Insig1 gene snps marker related to daily milk yield of sheep and application thereof

Abstract

The application discloses a SNP marker related to daily milk yield of sheep INSIG1 and application thereof, and belongs to the technical field of biotechnology. INSIG1 The relative expression of the gene is detected by using real-time fluorescent quantitative PCR INSIG1 , the SNPs and genotypes of the gene are analyzed, and the correlation between the nucleotide sequence variation of the gene and daily milk yield, milk protein rate, milk fat rate and other milk secretion traits of milk sheep is analyzed. * The application provides effective molecular genetic markers for molecular breeding of milk sheep, and obtains SNP1: c. 79A / G and SNP2: c. AG 533T / C. GG The daily milk yield of the individual with the SNP1 site AA is 0.135 kg and 0.238 kg higher than that of the individual with the SNP1 site. CC The daily milk yield of the individual with the SNP2 site TT is 0.261 kg higher than that of the individual with the SNP2 site.

Description

TECHNICAL FIELD

[0001] The present application relates to a kind of INSIG1 gene SNPs markers related to the daily milk yield of sheep and its application, belong to the field of biotechnology. BACKGROUND

[0002] Sheep milk is known as the noblest of milk, and it is favored by consumers, its milk protein rate (4.4-6.6%) and milk fat rate (5.3%-9.3%) are higher than cow milk and goat milk, and the monounsaturated fatty acids, conjugated linoleic acid, medium-chain triglycerides and essential fatty acids contained in it help to prevent cardiovascular disease and inflammation. Dairy sheep industry is mainly concentrated in Europe, West Asia and some areas of Africa, and the main dairy products are cheese, fresh milk, yogurt and milk powder, etc. The dairy sheep industry in China is a sunrise industry. Lactation traits are important economic traits of dairy sheep, which are affected by multiple factors. In the process of improving the lactation performance of dairy sheep, genetics is an important factor. Conventional breeding methods have a long breeding cycle and low efficiency, while molecular marker-assisted breeding has the advantages of being fast, accurate and not affected by environmental conditions.

[0003] Insulin induced genes (INSIGs) are a kind of genes closely related to fat metabolism, and the gene family includes two members, insulin induced gene 1 (INSIG1) and insulin induced gene 2 (INSIG2). Studies have found that INSIG1 gene binds to sterol regulatory element cleavage activating protein (SCAP) by binding to sterol regulatory element, which hinders the transcription process of sterol regulatory element binding protein (SREBP) target genes, thereby reducing the synthesis of sterols, fatty acids and triglycerides.

[0004] Studies have shown that single nucleotide polymorphisms (SNPs) of INSIG1 gene are related to the composition of fatty acids in milk. For example, Rincon et al. found 3 SNPs sites significantly affecting the fatty acid content of milk in the first exon, the fourth exon and the sixth intron of Holstein cows, among which the allele C at site ss252452218 in the first exon and the allele G at site ss252452223 in the sixth intron affect the saturated fatty acid content of milk, and the allele C at site ss252452220 in the fourth exon significantly affects both the saturated fatty acid content and the monounsaturated fatty acid content in milk. At present, there is no report on the relationship between SNPs sites of INSIG1 gene and lactation of livestock. SUMMARY

[0005] The present study adopts real-time fluorescent quantitative PCR (Reverse transcriptase-quantitative-PCR, RT-qPCR) to detect the relative expression of INSIG1, analyzes SNPs and genotypes of the INSIG1 gene through Sanger sequencing and penta-primer amplification refractory mutation system (PARMS) technology, and analyzes the correlation between nucleotide sequence variation of the improved gene and milk secretion traits such as daily milk secretion amount, milk protein rate and milk fat rate of milk sheep, so as to provide effective molecular genetic markers for molecular breeding of milk sheep.

