferably, in step 2), the amplification is performed under the following conditions: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, for a total of 35 cycles.

[0019] The application of the above primers and kits in the preparation of products for the identification of animal-derived components.

[0020] The primers and kits described in this invention can be applied to identification in the field of public safety, such as the identification of counterfeit animal-derived components in the fields of food, medicine, and environment.

[0021] Compared to conventional DNA barcoding or quantitative real-time PCR methods, the primers designed in this invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, enabling the identification of animal-derived components with a single primer pair, thus improving the detection efficiency of counterfeit animal-derived components in the public security, food, drug, and environmental protection fields. The primer pairs designed in this invention amplify all mitochondrial loci, including D-LOOP, COX1, COX2, COX3, and CYTB, providing higher species resolution compared to shorter fragments. Attached Figure Description

[0022] Figure 1 The genome structure of mitochondria;

[0023] Figure 2 This is an electrophoretic detection image from Embodiment 2 of the present invention;

[0024] Figure 3 This is an electrophoretic detection image of Embodiment 3 of the present invention;

[0025] Figure 4 This is an electrophoretic detection image of Embodiment 4 of the present invention. Detailed Implementation

[0026] The technical content of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0027] The abbreviations and key terms used in this invention are defined as follows:

[0028] Nanopore sequencing is a novel DNA sequencing technology that relies on passing a single DNA molecule through a nanoscale pore (nanopore) to read its base sequence. The core component of nanopore sequencing is a nanoscale pore formed from a protein or synthetic material. This pore is embedded in a thin film with electrodes on both sides. When a DNA molecule passes through the nanopore, it impedes the flow of electric current; different bases (A, T, C, G) impede the current in different ways. By detecting changes in current, the DNA sequence that passed through the nanopore can be deduced.

[0029] Species identification refers to the identification and determination of the species of an organism using specific biological methods. It is a key technology in many fields such as ecology, conservation biology, agriculture, and forensic medicine. With the development of technology, species identification methods have continuously evolved, encompassing a variety of approaches from traditional morphology to modern molecular biology.

[0030] Example 1: Primer Design for Animal-Derived Component Identification Based on Third-Generation Sequencing Technology

[0031] This invention analyzed the full-length mitochondrial genome sequences of common animal-derived adulterants, including pigs, cattle, sheep, chickens, ducks, horses, donkeys, geese, rats, rabbits, camels, dogs, cats, and foxes. The NCBI accession numbers for each species are as follows:

[0032] >NC_022418.1 Anas poecilorhyncha mitochondrion, complete genome

[0033] >NC_011196.1 Anser anser mitochondrion, complete genome

[0034] >NC_053523.1 Gallus gallus isolate bGalGal1 mitochondrion,

[0035] complete sequence, whole genome shotgun sequence

[0036] >NC_006853.1 Bos taurus mitochondrion, complete genome

[0037] >NC_009629.2 Camelus ferus mitochondrion, complete genome

[0038] >NC_002008.4 Canis lupus familiaris mitochondrion, complete genome

[0039] >NC_005044.2 Capra hircus isolate V07-146 mitochondrion, completegenome

[0040] >NC_001788.1 Equus asinus mitochondrion, complete genome

[0041] >NC_001640.1 Equus caballus mitochondrion, complete genome

[0042] >NC_001700.1 Felis catus mitochondrion, complete genome

[0043] >NC_005089.1 Mus muscμLus mitochondrion, complete genome

[0044] >NC_001913.1 Oryctolagus cunicμLus mitochondrion, complete genome

[0045] >NC_000845.1 Sus scrofa mitochondrion, complete genome

[0046] >NC_008434.1 VμLpes vμLpes mitochondrion, complete genome

[0047] By comparing sequence consistency, the highly conserved mitochondrial sequences of different species were analyzed, and universal primers were designed based on the highly conserved regions as amplification primers for full-length mitochondria. Primer F for SEQ ID No. 1: GTATGACCGCGGTGGCTGGCAC; Primer R for SEQ ID No. 2: CCAAACTGGGATTAGATACCC.

