Molecular markers for discriminating or aiding in discriminating the sedimentation value of wheat flour and use thereof

By detecting the polymorphism of SNP1 in the wheat genome, dCAPS markers were developed, and alleles were distinguished using XbaI restriction sites. This solved the problem of identifying the sedimentation value of wheat flour and improved the efficiency and accuracy of wheat quality breeding.

CN119979746BActive Publication Date: 2025-11-28INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311495376.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-10
Publication Date
2025-11-28
Estimated Expiration
2043-11-10

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify the sedimentation value of wheat flour, which affects the efficiency and effectiveness of wheat quality breeding.

Method used

By detecting the polymorphism or genotype of SNP1 in the wheat genome, especially SNP sites with nucleotide types C or T (SEQ ID No. 1, position 1557), a dCAPS marker was developed, and alleles were distinguished using the XbaI restriction site, thus achieving efficient identification of wheat flour sedimentation value.

Benefits of technology

This method enables efficient and low-cost identification of wheat flour sedimentation value, improves the accuracy and speed of wheat quality breeding, and provides a tool for molecular marker-assisted selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979746B_ABST
    Figure CN119979746B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker for identifying or assisting in identifying the sedimentation value of wheat flour and application thereof, and specifically discloses application of a substance for detecting polymorphism or genotype of SNP1 in a wheat genome in identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is an SNP site in the wheat genome, the nucleotide type of which is C or T, and the nucleotide is represented by Y and is the 1557th nucleotide in SEQ ID No. 1. A dCAPS marker is developed by using the SNP1 site, and 130 wheat materials are scanned. Correlation analysis is performed on the genotype and phenotype data of the sedimentation value, and it is found that the marker is significantly related to the sedimentation value of the wheat flour, which indicates that the marker is a molecular marker for effectively screening wheat with different sedimentation values. The dCAPS marker has good repeatability, is convenient to detect and has low cost, and has a good application prospect in molecular marker assisted selection for improving the quality of the wheat and molecular design breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a molecular marker for identifying or assisting in identifying the sedimentation value of wheat flour and its application in the field of biotechnology. BACKGROUND

[0002] Wheat is an important food crop. With the improvement of people's living standards, the diet is more colorful, and the requirement for flour quality is increasing. The breeding goal of wheat has changed from high yield to high yield and quality. How to further improve the quality of wheat under the premise of high yield is a problem that needs to be solved in current breeding.

[0003] Wheat quality can be divided into nutritional quality and processing quality. Among them, the eating quality in processing quality is the main concern in wheat quality breeding. The eating quality of wheat is mainly related to the physicochemical properties of dough, which can be measured by SDS-sedimentation value (SDS-SV), gluten content, extension area, and stability time. SDS-SV is significantly related to the baking quality of wheat flour and is an important indicator for evaluating the quality of flour protein (Axford et al. 1979). Past studies have found that the SDS-SV of wheat flour is controlled by multiple genes. Conti et al. found that Glu-B1 is a stable site that controls SDS-SV (Conti et al. 2011). The SDS-sedimentation value of the Glu-A1 functional deletion mutant of high molecular weight glutenin subunit gene will significantly decrease (Yang et al. 2014). The alleles Glu-1 of high molecular weight glutenin subunit (HMW-GS) and Glu-3 of low molecular weight glutenin subunit (LMW-GS) have important control effects on sedimentation value, and 1BL / 1RS translocation has a significant negative impact on SDS sedimentation value (Liu et al. 2004). The Pinb-D1b allele variation that controls the hardness of wheat positively regulates SDS-SV (Würschum et al. 2016). In addition, the team of Yao Yingyin from China Agricultural University used a near-isogenic line population constructed by a parent with low SDS-SV ND3331 and a parent with high SDS-SV Zang1817 to identify 10 QTLs that control SDS-SV. Among them, four major loci are related to high molecular weight glutenin subunit 1Ax1, 1B / 1R translocation, Pina-D1, and Pinb-D1, and it is found that Pinb-D1p carried by Zang1817 is an excellent allele of high SDS-SV (Chang et al. 2022). In summary, SDS-SV is mainly regulated by wheat quality genes. Therefore, mining and utilizing genes that control the SDS-SV of wheat not only provide new gene resources for molecular marker-assisted breeding and transgenic breeding, but also help to improve the speed and level of wheat quality breeding, which is of great significance for high-yield and high-quality wheat breeding.