[0006] The single nucleotide polymorphism genetic marker of the present application is located at the INSIG1 gene of the positive strand of the chromosome 4 in the ARS-UI_Ramb_v3.0 version sequence information of the sheep reference genome.

[0007] The present application provides a reagent for detecting the genotype of at least one SNP site in the following two SNP sites in the identification or auxiliary identification of milk secretion traits of sheep.

[0008] The SNP site is that the adenine at c. 79 bp of the INSIG1 gene sequence of the positive strand of the chromosome 4 corresponding to the sheep genome sequence is replaced by guanine (SNP1).

[0009] The SNP1 sequence is amplified from the INSIG1 gene, and specifically is:

[0010] ACCTGACCTGCTTTGGAAGTGAACTTGATCAGGGTTCCACCTCCACGCCCCCTTTTCGTTCTAGGAAAGCCTGCAGGCTGGTGGCTCATGCCCAGACTGGACGACCACCTCTGGAGAGGTCCCTGTGCCAAGGGCACGAAGCACAGAAGCCACCCGAGGGCCAGC [A / G]CCAGAGGGCTGGTGGCCAAAGCGGGAGAGATGATCAACTCCTCGGGGTCAGGCCCCTCTCTGCTGGCAGCCCATGGCGCCCCGGGCACTGACCCCGCTCACGGGCTTCAGAGCACTGGTGTGGGGGGCCAGGGCAGCAGCGGCCACGTCAACAGCTGGCATCACCACTTGGTGCAGAGGAGCCTGGTGCTGTTCTCGGTGGGGGTGGTCCTGGCCTTGGTGCTCAACCTCCTGCAGGTCCAGAGGAATGTCACCCTGTTCCCGGACGAGGTCATCGCCACCATCTTCTCCTC.

[0011] Wherein, the adenine at the 79th bp of the CDS region of the INSIG1 gene is replaced by guanine, that is, the adenine in the above gene sequence is replaced by guanine. [A / G] Represent the base sequences before and after mutation;

[0012] The SNP site is the non-coding region of the INSIG1 gene sequence on the positive strand of chromosome 4 of the sheep genome sequence. * 533bp is replaced by cytosine (SNP2);

[0013] The SNP2 sequence is amplified from the INSIG1 gene, specifically:

[0014] AGCTCTGGTTCCATGTCAGGGCCCTGGGGATGGCTTGGTGGTGCTTATGAAGATGAAGTGTGGTGAGATAGGAATATTACTCATCCAAAAGATTTTTAAAATAGGGCTGTGTTGTGAAAAAGAGAAGGCAGTGGTGGCAGCAAGTGCTGGGTGGCCGTGCCGGGCAGGCGGGCACGGCGTGCCCTCGGTGCCCG [T / C] GTGGGGCCGCACACAGACAGTCCTGCAGAGGAGGCAGTGAGTGGGAGGTCGTGGCTCTGTGCTTCGATGGGTTGGACTTTCCACCCCGGTATTCACAGAGTTTGCCCGGAATCCGCGTCGTCTCGAAGGGGGCACCCGCCGGCCACACGTCTCCGTCTTGGCCCAAAACTTGCGTTTTCTCTGATACTCGGGAAGAAGAGACAGCT.

[0015] In the INSIG1 gene, thymine at position 533 bp, starting from the 3′ UTR, is replaced with cytosine, i.e., in the above gene sequence. [T / C] This represents the base sequence before and after the mutation.

[0016] In one embodiment of the present invention, the milk production trait is daily milk production.

[0017] The present invention also provides a single nucleotide polymorphism (SNP) genetic marker associated with the milk production trait in sheep, wherein the SNP is located in the sheep INSIG1 gene, and the SNP is any one or more combinations of the following (a) to (b);

[0018] (a) The single nucleotide polymorphism genetic marker is located at c. 79 bp in the INSIG1 gene sequence on the positive strand of chromosome 4 of the sheep genome sequence, and there is an A / G base mutation;

[0019] (b) The single nucleotide polymorphism genetic marker is located on chromosome 4 of the sheep genome sequence, specifically on the non-coding region of the INSIG1 gene on the positive strand. * The 533bp site contains a T / C base mutation.

