INSIG1 gene SNPs marker related to daily lactation yield of sheep and application of INSIG1 gene SNPs marker

Abstract

The invention discloses an INSIG1 gene SNPs marker related to daily lactation yield of sheep and application of the INSIG1 gene SNPs marker, and belongs to the technical field of biology. According to the research, the relative expression quantity of INSIG1 is detected by adopting a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) method, the SNPs and genotype of the INSIG1 gene are analyzed, the correlation between the nucleotide sequence variation of the gene and the lactation traits such as the daily lactation yield, the milk protein rate and the milk fat rate of the milk sheep is analyzed, an effective molecular genetic marker is provided for molecular breeding of the milk sheep, and SNP1: c.79A / G and SNP2: c.* 533T / C are obtained; the daily lactation yields of AG type individuals and GG type individuals on the SNP1 site are respectively 0.135 kg and 0.238 kg higher than those of AA type individuals. And the daily lactation yield of the CC type individual on the SNP2 site is 0.261 kg higher than that of the TT type individual.

Description

Technical Field

[0001] The invention relates to an INSIG1 gene SNPs marker related to the daily milk production of sheep and application thereof, belonging to the field of biotechnology. Background Art

[0002] Sheep milk is known as the aristocrat of milk and is favored by consumers. Its milk protein rate (4.4-6.6%) and milk fat rate (5.3%-9.3%) are higher than those of cow milk and goat milk. It is rich in monounsaturated fatty acids, conjugated linoleic acid, medium-chain triglycerides and essential fatty acids, which help prevent cardiovascular diseases and inflammation. The dairy sheep industry is mainly concentrated in Europe, West Asia and parts of Africa. The main dairy products are cheese, fresh milk, yogurt and milk powder, while my country's dairy sheep industry is a sunrise industry. Lactation traits are important economic traits of dairy sheep and are affected by multiple factors. In the process of improving the lactation performance of dairy sheep, genetics is an important factor. Conventional breeding methods have a long breeding cycle and low efficiency, while molecular marker-assisted breeding has the advantages of being fast, accurate and not affected by environmental conditions.

[0003] Insulin induced genes (INSIGs) are genes closely related to fat metabolism. This gene family includes two members: insulin induced gene 1 (INSIG1) and insulin induced gene 2 (INSIG2). Studies have found that the INSIG1 gene binds to the sterol regulatory element-binding cleavage activating protein (SREBP cleavageactivating protein, SCAP), hindering the transcription process of sterol regulatory element-binding proteins (SREBP) target genes, thereby reducing the synthesis of sterols, fatty acids and triglycerides.

[0004] Studies have shown that single nucleotide polymorphisms (SNPs) of the INSIG1 gene are related to the fatty acid composition of milk. For example, Rincon et al. found three SNPs sites in exon 1, exon 4, and intron 6 of Holstein cows that significantly affect milk fatty acids. Among them, allele C at ss252452218 on exon 1 and allele G at ss252452223 on intron 6 affect the saturated fatty acid content of milk, while allele C at ss252452220 on exon 4 has a significant effect on the content of saturated fatty acids and monounsaturated fatty acids in milk. At present, there are no reports on the relationship between INSIG1 gene SNPs and livestock milk production. Summary of the invention

[0005] In this study, the real-time fluorescence quantitative PCR (Reverse transcriptase-quantitative-PCR, RT-qPCR) method was used to detect the relative expression level of INSIG1, and the SNPs and genotypes of the INSIG1 gene were analyzed through Sanger sequencing and penta-primer amplification refractory mutation system (PARMS) technology. The correlation between the nucleotide sequence variation of the modified gene and lactation traits such as daily milk production, milk protein rate, and milk fat rate of dairy sheep was analyzed, in order to provide effective molecular genetic markers for molecular breeding of dairy sheep.

[0006] The single nucleotide polymorphism genetic marker of the present invention is located in the INSIG1 gene of the positive chain of chromosome 4 in the sequence information of the sheep reference genome ARS-UI_Ramb_v3.0 version.