[0004] References

[0005] 1. Liu L, Zhou Y, He ZH, et al. (2004) Effects of Glu-1 and Glu3 allelic variations on wheat processing varieties. Crop Sci, 30:959-968.

[0006] 2. Axford DEW, Mcdermott EE, Redman DG. (1979) Note on sodium dodecylsulfate test of breadmaking quality; comparison with pelshenke and zeleny test. Cereal Chem, 56:582-584.

[0007] 3. Chang SY, Chen Q, Yang T, et al. (2022) Pinb-D1p is an elite allele for improving end-use quality in wheat (Triticum aestivum L.). Theor Appl Genet, 135:4469-4481.

[0008] 4. Conti V, Roncallo PF, Beaufort V, et al. (2011) Mapping of main and epistatic effect QTLs associated to grain protein and gluten strength using a RIL population of durum wheat. J Appl Genet, 52:287-298.

[0009] 5. Würschum T, Leiser WL, Kazman E, et al. (2016) Genetic control of protein content and sedimentation volume in European winter wheat cultivars. Theor Appl Genet, 129:1685-1696

[0010] 6. Yang Y, Li S, Zhang K, et al. (2014) Efficient isolation of ion beam induced mutants for homoeologous loci in common wheat and comparison of the contributions of Glu-1 loci to gluten functionality. Theor Appl Genet, 127: 359-372. SUMMARY

[0011] The technical problem to be solved by the present application is how to identify the sedimentation value of wheat flour.

[0012] To solve the above technical problem, the present application provides any one of the following A1-A3 or the method of A4:

[0013] A1. Application of a substance for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat in identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is a SNP site in the genome of wheat, the nucleotide species of which is C or T, represented by Y, which is the 1557th nucleotide of SEQ ID No. 1.

[0014] A2. Application of a substance for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat in preparing a product for identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is a SNP site in the genome of wheat, the nucleotide species of which is C or T, represented by Y, which is the 1557th nucleotide of SEQ ID No. 1.

[0015] A3. Application of a substance for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat in wheat breeding or in preparing a product for wheat breeding; the SNP1 is a SNP site in the genome of wheat, the nucleotide species of which is C or T, represented by Y, which is the 1557th nucleotide of SEQ ID No. 1.

[0016] The purpose of the breeding includes breeding wheat with high or low sedimentation value of flour.

[0017] A4. A method for identifying or assisting in identifying the sedimentation value of wheat flour, comprising detecting the genotype of the wheat to be tested, and identifying or assisting in identifying the sedimentation value of wheat flour according to the genotype of the wheat to be tested; the genotype is the genotype of SNP1 in the genome of wheat; the SNP1 is a SNP site in the genome of wheat, the nucleotide species of which is C or T, represented by Y, which is the 1557th nucleotide of SEQ ID No. 1.

[0018] The wheat flour sedimentation value can be SDS-sedimentation value.

[0019] In the method of A4, the wheat flour sedimentation value of the wheat to be tested with genotype TT is higher than or higher than that of the wheat to be tested with genotype CC.

[0020] Another technical problem to be solved by the present application is how to breed wheat.

[0021] To solve the above technical problems, the present application provides the following technical solutions:

[0022] B1 and A4 are used in wheat breeding.

[0023] The breeding purpose includes selecting wheat with high SDS-sedimentation value.

[0024] B2 is a method for breeding wheat, comprising: detecting the polymorphism of SNP1 in the wheat genome, and selecting wheat with homozygous SNP1 TT as the parent for breeding; the breeding purpose includes selecting wheat with high SDS-sedimentation value.

[0025] Any one of C1-C3 containing the composition for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the wheat genome also belongs to the protection scope of the present application:

[0026] C1 is a product for detecting single nucleotide polymorphism or genotype related to wheat flour sedimentation value;

[0027] C2 is a product for identifying or assisting in identifying wheat flour sedimentation value;

[0028] C3 is a product for wheat breeding.