[0020] In one embodiment of the present invention, the milk production trait is daily milk production.

[0021] The present invention also provides the application of a haplotype combination sequence of a single nucleotide polymorphism molecular marker associated with sheep milk production traits in increasing daily milk production in sheep, wherein the haplotype combination is the haplotype combination of the single nucleotide polymorphism genetic marker associated with sheep milk production traits as described in claim 2, and the haplotype combination sequence tag is ATGC;

[0022] The single nucleotide polymorphism (SNP) genetic marker is located at c. 79 bp of the INSIG1 gene sequence on the positive strand of chromosome 4 of the sheep genome sequence, and has an A / G base mutation; or is located at c. 79 bp of the non-coding region of the INSIG1 gene on the positive strand of chromosome 4 of the sheep genome sequence. * The 533bp site contains a T / C base mutation.

[0023] This invention also provides a method for identifying or assisting in the identification of milk production traits in sheep, wherein the method is any one of the following 1)-2):

[0024] 1) Includes the following steps: Detecting the genotype of the SNP site c. 79A / G in the INSIG1 gene of the tested sheep; the genotype of the SNP site c. 79A / G is AA, AG, or GG;

[0025] The daily milk production of the tested sheep with the SNP site c. 79A / G genotype AG or GG in the INSIG1 gene was better than or slightly better than that of the tested sheep with the SNP site c. 79A / G genotype AA.

[0026] 2) This includes the following steps: detecting the SNP site c in the INSIG1 gene of the tested sheep. * The genotype of 533T / C; the SNP site c. * The genotypes of 533T / C are TT, TC, and CC;

[0027] The SNP site c in the INSIG1 gene. * The daily milk production of tested sheep with the 533T / C genotype CC was superior to or better than that of the SNP site c. * The tested sheep had the 533T / C genotype of TT.

[0028] This invention also provides the application of the above method in sheep screening or sheep breeding.

[0029] In one embodiment of the invention, the sheep selected for testing are of any of the following types for milk production or breeding:

[0030] The tested sheep had the genotype AG or GG at the SNP site c. 79A / G in the INSIG1 gene;

[0031] Or the SNP site c in the INSIG1 gene. * The tested sheep with the 533T / C genotype CC.

[0032] The present invention also provides a primer pair for detecting mutations in the INSIG1 gene, wherein the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 1-2, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 3-4, respectively.

[0033] The present invention also provides a method for detecting the above-mentioned molecular markers related to sheep milk production traits, the method comprising the following steps:

[0034] a) Genomic DNA was extracted from sheep blood samples, and the sheep INSIG1 gene was amplified by PCR using the primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4;

[0035] b) Perform pooled sequencing and sequence analysis on the above PCR amplification products to obtain the mutation sites and determine the mutation types;

[0036] c) By performing INSIG1 genotyping on individual sheep, the genotype and haplotype of the SNP loci in the INSIG1 gene detection region of the sheep are identified based on the genotyping results.

[0037] The present invention also provides a kit for detecting molecular markers associated with sheep milk production traits, the kit comprising primer pairs.

[0038] The upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 1~2, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 3~4, respectively.

[0039] This invention also provides applications of the above primer pairs or primer combinations, wherein the application is any one of the following (a)-(f):

[0040] (a) To identify or assist in the identification of daily milk production in sheep;

[0041] (b) Sheep selection;

[0042] (c) Sheep breeding;

[0043] (d) Prepare a kit for identifying or assisting in the identification of daily milk production in sheep;

[0044] (e) Preparation of a kit for sheep screening;

[0045] (f) Preparation of a kit for sheep breeding.