[0007] The present invention provides an application of a reagent for detecting the genotype of at least one of the following two SNP sites in identifying or assisting in identifying sheep milk production traits;

[0008] The SNP site is a site corresponding to the INSIG1 gene sequence of chromosome 4 on the positive strand of the sheep genome sequence, where adenine is replaced by guanine (SNP1) at c. 79 bp;

[0009] The SNP1 sequence is amplified from the INSIG1 gene, specifically:

[0010] ACCTGACCTGCTTTGGAAGTGAACTTGATCAGGGTTCCACCTCCACGCCCCTTTTCGTTCTAGGAAAGCCTGCAGGCTGGTGGCTCATGCCCAGACTGGACGACCACCTCTGGAGAGGTCCCTGTGCCAAGGGCACGAAGCACAGAAGCCACCCGAGGGCCAGC [A / G]CCAGAGGGCTGGTGGCCAAAGCGGGAGAGATGATCAACTCCTCGGGGTCAGGCCCCTCTCTGCTGGCAGCCCATGGCGCCCCGGGCACTGACCCCGCTCACGGGCTTCAGAGCACTGGTGTGGGGGGCCAGGGCAGCAGCGGCCAC GTCAACAGCTGGCATCACCACTTGGTGCAGGAGCCTGGTGCTGTTCTCGGTGGGGGTGGTCCTGGCCTTGGTGCTCAACCTCCTGCAGGTCCAGAGGAATGTCACCCTGTTCCCGGACGAGGTCATCGCCACCATCTTCTCCTC.

[0011] Among them, the adenine at the 79th bp of the CDS region of the INSIG1 gene was replaced by guanine, that is, [A / G] Represents the base sequence before and after the mutation;

[0012] The SNP site is c. * Thymine at 533 bp was replaced by cytosine (SNP2);

[0013] The SNP2 sequence was amplified from the INSIG1 gene, specifically:

[0014] AGCTTGGTTCCATGTCAGGGCCCTGGGGATGGCTTGGTGGTGCTTATGAAGATGAAGTGTGGTGAGATAGGAATATTACTCATCCAAAAGATTTTTAAAATAGGGCTGTGTTGTGAAAAAGAGAAGGCAGTGGTGGCAGCAAGTGCTGGGTGGCCGTGCCGGGCAGGCGGGCACGGCGTGCCCTCGGTGCCCG [T / C] GTGGGGCCGCACACAGACAGTCCTGCAGAGGAGGCAGTGAGTGGGAGGTCGTGGCTCTGTGCTTCGATGGGTTGGACTTTCCACCCCGGTATTCACAGAGTTTGCCCGGAATCCGCGTCGTCTCGAAGGGGGCACCCGCCGGCCACACGTCTCCGTCTTGGCCCAAAACTTGCGTTTTTCTCTGATACTCGGGAAGAAGAGACAGCT.

[0015] Among them, the thymine at the 533rd bp of the 3′ UTR of the INSIG1 gene was replaced by cytosine, that is, [T / C] Represents the base sequence before and after the mutation.

[0016] In one embodiment of the present invention, the milk production trait is daily milk yield.

[0017] The present invention also provides a single nucleotide polymorphism genetic molecular marker related to sheep milk production traits, wherein the single nucleotide polymorphism genetic marker is located in the sheep INSIG1 gene, and the single nucleotide polymorphism genetic molecular marker is any one or more combinations of the following (a) to (b);

[0018] (a) The single nucleotide polymorphism genetic marker is located at the c. 79 bp position of the INSIG1 gene sequence on the positive strand of chromosome 4 of the sheep genome sequence, and there is an A / G base mutation;

[0019] (b) The single nucleotide polymorphism genetic marker is located at c. * 533bp site, and there is a T / C base mutation.

[0020] In one embodiment of the present invention, the milk production trait is daily milk yield.

[0021] The present invention also provides an application of a haplotype combination sequence of a single nucleotide polymorphism molecular marker associated with sheep milk production traits in improving the daily milk production of sheep, wherein the haplotype combination is the haplotype combination of the single nucleotide polymorphism genetic marker associated with sheep milk production traits as described in claim 2, and the haplotype combination sequence label is ATGC;

[0022] The single nucleotide polymorphism genetic marker is located at the c. 79 bp position of the INSIG1 gene sequence of chromosome 4 in the positive strand of the sheep genome sequence, and there is an A / G base mutation; or is located at the c. * 533bp site, and there is a T / C base mutation.