[0048] This invention utilizes the advantage of third-generation sequencing technology, which can cover read lengths from hundreds of bp to Mbp, to design the aforementioned primer set for identifying counterfeit animal-derived components in food, drugs, and the environment. This primer set can amplify full-length mitochondria of various species, and the amplification products include all mitochondrial loci such as D-LOOP, COX1, COX2, COX3, and CYTB. Figure 1 The mitochondrial genome structure is shown. This method covers a wealth of gene sequence information and can effectively identify closely related species or different populations within the same species that have similar sequences.

[0049] Example 2: Method for whole-genome sequencing of animal-derived samples using primer sets designed in this invention.

[0050] 1. Reagents and samples: Species DNA (ZYAGEN); KeyPo SE Master mix (Vazyme);

[0051] Primer F is shown in SEQ ID No. 1, and primer R is shown in SEQ ID No. 2.

[0052] 2. Equipment and Instruments: Third-generation sequencer, PCR instrument

[0053] 3. Experimental steps:

[0054] 1) Sample amplification:

[0055] Prepare the amplification system as follows: 25 μL KeyPo SE Master, 1.5 μL primer F (10 μM), 1.5 μL primer R (10 μM), 10–200 ng DNA, and sterile double-distilled water to a final volume of 50 μL.

[0056] Amplification was performed according to the following procedure: pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 10 sec, annealing at 60℃ for 30 sec, extension at 68℃ for 480 sec, for a total of 35 cycles.

[0057] 2) Agarose gel electrophoresis detection:

[0058] Take 5 μL of the amplification product from the previous step and perform agarose gel electrophoresis to detect its quality. The amplification band should be approximately 16 kb in size, and the electrophoresis should show a single specific band with no non-specific amplification bands. Figure 2 The electrophoretic detection image is shown.

[0059] 3) Sample pretreatment: The MμLtiple samples dsDNA Library Prep Kit for ONTLigation Sequencing was used for multi-sample library construction using the ligation method. This was combined with amplification-free barcode kits (EXP-NBD104, EXP-NBD114) for multi-sample library construction and sequencing of genomic DNA and amplification products (double-stranded DNA). The main components are shown in Table 1.

[0060] Table 1

[0061] Serial Number Component names Location Storage temperature 12 reactions 24 reactions A Magnetic beads Box 1 Refrigerate (2-8℃) 2×0.9mL 2×1.8mL B Cleaning solution (containing ethanol) Box 1 Refrigerate (2-8℃) 10×1mL 10×2mL C Nuclease-free water Box 2 Freezing (-20℃) 2×1mL 2×2mL D End repair buffer Box 2 Freezing (-20℃) 1×50μL 1×100μL E Terminal repair enzyme Box 2 Freezing (-20℃) 1×40μL 1×80μL F TA-connected premixed liquid Box 2 Freezing (-20℃) 1×200μL 1×400μL G T4 Fast Ligation Buffer Box 2 Freezing (-20℃) 1×75μL 1×150μL H T4 fast ligase Box 2 Freezing (-20℃) 1×35μL 1×70μL

[0062] Procedure: (It is recommended to use 1 to 1.5 μg gDNA or 300 fmol PCR product.)

[0063] S1: Prepare the mixture in a 0.2ml PCR tube, mix gently, and then centrifuge briefly.

[0064] Table 2

[0065]

[0066]

[0067] S2: PCR reaction system: 20℃, 10min; 65℃, 5min; 20℃∞.

[0068] S3: Magnetic bead purification: Use 54.5 μL of magnetic beads, wash with washing solution (containing ethanol) B, and elute with 15 μL of nuclease-free water.

[0069] a. Add the reaction mixture to an equal volume of magnetic beads (1.5 mL centrifuge tube) and gently mix by tapping or pipetting; incubate at room temperature for 10 min.