[0046] The upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 1~2, respectively; or the upstream and downstream nucleotide sequences of the primer pair are shown in SEQ ID NO. 3~4, respectively.

[0047] Beneficial effects

[0048] This invention uses lactating sheep as the research subject, applies Sanger and other techniques to detect nucleotide sequence variation sites in the INSIG1 gene, and constructs a general linear mixed-effects model to study the correlation between nucleotide sequence variation and sheep lactation traits, thereby identifying molecular genetic markers regulating sheep lactation traits. This invention has achieved some positive results and indeed possesses significant advantages compared to existing technologies, as detailed below:

[0049] (1) One single nucleotide polymorphism (SNP) was identified in exon 2 of the INSIG1 gene: c. 79A / G (SNP1). This site is a missense mutation, resulting in a change in the encoded amino acid from threonine to alanine. One SNP, c, was found in the 3′UTR of the INSIG1 gene. * 533T / C (SNP2).

[0050] (2) Both SNP loci significantly affected the daily milk yield of sheep (P < 0.05), but had no significant effect on other traits. At SNP1, the daily milk yield of AG and GG individuals was 0.135 kg and 0.238 kg higher than that of AA individuals, respectively (P < 0.05). At SNP2, the daily milk yield of CC individuals was 0.261 kg higher than that of TT individuals.

[0051] (3) We analyzed the effects of three haplotype combinations H1H1, H1H2 and H1H3 with a frequency greater than 5% on lactation traits. The results showed that the daily milk production of the H1H2 combination was significantly higher than that of the H1H1 and H1H3 combinations (P < 0.05), and the haplotype combinations had no significant effect on the other milk components (P > 0.05). Attached Figure Description

[0052] Figure 1 : INSIG1 gene tissue expression profile.

[0053] Figure 2 : Figure 2 Sequencing results of SNP1 and SNP2 in the sheep INSIG1 gene; A is SNP1 c. 79A / G, B is SNP2 c.* 533T / C.

[0054] Figure 3 Linkage disequilibrium analysis of the INSIG1 gene in sheep. Detailed Implementation

[0055] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0057] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0058] The detection methods involved in the following embodiments are as follows:

[0059] The following indicators were measured using a UL40BC milk composition analyzer:

[0060] Milk fat percentage: The percentage of fat contained in milk.

[0061] Milk protein percentage: The percentage of protein contained in milk.

[0062] Ash content: The mineral content in milk.

[0063] Non-dairy fat solids content: The content of nutrients in milk other than lipids and water.

[0064] Dry matter content: The content of other nutrients in milk after water is removed.

[0065] Lactose: The lactose content in sheep milk.

[0066] The daily milk production of each experimental sheep was determined using a DeLaval 9JP-2X24 parallel milking machine.

[0067] Example 1: Gene sequencing and analysis of SNPs associated with daily milk production in sheep

[0068] 1. Sample collection

[0069] At Yuansheng Agricultural and Animal Husbandry Technology Co., Ltd. in Yongchang County, Gansu Province, 450 dairy sheep were selected under the same feeding and management conditions, including 34 East Friensian sheep (EF), 57 Hu sheep (H), 197 F1 crossbred East Friensian sheep × Hu sheep, and 162 F2 crossbred East Friensian sheep × Hu sheep. All experimental sheep were in good health, and data on age, parity, number of lambs, and daily milk production were complete.

[0070] One ml of blood was collected from each experimental sheep using the jugular vein blood collection method. The blood was then dripped onto an FTA card (Whatman, Middlesex, UK), dried, and stored for genomic DNA extraction.

[0071] During mid-lactation, 50 ml of milk was collected from each experimental sheep, and milk composition indicators such as milk protein content, milk fat content, lactose content, and non-fat milk solids content were measured using a UL40BC milk composition analyzer (U-Chuang, Hangzhou, China).