[0023] The present invention also provides a method for identifying or assisting in identifying sheep milk production traits, the method being any one of the following 1)-2):

[0024] 1) comprising the following steps: detecting the genotype of the SNP site c. 79A / G in the INSIG1 gene of the tested sheep; the genotype of the SNP site c. 79A / G is AA, AG and GG;

[0025] The daily milk production of the test sheep whose genotype of SNP site c. 79A / G in the INSIG1 gene is AG or GG is better than or auxiliary better than that of the test sheep whose genotype of SNP site c. 79A / G is AA;

[0026] 2) comprising the following steps: detecting the SNP site c in the INSIG1 gene of the test sheep. * 533T / C genotype; the SNP site c. * The genotypes of 533T / C were TT, TC, and CC;

[0027] The SNP site in the INSIG1 gene c. * The daily milk yield of the tested sheep with 533T / C genotype CC is better than or assisted by the SNP site c. * The 533T / C sheep had the TT genotype.

[0028] The invention also provides application of the method in sheep screening or sheep breeding.

[0029] In one embodiment of the present invention, in the application, any of the following sheep are selected for milk production or breeding:

[0030] The test sheep with genotypes of SNP site c.79A / G in the INSIG1 gene being AG or GG;

[0031] Or the SNP site c in the INSIG1 gene. * The 533T / C genotype of the tested sheep was CC.

[0032] The present invention also provides a primer pair for detecting mutations in the INSIG1 gene, wherein the upstream and downstream nucleotide sequences of the primer pair are respectively shown as SEQ ID NOs. 1-2; or the upstream and downstream nucleotide sequences of the primer pair are respectively shown as SEQ ID NOs. 3-4.

[0033] The present invention also provides a method for detecting the above-mentioned molecular markers related to sheep milk production traits, the method comprising the following steps:

[0034] a) extracting genomic DNA from sheep blood as a sample, and performing PCR amplification on the sheep INSIG1 gene using primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4;

[0035] b) performing mixed pool sequencing and sequence analysis on the above PCR amplification products to obtain the mutation site and determine the mutation type;

[0036] c) performing INSIG1 genotyping on the identified sheep individuals, and identifying the genotype and haplotype of the SNP site in the sheep INSIG1 gene detection region according to the typing results.

[0037] The present invention also provides a kit for detecting molecular markers related to sheep milk production traits, wherein the kit comprises a primer pair.

[0038] The nucleotide sequences of the upstream and downstream of the primer pair are shown as SEQ ID NO.1-2 respectively; or the nucleotide sequences of the upstream and downstream of the primer pair are shown as SEQ ID NO.3-4 respectively.

[0039] The present invention also provides an application of the above primer pair or primer combination, wherein the application is any one of the following (a)-(f):

[0040] (a) Determine or assist in determining the daily milk production of sheep;

[0041] (b) sheep screening;

[0042] (c) sheep breeding;

[0043] (d) preparing a kit for identifying or assisting in identifying the daily milk production of sheep;

[0044] (e) preparing a kit for sheep screening;

[0045] (f) Preparation of a kit for sheep breeding.

[0046] The nucleotide sequences of the upstream and downstream of the primer pair are shown as SEQ ID NO.1-2 respectively; or the nucleotide sequences of the upstream and downstream of the primer pair are shown as SEQ ID NO.3-4 respectively.

[0047] Beneficial Effects

[0048] The present invention uses lactating sheep as the research object, applies Sanger and other technologies to detect the nucleotide sequence variation sites of the INSIG1 gene, and constructs a general linear mixed effects model to study the correlation between nucleotide sequence variation and sheep lactation traits, and to explore molecular genetic markers that regulate sheep lactation traits; the present invention has achieved some positive effects and indeed has great advantages compared with the prior art, as follows:

[0049] (1) A single nucleotide polymorphism (SNP) site was identified in exon 2 of the INSIG1 gene: c. 79A / G (SNP1). This site is a missense mutation, which causes the encoded amino acid to change from threonine to alanine. A SNP site was found in the 3′UTR of the INSIG1 gene, c. * 533T / C (SNP2).

[0050] (2) Both SNPs significantly affected the daily milk production of sheep (P < 0.05), but had no significant effect on other traits. The daily milk production of AG and GG individuals at SNP1 was 0.135 kg and 0.238 kg higher than that of AA individuals, respectively (P < 0.05). The daily milk production of CC individuals at SNP2 was 0.261 kg higher than that of TT individuals.

[0051] (3) We analyzed the effects of three haplotype combinations with a frequency greater than 5%, H1H1, H1H2 and H1H3, on lactation traits. The results showed that the daily milk yield of the H1H2 combination was significantly higher than that of the H1H1 and H1H3 combinations (P < 0.05), and the haplotype combination had no significant effect on other milk components (P > 0.05). BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 : Tissue expression profile of INSIG1 gene.