[0029] In the above applications, methods and products, SNP1 is a SNP site in the wheat genome, the nucleotide species of which is C or T, represented by Y, which is the 1557th nucleotide of SEQ ID No. 1. The detection of the polymorphism or genotype (i.e. allele) of SNP1 in the wheat genome can specifically be the detection of the nucleotide species of SNP1. The genotype of SNP1 in the wheat genome can be CC or TT. The CC is homozygous SNP1 C in the wheat genome, and the TT is homozygous SNP1 T in the wheat genome.

[0030] In the above applications, methods and products, the breeding target of the breeding includes wheat flour sedimentation value, and the wheat breeding can specifically be the cultivation of wheat varieties with high wheat flour sedimentation value.

[0031] In the above-mentioned application, method and product, the composition for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat can be reagents and / or instruments required for determining the polymorphism or genotype of SNP1 by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele-specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.

[0032] In the above-mentioned application, method and product, the composition for detecting the polymorphism or genotype (i.e. allele) of SNP1 in the genome of wheat is any one of the following D1-D6:

[0033] D1, PCR primer pair P1 and XbaI enzyme containing amplification of the fragment of wheat genome DNA including SNP1 and replacement of A at position 1555 of SEQ ID No. 1 in the amplification product with T;

[0034] D2, PCR reagent containing PCR primer pair P1 of D1 and XbaI enzyme;

[0035] D3, kit containing PCR primer pair P1 of D1 or PCR reagent of D2 and XbaI enzyme;

[0036] D4, PCR primer pair P2 containing amplification of the fragment of wheat genome DNA including SNP1; D5, PCR reagent containing PCR primer pair P2 of D4;

[0037] D3, kit containing PCR primer pair P2 of D4 or PCR reagent of D5.

[0038] In the above-mentioned application, method and product, the PCR primer pair P1 can be a primer pair consisting of single-stranded DNA with nucleotide sequence of SEQ ID No. 2 and single-stranded DNA with nucleotide sequence of SEQ ID No. 3.

[0039] In the above-mentioned application, method and product, the PCR primer pair P2 can be a primer pair consisting of single-stranded DNA with nucleotide sequence of SEQ ID No. 4 and single-stranded DNA with nucleotide sequence of SEQ ID No. 5.

[0040] In the above applications, methods and products, the product can be a reagent or a kit or a system, which can include a combination of reagents or kits, instruments and analysis software.

[0041] The present application also protects a DNA molecule whose nucleotide sequence is SEQ ID No. 1.

[0042] The present application is based on population genetics and association analysis, and a gene controlling the sedimentation value of wheat flour is identified in a natural population by genome-wide association analysis (GWAS). By analyzing the sequence polymorphism of the gene and the promoter region in different wheat materials, a SNP site (C / T) is identified at-444 bp in the promoter region. A dCAPS marker is developed using the SNP site, and 130 wheat materials are scanned. Association analysis of genotypes and phenotype data of sedimentation value shows that the marker is significantly correlated with the sedimentation value of wheat flour, indicating that the marker is an effective molecular marker for screening wheat with different sedimentation values. The dCAPS marker has good reproducibility, convenient detection and low cost, and has good application prospect in molecular marker-assisted selection and molecular design breeding for improving wheat quality. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 Variation site information and marker development results of the gene controlling the sedimentation value of wheat flour and its 2 kb promoter region in Example 1 of the present application. Figure 1 The upper part shows the variation information of the gene and its 2 kb promoter region; Figure 1 The lower part shows the development and verification of the dCAPS marker, wherein the boxed T in Hap_C (nucleotide type C) and Hap_T (nucleotide type T) indicates the introduced variation site, the arrow indicates the SNP site of the present application, and the XbaI enzyme cutting site is underlined. Lanes 1-8 are: Jimai 22, Shi 4185, Beijing 8, Xiaoyan 6, Chuanmai 42, Zhoumai 22, Xinong 6028, and Jinmai 47; Lanes 9-16 are: Zhengmai 366, Luma 15, Jimai 20, Wengmai 6, Luma 14, Yumai 41, Zhongmai 175, and Yannong 19.