[0072] Meanwhile, three other F1 generation ewes in mid-lactation were selected, and after slaughter, tissue samples of the heart, liver, spleen, lungs, kidneys, mammary glands, and ovaries were collected and stored in liquid nitrogen in 2 mL cryovials for INSIG1 gene expression characterization analysis.

[0073] 2. Synthesis of genomic DNA, total tissue RNA, and cDNA

[0074] Genomic DNA was extracted from the blood of all sheep using a two-step method described by Zhou et al. (2006) for screening and typing of nucleotide sequence variant sites. Genomic DNA was extracted from the blood sampler from the FTA card for screening INSIG1 gene SNP sites. Specifically, a 1.2 mm diameter disc was taken from the FTA card using a sampler and placed in a 1.5 mL centrifuge tube. 200 μL of 20 mmol / L NaOH was added to the centrifuge tube, and the mixture was incubated at room temperature for 30 minutes. If the blood sample had been stored for a long time, it was heated in a 50°C water bath for 25 minutes. During incubation, the centrifuge tube should be rotated periodically. The NaOH solution in the tube was discarded. 200 μL of TE buffer solution was added, and the mixture was allowed to stand for 2 minutes. The TE buffer solution was then discarded, and the disc was air-dried at room temperature for later use.

[0075] Total RNA was extracted from heart, liver, spleen, lung, kidney, breast, and ovarian tissues using the Trizol method. The RNA was quality-tested using a NanoDrop 8000 spectrophotometer (Thermo, MA, USA). RNA that passed quality testing was reverse transcribed into cDNA using the SweScriptReverse Transcriptase II reverse transcription kit (Seville, Wuhan, China) for the detection of INSIG1 gene expression.

[0076] 3. Primer design and PCR amplification

[0077] Based on the sheep INSIG1 gene sequence (GeneID: 101106422) published in GeneBank, seven pairs of specific primers P1-P7 (Table 1) were designed using Primer 3.0 software to amplify all exons and the 3′ untranslated region (3′ UTR) of the INSIG1 gene. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0078] Five samples were randomly selected from each population for PCR amplification. The PCR products were then mixed and Sanger sequencing was performed to screen for gene SNP sites.

[0079] Table 1: Primer sequence information

[0080]

[0081] 2) PCR amplification and SNP site detection

[0082] Twenty samples were randomly selected from the experimental sheep. A 20 μL PCR reaction system was used to amplify seven regions of the INSIG1 gene, including one 1.2 mm DNA card, 0.8 μL each of upstream and downstream primers (10 μmol / L), 10.4 μL of Taq DNA polymerase, and 8.0 μL of ddH2O. The amplification conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56–62℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; final extension at 72℃ for 7 min; and storage at 4℃. Two μL of the PCR amplification products from each of the 20 samples were mixed in equal volumes and sent to Yangling Tianrun Aoke Biotechnology Co., Ltd. for Sanger sequencing. Finally, Chromas software was used to screen for SNP sites.

[0083] (3) Analysis of INSIG1 gene expression characteristics

[0084] Primers were designed for the CDS region; details are shown in Table 1. Using β-actin as an internal reference gene, the expression levels of the INSIG1 gene in seven tissues, including heart, liver, and breast, were detected by RT-qPCR on a LightCycler 480 instrument (Roche Applied Science, Mannheim, Germany).

[0085] The quality-tested cDNA was diluted to a concentration of 30 ng / μL. Using β-actin as an internal control gene, RT-qPCR was performed in a 20 μL system on an Applied Biosystems QuantStudio® 6 Flex qPCR instrument (Thermo Fisher Scientific, New York, USA). The system included 10 μL of SYBR Green qPCR Master Mix (Saiwell, Wuhan, China), 7.2 μL of deionized water, 0.8 μL of primers, and 2 μL of cDNA. Each sample was performed in 3 biological replicates and 4 technical replicates. Finally, 2... -ΔΔCt The relative expression levels of the INSIG1 gene in different sheep tissues were calculated.