[0053] Figure 2 : Figure 2 Sequencing results of SNP1 and SNP2 of sheep INSIG1 gene; A is SNP1 c. 79A / G, B is SNP2 c.* 533T / C.

[0054] Figure 3 : Linkage disequilibrium analysis of sheep INSIG1 gene. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0056] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0057] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0058] The detection methods involved in the following embodiments are as follows:

[0059] The following indicators were measured using the UL40BC milk composition analyzer:

[0060] Milk fat content: the percentage of fat in milk.

[0061] Milk protein rate: the percentage of protein contained in milk.

[0062] Ash content: The amount of minerals in milk.

[0063] Non-milk fat solids content: the content of nutrients in milk other than fat and water.

[0064] Dry matter content: the content of other nutrients in milk after removing water.

[0065] Lactose: The amount of lactose in sheep's milk.

[0066] The daily milk production of each test sheep was measured using a DeLaval 9JP-2X24 parallel milking machine.

[0067] Example 1: Gene sequencing and analysis of SNPs associated with daily milk production in sheep

[0068] 1. Sample collection

[0069] At Yuansheng Agriculture and Animal Husbandry Technology Co., Ltd. in Yongchang County, Gansu Province, 450 dairy sheep were selected under the same feeding and management conditions, including 34 East Friensian sheep (EF), 57 Hu sheep (H), 197 East Friensian sheep × Hu sheep hybrid first generation (F1), and 162 East Friensian sheep × Hu sheep hybrid second generation (F2). All the experimental sheep were in good health, and the data on age, parity, number of lambs, and daily milk production were complete.

[0070] One ml of blood was collected from each sheep by the jugular vein blood sampling method, dropped onto FTA cards (Whatman, Middlesex, UK), and then dried and stored for genomic DNA extraction.

[0071] In the middle of lactation, 50 ml of milk sample was collected from each experimental sheep, and milk composition indicators such as milk protein rate, milk fat rate, lactose rate, and non-fat milk solids content were determined using a UL40BC milk composition analyzer (U-Chuang, Hangzhou, China).

[0072] At the same time, another three F1 ewes in mid-lactation were selected, and heart, liver, spleen, lung, kidney, mammary gland and ovarian tissue samples were collected after slaughter and stored in 2 mL cryotubes with liquid nitrogen for analysis of INSIG1 gene expression characteristics.

[0073] 2. Synthesis of genomic DNA, tissue total RNA and cDNA

[0074] The two-step method described by Zhou et al. (2006) was used to extract genomic DNA from the blood of all sheep for nucleotide sequence variation site screening and typing. Blood genomic DNA was extracted from FTA cards for screening of INSIG1 gene SNPs sites. The specific method is to use a sampler to take a 1.2 mm diameter disc on the FTA card, place it in a 1.5 mL centrifuge tube, add 200 μL of 20 mmol / L NaOH to the centrifuge tube, and incubate at room temperature for 30 minutes; if the blood sample is stored for a long time, heat it in a 50°C water bath for 25 minutes, and turn the centrifuge tube from time to time during the incubation period; discard the NaOH solution in the tube. Add 200 μL TE solution and let it stand for 2 minutes; discard the TE buffer solution, air-dry the disc at room temperature, and set aside.

[0075] Total RNA was extracted from heart, liver, spleen, lung, kidney, breast, and ovary tissues using the Trizol method and quality checked using a NanoDrop 8000 spectrophotometer (Thermo, MA, USA). RNA that passed the quality check was reverse transcribed into cDNA using the SweScript Reverse Transcriptase II Reverse Transcription Kit (Sevier, Wuhan, China) for detection of INSIG1 gene expression.

[0076] 3. Primer design and PCR amplification

[0077] According to the sheep INSIG1 gene sequence published in GeneBank (GeneID: 101106422), seven pairs of specific primers P1-P7 (Table 1) were designed using primer3.0 software to amplify all exons and 3′ untranslated region (3′ UTR) of the INSIG1 gene. At the same time, the primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0078] Five samples were randomly selected from each group for PCR amplification, and the PCR products were mixed and then subjected to Sanger sequencing to screen gene SNPs sites.