[0044] Figure 2 The SNP-444 marker association analysis results of 130 wheat varieties in Example 1 of the present application are shown in the table. The average sedimentation value of materials with nucleotide type T (Hap_T) is significantly higher than that of materials with nucleotide type C (Hap_C). The capital letter indicates P<0.05. DETAILED DESCRIPTION

[0045] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0046] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0047] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0048] Example 1, development of SNP markers

[0049] Sixteen wheat materials with known genotypes (Ji Mai 22, Shi 4185, Beijing 8, Xiao Yan 6, Chuan Mai 42, Zhou Mai 22, Xinong 6028, Jinmai 47, Zhengmai 366, Luma 15, Jimai 20, Wengmai 6, Luma 14, Yumai 41, Zhongmai 175, Yannong 19) in different ecological zones were selected for target gene fragment amplification and first sequencing. The specific primers for the genes and promoter segments controlling the sedimentation value of wheat flour were composed of MYB44-D-F and MYB44-D-R:

[0050] F: 5'-AGCCTCCAATTCAATGATGCTAGTG-3' (as shown in SEQ ID No. 4, which is the same as the sequence from 1469 to 1493 of SEQ ID No. 1);

[0051] R: 5'-CCTCGTCTCCGGCCAGAAAT-3' (as shown in SEQ ID No. 5).

[0052] La-Taq enzyme was used in the experiment, and the concentration of template DNA (genomic DNA of 16 wheat materials with known genotypes as template DNA) was uniformly adjusted to 50 ng / μL. The PCR amplification system was as follows:

[0053] Table 1 First round PCR amplification system

[0054] System Content DNA 50 ng La-Taq 0.1 μL 2 x GC buffer 5 μL Upstream primer (10 μM) 0.25 μL Downstream primer (10 μM) 0.25 μL ddH2O Make up to 10 μL

[0055] The PCR amplification program was as follows: denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 sec, annealing at 61℃ for 30 sec, extension at 72℃ (1 kb·min -1 ), 30 cycles; extension at 72℃ for 5 min, and reaction at 12℃.

[0056] The amplification product of 1480 bp was the first round PCR product.

[0057] The sequencing results are spliced and sequence aligned, the sequence variation information of the gene coding region and the upstream 2 kb promoter region in 16 wheat materials with known genotypes is analyzed, combined with the published data of the common wheat pan-genome, detailed SNP site information is obtained, and it is found that there is only one SNP site in the promoter region. The SNP corresponds to a gene coding region and the upstream 2 kb promoter region of the Chinese spring genome at-444, which is called SNP1, and the nucleotide is C or T, represented by Y, corresponding to SEQ ID No. 1 in the sequence table. 1557. SEQ ID No. 1 is the nucleotide sequence of the upstream 2 kb of the gene coding region, and the ATG at positions 2001-2003 represents the start codon of the gene coding region controlling the sedimentation value of the wheat flour.

[0058] SEQ ID No. 1:

[0059]

[0060] A dCAPS marker was developed for the SNP site, named SNP-444, see Figure 1 , a single base T variation was introduced upstream of the SNP site to form the recognition site "TCTAGA" of endonuclease XbaI, for which the dCAPS marker primer of SNP-444 was designed, consisting of SNP_-444-XbaI-F and SNP_-444-XbaI-R, the italicized bases being the introduced variation site:

[0061] SNP_-444-XbaI-F: GTTAATTTTACAGCTAGTGGTGATC (as shown in SEQ ID No. 2, combined with positions 1532-1556 of SEQ ID No. 1, and replacing A at position 1555 of SEQ ID No. 1 in the amplified product with T);

[0062] SNP_-444-XbaI-R: AGCAGGCATATGATCCATCTATA (as shown in SEQ ID No. 3, reverse complementary to positions 1634-1656 of SEQ ID No. 1).

[0063] Second round of PCR amplification: the first round of PCR product was diluted 10-fold, the primer pair consisted of SNP_-444-XbaI-F and SNP_-444-XbaI-R, then 2xMix was used for the second round of PCR amplification, the system is shown in Table 2:

[0064] Table 2 Second round of PCR amplification system

[0065] System Content First round PCR dilution product 1 μL 2 x Mix 5 μL Upstream primer (10 μM) 0.2 μL Downstream primer (10 μM) 0.2 μL ddH2O 3.6 μL

[0066] The PCR amplification program was as follows: denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 sec, annealing at 56℃ for 30 sec, extension at 72℃ for 10 sec, 35 cycles; extension at 72℃ for 5 min, end reaction at 12℃.