[0086] (4) Experimental results

[0087] RT-qPCR results showed that the INSIG1 gene was expressed in sheep heart, liver, spleen, lung, kidney, ovary, and mammary gland tissues, with the highest expression level in mammary gland tissue, which was 1.42, 5.08, 9.67, 10.49, 30.43, and 39.65 times higher than that in liver, lung, spleen, ovary, kidney, and heart, respectively. The lowest expression level was observed in the heart. Figure 1 ).

[0088] The results showed that a single nucleotide polymorphism (SNP) site c. 79A / G (SNP1) was identified in exon 2 of the INSIG1 gene. Figure 2 A) This site is a missense mutation, resulting in a change in the encoded amino acid from threonine to alanine. One SNP site, c, was found in the 3′UTR of the INSIG1 gene. * 533T / C (SNP2, Figure 2 B). No SNP sites were detected in the PCR products amplified by the other 5 pairs of primers.

[0089] SNP1: Represents single nucleotide polymorphism site 1, which is c. 79A / G. This indicates that there is an A / G mutation at c. 79 bp in the INSIG1 gene sequence on sheep chromosome 4, where A (adenine) is replaced by G (guanine).

[0090] SNP2: Represents single nucleotide polymorphism site 2, which is c. * 533T / C indicates that the INSIG1 gene sequence located on sheep chromosome 4 is in the c-uncoding region. * There is a T / C mutation at 533bp, in which thymine (T) is replaced by cytosine (C);

[0091] Based on the two discovered SNPs, primers for amplifying these SNPs can be designed, including forward and reverse primers, which are located upstream and downstream of the five single nucleotide polymorphism sites, respectively. Kits for detecting these SNPs can also be designed using existing technologies based on the primers.

[0092] Example 2: Association between genotyping and milk production traits in sheep

[0093] 1. Experimental Methods

[0094] (1) PARMS genotyping and haplotype construction

[0095] Based on the sequencing results in Example 1, SNPs with mutations in the second exon and 3′UTR regions of the INSIG1 gene were identified. Blood DNA samples extracted from all 450 lactating ewes selected in Example 1 were correlated with the INSIG1 gene SNP information, and nucleotide sequences were aligned using Chromas software to screen for SNPs on the INSIG1 gene. Genotypes at the variant sites were determined using PARMS technology. The selected SNPs were then sent to Wuhan Jingtai Biotechnology Co., Ltd. for allelic and genotyping.

[0096] Popgene 32.0 was used to calculate the allele and genotype frequencies of variant sites. Haplotypes were constructed using Haploview v4.2 software, and haplotypes with frequencies greater than 1% were selected to construct haplotype combinations.

[0097] (3) Correlation analysis of lactation traits

[0098] The experiment examined the polymorphism of 450 lactating dairy sheep to determine their genotypes. The correlation between the genotypes and haplotypes of INSIG1 gene SNPs with a frequency greater than 5% and the sheep lactation trait was analyzed using a general linear mixed-effects model in SPSS 16.0. The results are expressed as mean ± standard error.

[0099] To determine the fixed and random effects included in the model, we analyzed the influence of age, number of lambs, and parity on the sheep lactation trait. The results showed that number of lambs and parity had no significant effect on lactation, but age had a highly significant effect. We used a general linear mixed-effects model in SPSS 16.0 to analyze the correlation between the INSIG1 genotype (allele or haplotype) and the sheep lactation trait.

[0100] The model is Y = μ + Genotype (Haplotype) + Population + Age + e, where Y represents the lactation trait, µ is the population mean, Genotype is the genotype, Haplotype is the haplotype, Population is the experimental population, Age is the age, and e is the random effect.

[0101] 2. Experimental Results

[0102] The embodiments of the present invention have achieved some positive results during the research and development or use process, and have indeed great advantages compared with the prior art. The following content describes them in conjunction with the data, charts and other information of the experimental process.