[0079] Table 1: Primer sequence information

[0080] 2) PCR amplification and SNPs site detection

[0081] Twenty samples were randomly selected from the test sheep, and 7 regions of the INSIG1 gene were amplified using a 20 μL PCR reaction system, including a 1.2 mm DNA card, 0.8 μL of upstream and downstream primers (10 μmol / L), 10.4 μL of TaqDNA polymerase, and 8.0 μL of ddH2O. The amplification conditions were: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 56-62°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles; 72°C final extension for 7 min; 4°C storage. 2 μL of the PCR amplification products of the 20 samples were taken from each sample, mixed according to the principle of equal amount, and sent to Yangling Tianrun Aoke Biotechnology Co., Ltd. for Sanger sequencing. Finally, Chromas software was used to compare and screen SNPs sites.

[0082] (3) Analysis of INSIG1 gene expression characteristics

[0083] Primers were designed in the CDS region, and the specific information is shown in Table 1. Using β-actin as the internal reference gene, the expression of INSIG1 gene in seven tissues including heart, liver and breast was detected by RT-qPCR on a LightCycler 480 instrument (Roche Applied Science, Mannheim, Germany):

[0084] The qualified cDNA was diluted to a concentration of 30 ng / μL, and β-actin was used as the internal reference gene. RT-qPCR was performed on an Applied Biosystems QuantStudio®6 Flex qPCR instrument (Thermo Fisher Scientific, New York, USA) using a 20 μL system, including 10 μL SYBR Green qPCR Master Mix (Sevier, Wuhan, China), 7.2 μL deionized water, 0.8 μL primers, and 2 μL cDNA. Three biological replicates and four technical replicates were performed for each sample, and 2 were used for final analysis. -ΔΔCt The relative expression level of INSIG1 gene in different tissues of sheep was calculated by this method.

[0085] (4) Experimental results

[0086] RT-qPCR results showed that the INSIG1 gene was expressed in sheep heart, liver, spleen, lung, kidney, ovary and mammary gland tissues, with the highest expression level in mammary gland tissue, which was 1.42, 5.08, 9.67, 10.49, 30.43 and 39.65 times that of liver, lung, spleen, ovary, kidney and heart, respectively, and the lowest expression level in heart ( Figure 1 ).

[0087] The results showed that a single nucleotide polymorphism site c. 79A / G (SNP1, Figure 2 A), this site is a missense mutation, resulting in the change of the encoded amino acid from threonine to alanine. A SNP site was found in the 3′UTR of the INSIG1 gene, c. * 533T / C (SNP2, Figure 2 B). No SNPs were detected in the PCR products amplified by the other five primer pairs.

[0088] SNP1: Single nucleotide polymorphism site 1, which is: c. 79A / G, indicating that there is a base A / G mutation at c. 79 bp of the INSIG1 gene sequence located on sheep chromosome 4, where A (adenine) is replaced by G (guanine);

[0089] SNP2: represents single nucleotide polymorphism site 2, which is: c. * 533T / C, indicating that the INSIG1 gene sequence located on sheep chromosome 4 is in the non-coding region c. * There is a base T / C mutation at 533bp, where thymine (T) is replaced by cytosine (C);

[0090] Based on the two SNPs found, primers for amplifying the above SNPs can be designed, including a forward primer and a reverse primer, wherein the forward primer and the reverse primer are respectively located upstream and downstream of the above five single nucleotide polymorphism sites. Based on the primers of the above SNPs, a kit for detecting the above SNPs can also be designed using existing technology.

[0091] Example 2: Association between genotyping and milk production traits in sheep

[0092] 1. Experimental methods

[0093] (1) PARMS genotyping and haplotype construction

[0094] According to the sequencing results in Example 1, the SNPs sites that mutated in the second exon region and 3 'UTR region of the INSIG1 gene were counted, and the blood DNA samples extracted from the blood of 450 ewes in the lactation period selected in Example 1 were matched with the SNPs site information of the INSIG1 gene, and the nucleotide sequences were compared using Chromas software to screen the SNPs sites on the INSIG1 gene. The genotypes at the variant sites were typed using PARMS technology. The screened SNPs sites were sent to Wuhan Jingpeptide Biological Co., Ltd. for allele and genotype typing.

[0095] Popgene32.0 was used to calculate the allele frequency and genotype frequency of the variant sites. Haploviewv4.2 software was used to construct haplotypes, and haplotypes with a frequency greater than 1% were selected to construct haplotype combinations.