[0067] The amplified product was the sequence of SEQ ID No. 1 positions 1532-1656, and A at position 1555 of SEQ ID No. 1 was replaced with T.

[0068] The second round of amplification product was subjected to enzyme digestion reaction: XbaI single enzyme digestion, the reaction system is shown in Table 3:

[0069] Table 3 Enzyme digestion system

[0070]

[0071]

[0072] Reaction procedure: 37°C constant temperature water bath, enzyme digestion for 4h.

[0073] Agarose gel electrophoresis: the enzyme digestion products were subjected to electrophoresis in 3% agarose gel, then photographed and the genotypes of the materials were determined according to the band types, and the results are shown in Figure 1. Figure 1 The second round of amplification products of the materials with nucleotide T of the SNP had XbaI enzyme recognition site "TCTAGA", which was cut to form two bands, while the second round of PCR products of the materials with nucleotide C of the SNP had no XbaI enzyme recognition site and could not be cut, thereby distinguishing the two allelic variations.

[0074] Example 2, verification of the function of SNP-444

[0075] The 130 wheat natural population materials in Table 4 (the genotypes of the SNP sites are homozygous) were used to verify the function of SNP-444, and the primer pair composed of MYB44-D-F and MYB44-D-R, the primer pair composed of SNP_-444-XbaI-F and SNP_-444-XbaI-R, and the genomic DNA extracted from the wheat materials were used for two rounds of PCR amplification (referring to the two-round PCR amplification system and reaction procedure in Example 1). The amplification products were subjected to single enzyme digestion with XbaI enzyme and electrophoresis in 3% agarose gel. The second round of amplification products of the materials with nucleotide T of the SNP had XbaI enzyme recognition site "TCTAGA", which was cut to form two bands, while the second round of PCR products of the materials with nucleotide C of the SNP had no XbaI enzyme recognition site and could not be cut, thereby distinguishing the two allelic variations.

[0076] SDS-SV: sodium dodecyl sulfate-settling value.

[0077] The flour settling value (SDS-SV) of the 130 wheat samples in Table 4 was determined as follows:

[0078] 1) SDS-lactic acid mixed solution preparation: weigh 20g SDS, put it into a beaker, add 20mL lactic acid solution (lactic acid: water = 1:8), dilute to 1L with pure water, mix well and reserve.

[0079] 2) Bromophenol blue solution: add 50mg bromophenol blue to 1L pure water, mix well and reserve.

[0080] 3) Take 20g wheat grains and grind them into whole wheat flour with a flour mill.

[0081] 4) Weigh 2g into a 35mL measuring cylinder, add 16.7mL of 10mg / kg bromophenol blue solution, shake well for 5min.

[0082] Each material was repeated three times.

[0083] 5) Add 16.7 mL of lactic acid-SDS working solution, shake for 5 min, then stand for 5 min, and then read the sediment volume.

[0084] 6) The results were calculated based on the moisture content of flour of 14% (m / m) wet basis, and the calculation formula was:

[0085] Sedimentation value (mL) = measured value (100-14) / (100-sample moisture%)

[0086] The results were combined with the flour sedimentation value (SDS-SV) data of Shunyi in 2019 for correlation analysis, as shown in Table 4:

[0087] Table 4 Nucleotide type information of 130 wheat materials

[0088]

[0089]

[0090] The genotype of nucleotide type T is homozygous SNP1 T, i.e. TT, and the genotype of nucleotide type C is homozygous SNP1 C, i.e. CC.

[0091] The 130 wheat materials in the table were from the National Crop Germplasm Resources Platform (https: / / www.cgris.net / query / croplist.php#).