[0103] (1) PARMS genotyping results and allele frequencies of INSIG1 gene SNPs

[0104] Three genotypes, AA, AG, and GG, were found in SNP1 (Table 2), with AA being the dominant genotype and A being the dominant allele. The GG genotype was not detected only in the Hu sheep population; all three genotypes were present in the other three populations. The test revealed that all four groups were in Hardy-Weinberg equilibrium (P > 0.05).

[0105] Three genotypes, TT, TC and CC, also exist in SNP2 (Table 2). TT is the dominant genotype and T is the dominant allele. No individuals with the CC genotype were found in the Hu sheep population. All three genotypes were present in the other three populations.

[0106] Table 2: Genotypes and allele frequencies of the INSIG1 gene in sheep

[0107]

[0108] (2) Effect of INSIG1 genotype on lactation traits

[0109] Both SNP loci significantly affected daily milk production in sheep (P < 0.05), but had no significant effect on other traits. At SNP1, the daily milk production of AG and GG individuals was 0.135 kg and 0.238 kg higher than that of AA individuals, respectively (P < 0.05). At SNP2, the daily milk production of CC individuals was 0.261 kg higher than that of TT individuals (P < 0.05).

[0110] Table 3: Effects of INSIG1 genotype on lactation traits in sheep

[0111]

[0112] Note: Different lowercase letters in the same line indicate significant differences (P < 0.05), the same applies below.

[0113] (3) Haplotype analysis of the INSIG1 gene in sheep

[0114] The linkage disequilibrium between the two SNPs c. 79A / G and c. *533T / C in the sheep INSIG1 gene is shown in [reference needed]. Figure 3 The results show that SNP1 and SNP2 can form a haplotype module, and are in a strongly linked disequilibrium state (r 2 =0.71).

[0115] SNP1 and SNP2 together form three haplotypes, H1 to H3 (Table 4). Haplotype H1 has the highest frequency (73.5%), while H2 and H3 have relatively lower frequencies, at 20.2% and 6.3%, respectively.

[0116] Table 4: Haplotype analysis of INSIG1 gene SNPs

[0117]

[0118] The three haplotypes mentioned above form a total of six haplotype combinations (Table 5), namely H1H1, H1H2, H1H3, H2H2, H2H3 and H3H3, with frequencies of 54.0%, 31.6%, 8.2%, 3.1%, 2.9% and 0.2%, respectively.

[0119] Table 5: Haplotype Combination Analysis of INSIG1 Gene SNPs

[0120]

[0121] (4) Association analysis between haplotype combinations of the INSIG1 gene in sheep and lactation traits

[0122] We analyzed the effects of three haplotype combinations H1H1, H1H2, and H1H3, with frequencies greater than 5%, on lactation traits. The results showed that the daily milk yield of the H1H2 combination was significantly higher than that of the H1H1 and H1H3 combinations (P < 0.05), while the haplotype combinations had no significant effect on other milk components (P > 0.05).

[0123] Table 6: Association analysis between haplotype combinations of the INSIG1 gene in sheep and lactation traits

[0124]