[0096] (3) Correlation analysis of lactation traits

[0097] A total of 450 dairy sheep in lactation were tested for polymorphism, their genotypes were determined, and the general linear mixed effects model of SPSS16.0 was used to analyze the correlation between the genotype and haplotype of INSIG1 gene SNPs with a frequency greater than 5% and sheep lactation traits. The analysis results were expressed as mean ± standard error.

[0098] In order to determine the fixed effects and random effects included in the model, we analyzed the effects of age, lambing number and parity on lactation traits in sheep. The results showed that lambing number and parity had no significant effect on lactation traits, but age had a very significant effect on lactation traits. SPSS16.0 general linear mixed effects model was used to analyze the correlation between INSIG1 genotype (allele or haplotype) and lactation traits in sheep.

[0099] The model is Y = μ + Genotype (Haplotype) + Population + Age + e, where Y represents lactation traits, μ is the population mean, Genotype is the genotype, Haplotype is the haplotype, Population is the experimental population, Age is age, and e is the random effect.

[0100] 2. Experimental results

[0101] The embodiments of the present invention have achieved some positive effects during the development or use process, and indeed have great advantages over the prior art. The following content is described in conjunction with data, charts, etc. of the test process.

[0102] (1) PARMS typing results and allele frequencies of INSIG1 gene SNPs

[0103] There are three genotypes in SNP1: AA, AG and GG (Table 2), of which AA is the dominant genotype and A is the dominant allele. Only in the Hu sheep population was no GG type individual detected, while the other three populations all had three genotypes. After testing, it was found that the four groups were in Hardy-Weinberg equilibrium (P>0.05).

[0104] There are also three genotypes in SNP2: TT, TC and CC (Table 2), among which TT is the dominant genotype and T is the dominant allele. No CC genotype individuals were found in the Hu sheep population, while the other three populations all have the three genotypes.

[0105] Table 2: Genotype and allele frequencies of the sheep INSIG1 gene

[0106] (2) Effect of INSIG1 genotype on lactation traits

[0107] Both SNPs loci significantly affected the daily milk production of sheep (P<0.05), but had no significant effect on other traits. The daily milk production of AG and GG type individuals at SNP1 locus was 0.135 kg and 0.238 kg higher than that of AA type individuals, respectively (P<0.05). The daily milk production of CC type individuals at SNP2 locus was 0.261 kg higher than that of TT type individuals (P<0.05).

[0108] Table 3: Effects of sheep INSIG1 genotype on lactation traits

[0109] Note: Different lowercase letters in the same line indicate significant differences (P<0.05), the same below

[0110] (3) Haplotype analysis of sheep INSIG1 gene

[0111] The linkage disequilibrium status between the two SNPs c. 79A / G and c. *533T / C in the sheep INSIG1 gene is shown in Figure 3 The results showed that SNP1 and SNP2 could form a haplotype module and were in a strong linkage disequilibrium state (r 2 =0.71).

[0112] There are three haplotypes between SNP1 and SNP2, namely H1 to H3 (Table 4). The frequency of haplotype H1 is the highest (73.5%), while the frequencies of H2 and H3 are relatively low, at 20.2% and 6.3%, respectively.

[0113] Table 4: Haplotype analysis of INSIG1 gene SNPs

[0114] A total of 6 haplotype combinations were formed between the above three haplotypes (Table 5), namely H1H1, H1H2, H1H3, H2H2, H2H3 and H3H3, and their frequencies were 54.0%, 31.6%, 8.2%, 3.1%, 2.9% and 0.2%, respectively.

[0115] Table 5: Haplotype combination analysis of INSIG1 gene SNPs loci

[0116] (4) Association analysis between sheep INSIG1 gene haplotype combinations and lactation traits

[0117] We analyzed the effects of three haplotype combinations H1H1, H1H2 and H1H3 with a frequency greater than 5% on lactation traits. The results showed that the daily milk yield of the H1H2 combination was significantly higher than that of the H1H1 and H1H3 combinations (P < 0.05), and the haplotype combination had no significant effect on other milk components (P > 0.05).