[0070] b. Transfer the test tube to the magnetic rack and let it stand for 2 minutes; carefully discard the supernatant (be careful not to let it touch the magnetic beads).

[0071] c. Add 200 μL of B cleaning solution (containing ethanol) to the tube; after a short while, carefully discard the supernatant (be careful not to let it come into contact with the magnetic beads).

[0072] d. Repeat step (use cleaning solution B (containing ethanol) for a second cleaning to remove impurities).

[0073] e. Immediately disconnect from the mini centrifuge and carefully discard any remaining liquid with a pipette; open the test tube cap and allow it to air dry for 30 seconds (do not allow it to dry and crack).

[0074] f. Add 15 μL of nuclease-free water to wash off, and gently tap to mix with your finger; incubate at room temperature for 5 min.

[0075] g. Place the tube back into the magnetic rack until the magnetic beads are attracted to one side of the rack or the mixture becomes clear; transfer 14 μL of supernatant into a clean PCR tube.

[0076] h. Take 1 μL of DNA for Qubit fluorescence quantification.

[0077] S4: Take equal amounts of samples, add the corresponding barcodes and record them (NBD01~NBD24), prepare a mixed system in a 0.2ml PCR tube, mix gently, and then centrifuge briefly.

[0078] Table 3

[0079] Components Volume (μL) DNA after end repair 12.5 Native Barcode 2.5 FTA-linked premixed solution 15 C Nuclease-free water supplement 30

[0080] S5: PCR reaction system: 25℃, 15min; 65℃, 10min; 20℃∞.

[0081] S6: Magnetic bead purification: Mix all barcode-added samples, purify with 1× magnetic beads, wash with washing buffer (containing ethanol) B, and elute with 50 μL of nuclease-free water. (Refer to the steps above).

[0082] S7: Prepare the mixture in a 0.2ml PCR tube, mix gently, and then centrifuge briefly.

[0083] Table 4

[0084] Components Volume (μL) Mixed samples 45 Sequencing adapter II (AMII) 5 G Fast Ligation Buffer 14 HT4 fast ligase 7 Total volume 70

[0085] S8: PCR reaction system: 20℃, 15min; 21℃∞.

[0086] S9: Magnetic bead purification: Wash with 0.5× magnetic beads (35 μL) short fragment buffer (SFB) and elute with 15 μL elution buffer (EB).

[0087] a. Add the reaction mixture to 35 μL of magnetic bead A (1.5 mL centrifuge tube) and gently mix by tapping or pipetting; incubate at room temperature for 10 min.

[0088] b. Transfer the test tube to the magnetic rack and let it stand for 2 minutes; carefully discard the supernatant (be careful not to let it touch the magnetic beads).

[0089] c. Add 200 μL of short fragment buffer (SFB) to the tube; after a few moments, carefully discard the supernatant (be careful not to let it come into contact with the magnetic beads).

[0090] d. Repeat the steps (using short-fragment buffer for secondary washing to remove impurities).

[0091] e. Immediately disconnect from the mini centrifuge and carefully discard any remaining liquid with a pipette; open the test tube cap and allow it to air dry for 30 seconds (do not allow it to dry and crack).

[0092] f. Add 15 μL of elution buffer (EB) to elute, and gently tap to mix with your finger; incubate at room temperature (preferably 34°C) for 5 min.

[0093] g. Place the tube back into the magnetic rack until the magnetic beads are attracted to one side of the rack or the mixture becomes clear; transfer 13 μL of supernatant into a clean PCR tube.

[0094] S10: Take 1 μL of barcoded DNA for Qubit fluorescence quantification, and use the remaining 12 μL of DNA library for instrumental experiments.

[0095] 4) Library construction and sequencing:

[0096] Following the instructions of the third-generation sequencing platform, tags and adapters were added to the amplified products sequentially to construct a sequencing library. Sequencing was then performed on the third-generation sequencing platform.