[0092] In the determination results, there are two genotypes of SNP sites, i.e. CC or TT (no heterozygote): genotype CC is homozygous SNP C, and the nucleotide type is C (Hap_C), which is a low flour sedimentation value type (average SDS-sedimentation value is low); genotype TT is homozygous SNP T, and the nucleotide type is T (Hap_T), which is a high flour sedimentation value type (average SDS-sedimentation value is high).

[0093] The statistical results show that the average sedimentation value of the material with nucleotide type C (Hap_C) is 20.034 mL, and the average sedimentation value of the material with nucleotide type T (Hap_T) is 21.757 mL, reaching a significant difference level (P=0.036) (see Figure 2 ). The above results show that the marker is effective and can be used as a functional marker for screening of wheat flour sedimentation value.

[0094] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Application of substances that detect the genotype of SNP1 in the wheat genome in identifying the sedimentation value of wheat flour; wherein SNP1 is a SNP site in the wheat genome, its nucleotide type is C or T, represented by Y, and is the nucleotide at position 1557 of SEQ ID No. 1; the sedimentation value of wheat flour to be tested with the genotype TT of SNP1 is higher than that of wheat flour to be tested with the genotype CC.

2. Application of substances for detecting the genotype of SNP1 in the wheat genome in the preparation of products for identifying the sedimentation value of wheat flour; wherein SNP1 is a SNP site in the wheat genome, its nucleotide type is C or T, represented by Y, and is the nucleotide at position 1557 of SEQ ID No. 1; the sedimentation value of wheat flour to be tested with the genotype TT of SNP1 is higher than that of wheat flour to be tested with the genotype CC.

3. The application of substances for detecting the genotype of SNP1 in the wheat genome in wheat breeding or in the preparation of wheat breeding products; wherein SNP1 is a SNP site in the wheat genome, its nucleotide type is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No. 1; the sedimentation value of the wheat flour to be tested with the SNP1 genotype TT is higher than that of the wheat flour to be tested with the SNP1 genotype CC; the wheat breeding is to cultivate wheat with high wheat flour sedimentation value.

4. A method for determining the sedimentation value of wheat flour, characterized in that: The method includes detecting the genotype of the wheat to be tested and identifying the sedimentation value of wheat flour based on the genotype of the wheat to be tested; the genotype is the genotype of SNP1 in the wheat genome; SNP1 is a SNP site in the wheat genome, its nucleotide type is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No. 1; the sedimentation value of the wheat flour to be tested with the SNP1 genotype TT is higher than that of the wheat flour to be tested with the genotype CC.

5. The application of the method of claim 4 in wheat breeding; wherein the wheat breeding is for cultivating wheat with high flour sedimentation value.

6. The application according to any one of claims 1-3 and 5, or the method according to claim 4, characterized in that: The substance used to detect the genotype of SNP1 in the wheat genome is any one of the following D1-D3: D1, containing PCR primer pair P1 and XbaI enzyme, which amplifies the wheat genomic DNA fragment including SNP1 and replaces A with T at position 1555 of SEQ ID No. 1 in the amplification product; wherein PCR primer pair P1 is a primer pair composed of single-stranded DNA with nucleotide sequence SEQ ID No. 2 and single-stranded DNA with nucleotide sequence SEQ ID No. 3; D2 consists of PCR reagents containing the PCR primer pair P1 described in D1 and XbaI enzyme; D3, a kit containing the PCR primer pair described in D1, or the PCR reagent described in D2, and XbaI enzyme.

7. The application according to any one of claims 1-3 and 5, or the method according to claim 4, characterized in that: The substance used to detect the genotype of SNP1 in the wheat genome is any one of the following E1-E3: E1, a PCR primer pair P2 containing amplification of wheat genomic DNA fragments including the SNP1; the PCR primer pair P2 is a primer pair composed of single-stranded DNA with nucleotide sequence SEQ ID No. 4 and single-stranded DNA with nucleotide sequence SEQ ID No. 5; E2 is a PCR reagent containing the PCR primer pair P2 described in E1; E3, a kit containing the PCR primer pair described in E1 or the PCR reagent described in P2 or E2.

Citation Information

Patent Citations

  • Method and molecular marker for identifying black embryo disease resistance of wheat to be detected

    CN116855631A

  • Identification, isolation and use of a wheat storage protein gene variant

    WO2001079477A3