[0125] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Use of a reagent for detecting the genotype of at least one SNP locus in the SNP1 and SNP2 loci in the following test sheep INSIG1 for identifying or assisting in the identification of a sheep for a milk production trait, characterised in that, The sequence of the SNP1 is: ACCTGACCTGCTTTGGAAGTGAACTTGATCAGGGTTCCACCTCCACGCCCCCTTTTCGTTCTAGGAAAGCCTGCAGGCTGGTGGCTCATGCCCAGACTGGACGACCACCTCTGGAGAGGTCCCTGTGCCAAGGGCACGAAGCACAGAAGCCACCCGAGGGCCAGC [A / G] CCAGAGGGCTGGTGGCCAAAGCGGGAGAGATGATCAACTCCTCGGGGTCAGGCCCCTCTCTGCTGGCAGCCCATGGCGCCCCGGGCACTGACCCCGCTCACGGGCTTCAGAGCACTGGTGTGGGGGGCCAGGGCAGCAGCGGCCACGTCAACAGCTGGCATCACCACTTGGTGCAGAGGAGCCTGGTGCTGTTCTCGGTGGGGGTGGTCCTGGCCTTGGTGCTCAACCTCCTGCAGGTCCAGAGGAATGTCACCCTGTTCCCGGACGAGGTCATCGCCACCATCTTCTCCTC, wherein the base at position 166 is polymorphic for A / G; The sequence of the SNP2 is: AGCTCTGGTTCCATGTCAGGGCCCTGGGGATGGCTTGGTGGTGCTTATGAAGATGAAGTGTGGTGAGATAGGAATATTACTCATCCAAAAGATTTTTAAAATAGGGCTGTGTTGTGAAAAAGAGAAGGCAGTGGTGGCAGCAAGTGCTGGGTGGCCGTGCCGGGCAGGCGGGCACGGCGTGCCCTCGGTGCCCG [T / C] GTGGGGCCGCACACAGACAGTCCTGCAGAGGAGGCAGTGAGTGGGAGGTCGTGGCTCTGTGCTTCGATGGGTTGGACTTTCCACCCCGGTATTCACAGAGTTTGCCCGGAATCCGCGTCGTCTCGAAGGGGGCACCCGCCGGCCACACGTCTCCGTCTTGGCCCAAAACTTGCGTTTTCTCTGATACTCGGGAAGAAGAGACAGCT, wherein a T / C polymorphism is present at position 195; The milk production trait is daily milk yield.

2. A method of identifying or assisting in the identification of a ewe's milk production trait, characterised in that, The method is any one of the following 1)-2): 1) comprising the steps of: detecting the genotype of SNP1 locus in the gene of the test sheep of claim 1; the genotype of the SNP1 locus is INSIG1 , AA , AG and GG ; The INSIG1 SNP1 site genotype of the gene is AG , GG The daily milk yield of the test sheep whose SNP1 site genotype of the gene is AA is better than or auxiliary better than that of the test sheep whose SNP1 site genotype of the gene is 2) comprising the step of detecting in a test sheep of claim 1 INSIG1 the genotype at SNP2 locus in the gene; the genotype at SNP2 locus in the gene is TT , TC and CC ; The INSIG1 Sheep having the genotype of SNP2 locus in the gene of CC The daily milk yield of the test sheep is better than or auxiliary better than the test sheep having the genotype of SNP2 locus in the gene of TT The daily milk yield of the test sheep is better than or auxiliary better than the test sheep having the genotype of SNP2 locus in the gene of 3. The use of the method of claim 2 in screening of sheep daily milk yield or breeding of sheep daily milk yield.

4. Use according to claim 3, characterized in that, In the use, the test sheep of any one of the following of claim 2 is selected for milk production or breeding: The INSIG1 SNP1 site genotype of the gene is AG , GG test sheep; or the INSIG1 genotype of SNP2 site in the gene is CC the test sheep.

5. Use of a primer pair for detecting the SNP1 or SNP2 site according to claim 1, characterized in that, The nucleotide sequences of the upstream and downstream primers of the primer pair for detecting the SNP1 site are shown in SEQ ID NO. 1-2, respectively, and the nucleotide sequences of the upstream and downstream primers of the primer pair for detecting the SNP2 site are shown in SEQ ID NO. 3-4, respectively, and the use is any one of the following (a)-(f): (a) identifying or assisting in identifying sheep daily milk yield; (b) screening of sheep daily milk yield; (c) breeding of sheep daily milk yield; (d) preparing a kit for identifying or assisting in identifying sheep daily milk yield; (e) preparing a kit for screening of sheep daily milk yield; (f) preparing a kit for breeding of sheep daily milk yield.

Images