[0097] Sequencing chip preparation and setup:

[0098] S1: Turn clockwise 90° to the left to open the P hole.

[0099] S2: Adjust P1000 to 200, then slowly rotate it to the larger range (approximately 220-230) until the tip of the pipette draws up the yellow liquid.

[0100] S3: Prepare primer mixture: Add 30 μL of wash fixative (FLT) to a tube of wash buffer (FB) and mix well.

[0101] S4: Use P1000 to push 800 μL of the well-mixed primer mixture into the P well at a constant speed, and wait for 5 min.

[0102] S5: Prepare the sample loading mixture for the library: 75 μL in total.

[0103] Table 5

[0104] Components Volume (μL) Sequencing Buffer (SQB) / (SBII) 37.5 Loading Beads (LB) / (LBII) 25.5 DNA library 12 Total volume 75

[0105] S6: Flip the rubber cap upwards to open the S-hole.

[0106] S7: Then, push 200 μL (P1000) of the well-mixed primer mixture into the P well at a constant speed. At this point, you should see large droplets flowing upwards from the S well.

[0107] S8: Use P200 to add 75μL of the prepared sample mixture of the test library through the S-hole, and control the dropping speed to ensure that the library fills the chip area.

[0108] S9: Close the S-well and P-well to prepare for sequencing.

[0109] S10: Place the chip into the third-generation sequencer and begin sequencing.

[0110] Data Analysis:

[0111] The sequencing results are compared with the NCBI database using BLAST (Basic Local Alignment Search Tool). The species with the highest similarity is the species to which the DNA belongs.

[0112] Example 3: Accuracy verification experiment of the kit designed in this invention.

[0113] 1. Reagents and samples: Sheep DNA (ZYAGEN); KeyPo SE Master mix (Vazyme);

[0114] Primer F is shown in SEQ ID No. 1, and primer R is shown in SEQ ID No. 2.

[0115] 2. Equipment and Instruments: Third-generation sequencer, PCR instrument

[0116] 3. Experimental steps:

[0117] 1) Extracting genomic DNA from samples: Genomic DNA is extracted using magnetic bead method or column method.

[0118] 2) Sample amplification: Prepare the amplification system as follows: 2x KeyPo SE Master 25 μL, primer F (10 μM) 1.5 μL, primer R (10 μM) 1.5 μL, DNA 10–200 ng, and sterile double-distilled water to a final volume of 50 μL. Perform amplification according to the following program: pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 10 sec, annealing at 60℃ for 30 sec, extension at 68℃ for 480 sec, for a total of 35 cycles.

[0119] 3) Agarose gel electrophoresis detection: Take 5 μL of the amplification product from the previous step for agarose gel electrophoresis detection. To assess the quality of the amplification product, the amplification band size should be approximately 16 kb. The electrophoresis should show a single specific band with no non-specific amplification bands. Figure 3 The electrophoretic detection image is shown.

[0120] 4) Purification of amplification products: Purify PCR amplification products using magnetic beads or other purification methods with equivalent effectiveness.

[0121] 5) Library construction and sequencing: Following the instructions of the third-generation sequencing platform, tags and adapters were added to the amplified products to construct the sequencing library. Sequencing was performed on the third-generation sequencing platform. The sequencing results are shown in SEQ ID No. 3.

[0122] 6) Data analysis: The DNA sequencing results are compared with the NCBI database using BLAST sequence comparison. The species with the highest similarity is the species to which the DNA belongs.

[0123] The comparison results are as follows:

[0124] Query: dna Query ID: lcl|Query_1675869Length: 16491

[0125] >Capra hircus isolate V07-146 mitochondrion, complete genome SequenceID: NC_005044.2Length: 16643

[0126] >Capra hircus isolate V07-146 mitochondrion, complete genome SequenceID: GU295658.1Length: 16643

[0127] Range 1: 480 to 16643

[0128] Score: 29850bits(16164), Expect: 0.0,

[0129] Identities: 16164 / 16164 (100%), Gaps: 0 / 16164 (0%), Strand: Plus / Plus

[0130] The DNA sample showed 100% similarity to the mitochondrial genome of Capra hircus, a sheep species, indicating that the sample originated from sheep. The experimental results demonstrate that the primer set of this invention has high resolution, high accuracy, and strong specificity.