[0118] Table 6: Association analysis between sheep INSIG1 gene haplotype combinations and lactation traits

[0119] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Use of a reagent for detecting the genotype of at least one of the following two SNP sites in identifying or assisting in identifying the milk production trait of sheep; the SNP site is the positive strand of chromosome 4 corresponding to the sheep genome sequence INSIG1 The adenine at c. 79 bp of the gene sequence was replaced by guanine; The SNP site corresponds to the positive strand of chromosome 4 in the sheep genome sequence. INSIG1 Gene sequence c. * The thymine at 533 bp was replaced by cytosine; Preferably, the milk production trait is daily milk yield.

2. A single nucleotide polymorphism genetic molecular marker associated with sheep milk production traits, characterized in that: The single nucleotide polymorphism genetic marker is located in sheep INSIG1 In the gene, the single nucleotide polymorphism genetic molecular marker is any one or more combinations of the following (a) to (b); (a) The single nucleotide polymorphism genetic marker is located on the positive strand of chromosome 4 of the sheep genome sequence INSIG1 c. 79 bp site of the gene sequence, and there is an A / G base mutation; (b) The single nucleotide polymorphism genetic marker is located on the positive strand of chromosome 4 of the sheep genome sequence INSIG1 The non-coding region of the gene. * 533bp site, and there is a T / C base mutation.

3. An application of a haplotype combination sequence of a single nucleotide polymorphism molecular marker related to sheep milk production traits in increasing the daily milk production of sheep, characterized in that: The haplotype combination is the haplotype combination of the single nucleotide polymorphism genetic marker associated with the sheep milk production trait as claimed in claim 2, and the haplotype combination sequence tag is ATGC; The single nucleotide polymorphism genetic marker is located on the positive strand of chromosome 4 of the sheep genome sequence INSIG1 c. 79 bp of the gene sequence with an A / G mutation; or located on the positive strand of chromosome 4 of the sheep genome sequence INSIG1 The non-coding region of the gene. * 533bp site, and there is a T / C base mutation.

4. A method for identifying or assisting in identifying the milk production traits of sheep, characterized in that: The method is any one of the following 1)-2): 1) The following steps are included: testing the sheep INSIG1 The genotype of the SNP site c. 79A / G in the gene; The genotype of the SNP site c.79A / G is AA , AG and GG ; Said INSIG1 The genotype of the SNP site c. 79A / G in the gene is AG , GG The daily milk production of the tested sheep is better than or assisted by the SNP site c. 79A / G genotype is AA of the tested sheep; 2) The following steps are included: testing the test sheep INSIG1 SNP site in the gene c. * Genotype of 533T / C; The SNP site c. * The genotype of 533T / C is TT , TC and CC ; Said INSIG1 SNP site in the gene c. * The genotype of 533T / C is CC The daily milk yield of the tested sheep is better than or assisted by the SNP site c. * The genotype of 533T / C is TT of the tested sheep.

5. Use of the method according to claim 4 in sheep screening or sheep breeding.

6. The use according to claim 5, characterized in that: In the application, any of the following sheep in claim 4 is selected for milk production or breeding: Said INSIG1 The genotype of the SNP site c. 79A / G in the gene is AG , GG of the tested sheep; or INSIG1 SNP site in the gene c. * The genotype of 533T / C is CC of the tested sheep.

7. A detection INSIG1 A primer pair for detecting a mutation in a gene, characterized in that The nucleotide sequences of the upstream and downstream of the primer pair are shown as SEQ ID NO.1-2 respectively; or the nucleotide sequences of the upstream and downstream of the primer pair are shown as SEQ ID NO.3-4 respectively.

8. A method for detecting the molecular markers related to sheep milk production traits according to claim 2, characterized in that: The steps include: a) Using sheep blood as a sample to extract genomic DNA, using the primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 to genotype sheep INSIG1 The gene was amplified by PCR; b) performing mixed pool sequencing and sequence analysis on the above PCR amplification products to obtain the mutation site and determine the mutation type; c) by identifying individual sheep INSIG1 Genotyping, identification of sheep based on genotyping results INSIG1 The genotype and haplotype of the SNP loci in the gene detection region.

9. A kit for detecting molecular markers related to sheep milk production traits, characterized in that: The kit comprises the primer pair according to claim 7.

10. Use of the primer pair or primer combination according to claim 7, wherein the use is any one of the following (a)-(f): (a) Determine or assist in determining the daily milk production of sheep; (b) sheep screening; (c) sheep breeding; (d) preparing a kit for identifying or assisting in identifying the daily milk production of sheep; (e) preparing a kit for sheep screening; (f) Preparation of a kit for sheep breeding.

Images