[0131] Example 4: Sample adaptability verification experiment of the primer set and reagent kit designed in this invention.

[0132] 1. Reagents and Samples:

[0133] Sample 1: Duck blood; Sample 2: Whole cut mutton; Sample 3: Beef jerky; Sample 4: Pork jerky (purchased from the market); KeyPoSE Master mix (Vazyme);

[0134] Primer F is shown in SEQ ID No. 1, and primer R is shown in SEQ ID No. 2.

[0135] 2. Equipment and Instruments: Third-generation sequencer, PCR instrument

[0136] 3. Experimental steps:

[0137] 1) Extracting genomic DNA from samples: Genomic DNA is extracted using magnetic bead method or column method.

[0138] 2) Sample amplification: Prepare the amplification system as follows: 2x KeyPo SE Master 25 μL, primer F (10 μM) 1.5 μL, primer R (10 μM) 1.5 μL, DNA 10–200 ng, and sterile double-distilled water to a final volume of 50 μL. Perform amplification according to the following program: pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 10 sec, annealing at 60℃ for 30 sec, extension at 68℃ for 480 sec, for a total of 35 cycles.

[0139] 3) Agarose gel electrophoresis detection: Take 5 μL of the amplification product from the previous step for agarose gel electrophoresis detection. To assess the quality of the amplification product, the amplification band size should be approximately 16 kb. The electrophoresis should show a single specific band with no non-specific amplification bands. Figure 4 The electrophoretic detection image is shown below;

[0140] 4) Purification of amplification products. Purify PCR amplification products using magnetic beads or an equivalent purification method.

[0141] 5) Library construction and sequencing: Following the instructions of the third-generation sequencing platform, tag and adapters were added to the amplification products to construct the sequencing library. Sequencing was then performed on the third-generation sequencing platform.

[0142] The sequencing results of sample 1 are shown in SEQ ID No. 4.

[0143] The sequencing results of sample 2 are shown in SEQ ID No. 5.

[0144] The sequencing results of sample 3 are shown in SEQ ID No. 6.

[0145] The sequencing results of sample 4 are shown in SEQ ID No. 7.

[0146] 6) Data Analysis: The DNA sequencing results were compared with the NCBI database using BLAST. The species with the highest similarity was identified as the species to which the DNA belonged. The comparison results are shown below:

[0147] Sample 1 DNA alignment results:

[0148] Query: sample Query ID: lcl|Query_928503Length: 16436

[0149] >Anas poecilorhyncha mitochondrion, complete genome Sequence ID: NC_022418.1Length: 16608

[0150] >Anas poecilorhyncha mitochondrion, complete genome Sequence ID: KF156760.1Length: 16608

[0151] Range 1: 517 to 16608

[0152] Score: 29717bits(16092), Expect: 0.0,

[0153] Identities: 16092 / 16092 (100%), Gaps: 0 / 16092 (0%), Strand: Plus / Plus

[0154] DNA alignment results of sample 2:

[0155] Query: dna Query ID: lcl|Query_1675869 Length: 16491

[0156] >Capra hircus isolate V07-146 mitochondrion, complete genome Sequence ID: NC_005044.2 Length: 16643

[0157] >Capra hircus isolate V07-146 mitochondrion, complete genome Sequence ID: GU295658.1 Length: 16643

[0158] Range 1: 480 to 16643

[0159] Score: 29850 bits(16164), Expect: 0.0,

[0160] Identities: 16164 / 16164 (100%), Gaps: 0 / 16164 (0%), Strand: Plus / Plus

[0161] DNA alignment results of sample 3:

[0162] Query: sample Query ID: lcl|Query_417931 Length: 16185

[0163] >Bos taurus mitochondrion, complete genome Sequence ID: MF925711.1 Length: 16340

[0164] Range 1: 479 to 16340

[0165] Score: 29226 bits(15826), Expect: 0.0,

[0166] Identities: 15850 / 15862 (99%), Gaps: 0 / 15862 (0%), Strand:

[0167] Plus / Plus

[0168] DNA alignment results for sample 4:

[0169] Query: sample Query ID: lcl|Query_939985Length: 16459

[0170] >Sus scrofa isolate DM1122 mitochondrion, complete genome Sequence ID: MT483613.1Length: 16620

[0171] Range 1: 486 to 16620

[0172] Score: 29523 bits (15987), Expect: 0.0,

[0173] Identities: 16090 / 16138 (99%), Gaps: 13 / 16138 (0%), Strand: Plus / Plus

[0174] Through comparison, Sample 1 DNA showed 100% similarity to *Anas poecilorhyncha*, indicating that this sample contains duck-derived components; Sample 2 DNA showed 100% similarity to *Capra hircus*, indicating that this sample contains sheep-derived components; Sample 3 DNA showed 99% similarity to *Bos taurus*, indicating that this sample contains bovine-derived components; and Sample 4 DNA showed 99% similarity to *Sus scrofa*, indicating that this sample contains porcine-derived components. All the above sample test results are consistent with the label, and no adulteration was found.

[0175] The above experimental results demonstrate that the primers designed in this invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, and accurate identification of animal-derived components can be achieved with only one pair of primers, thus improving the detection efficiency of identifying counterfeit animal-derived components in the fields of public security, food, drug and environmental protection.

Claims

1. A primer for identifying animal-derived components based on third-generation sequencing technology, characterized in that, The primers are primer F shown in SEQ ID No. 1: GTATGACCGCGGTGGCTGGCAC, and primer R shown in SEQ ID No. 2: CCAAACTGGGATTAGATACCC.

2. A kit for identifying animal-derived components based on third-generation sequencing technology, characterized in that... Includes the primers described in claim 1.

3. A method for identifying animal-derived components based on third-generation sequencing technology, characterized in that... Includes the following steps: 1) Extraction of genomic DNA from samples: Genomic DNA is extracted using the magnetic bead method or the column method; 2) Sample amplification: Prepare the amplification system according to the following system: 2x KeyPo SE Master 25μL, primer F 10uM 1.5μL as shown in SEQ ID No.1, primer R 10uM 1.5μL as shown in SEQ ID No.2, DNA 10~200ng, and sterile double-distilled water to make up to 50μL; 3) Agarose gel electrophoresis detection: Take the amplification product from step 2) and perform agarose gel electrophoresis detection to detect the quality of the amplification product. The amplification band size should be 16kb, and the electrophoresis detection should show a single specific band without any non-specific amplification bands. 4) Purification of amplification products: PCR amplification products were purified using the magnetic bead method; 5) Library construction and sequencing: Tags and adapters are added to the amplification products sequentially to construct sequencing libraries, which are then sequenced on a third-generation sequencing platform; 6) Data analysis: The DNA sequencing results are compared with the NCBI database using BLAST sequence comparison. The species with the highest similarity is the species to which the DNA belongs.

4. The method for identifying animal-derived components as described in claim 3, characterized in that, In step 2), the amplification is performed under the following conditions: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, for a total of 35 cycles.

5. The application of the primers described in claim 1 in the preparation of products for identifying animal-derived components.

6. The use of the kit according to claim 2 in the preparation of products for identifying animal-derived components.

Citation Information

Patent Citations

  • Long-fragment universal primer composition for identifying animal-derived components in food, detection kit and identification method

    CN117230214A

  • Method of using gene chip technology to identify and detect 16 animal-derived compositions

    CN102758002A

  • Mitochondrial genome sequencing primer, kit and method

    CN111378732A