SNP molecular marker related to wheat kernel protein content and application

By designing SNP molecular markers and KASP primer combinations on wheat chromosome 7B, the problem of identifying wheat protein content in existing technologies has been solved, enabling rapid and accurate breeding selection and variety improvement.

CN119979755BActive Publication Date: 2025-12-12INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510173444.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-17
Publication Date
2025-12-12
Estimated Expiration
2045-02-17

AI Technical Summary

Technical Problem

The lack of effective SNP molecular markers in current technologies for rapid and accurate identification of wheat grain protein content affects breeding efficiency and variety improvement.

Method used

A molecular marker for an SNP at position 167440648 bp on wheat chromosome 7B and a specific KASP primer combination were designed for rapid identification of plant protein content via PCR amplification. The primer combination includes forward primer 1, forward primer 2, and reverse primer, which are then used in conjunction with a detection kit for detection.

Benefits of technology

It enables rapid and accurate identification of wheat protein content, improves selection efficiency, shortens the breeding cycle, and allows for the rapid identification and cultivation of wheat varieties with ideal protein content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979755B_ABST
    Figure CN119979755B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and in particular to a SNP molecular marker related to wheat kernel protein content and application. The SNP molecular marker contains a nucleotide sequence with polymorphism of T or C at the 167440648 bp of wheat chromosome 7B. The present application determines that the site is a SNP site closely related to protein content, and a specific KASP primer combination designed based on the SNP site can realize rapid and accurate identification of wheat protein content. The technical solution provided by the present application can not only improve the selection efficiency, but also shorten the breeding period, and is helpful for quickly identifying and cultivating wheat varieties with ideal protein content. The KASP primer combination provided by the present application provides an effective tool for molecular marker assisted selection of wheat nutritional quality related traits.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a SNP molecular marker related to wheat kernel protein content and application. BACKGROUND

[0002] With the improvement of people's healthy diet concept, the breeding goal of breeders is also changed from improving yield to improving healthy varieties, and the kernel protein content is a key indicator of wheat nutrition. KASP (Kompetitive Allele Specific PCR) technology is a SNP site-based molecular marker method, which is highly stable, accurate and economical in genotyping. The application of KASP technology not only improves the speed and efficiency of genotyping, but also reduces the cost, so that it has a wide application prospect in the fields of agricultural breeding, genetic research and molecular diagnosis. At present, the SNP marker related to the protein content of wheat needs to be further developed. In view of this, the present application is proposed. SUMMARY

[0003] In order to solve the above technical problems, the present application provides a SNP molecular marker related to plant protein content, a KASP primer combination and application thereof.

[0004] Specifically, the technical scheme of the present application is as follows:

[0005] In the first aspect, the present application provides a SNP molecular marker related to plant protein content, which contains a nucleotide sequence with polymorphism of T or C at the position of 167440648 bp on wheat 7B chromosome.

[0006] Preferably, the plant with genotype TT of the polymorphism site has higher protein content than the plant with genotype CC.

[0007] In the second aspect, the present application provides a KASP primer combination for amplifying the SNP molecular marker, which includes forward primer 1, forward primer 2 and reverse primer; the nucleotide sequence of the forward primer 1 includes the nucleotide fragment as shown in SEQ ID NO. 01; the nucleotide sequence of the forward primer 2 includes the nucleotide fragment as shown in SEQ ID NO. 02; and the nucleotide sequence of the reverse primer includes the nucleotide fragment as shown in SEQ ID NO. 03.

[0008] In the third aspect, the present application provides a detection reagent or kit for detecting plant protein content, and the kit includes the KASP primer combination.

[0009] In a fourth aspect, the present application provides a method for identifying a plant with high protein content, comprising: using the KASP primer combination or the detection reagent or kit to perform PCR amplification with DNA of a plant sample as a template, and determining the protein content of the plant sample according to the amplification result.

[0010] Preferably, determining the protein content of the plant sample according to the amplification result comprises: analyzing the genotype of the polymorphic site located at 167440648 bp of the wheat 7B chromosome in the amplification product, and the plant with the genotype of TT has higher protein content than the plant with the genotype of CC.

[0011] Preferably, the plant is wheat.

[0012] Preferably, the system used for PCR amplification comprises: 2xKASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the rest is water, based on a total system of 10 μL; the primer mixture comprises: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 10-14 μL, and the rest is water, based on 100 μL.

[0013] Preferably, the reaction program used for PCR amplification is: 95℃ 8-12 min; 95℃ 15-25 s, 61℃ 60 s, 8-12 cycles, with a decrease of 0.5-0.7℃ in annealing temperature for each cycle; 95℃ 15-25 s, 55℃ 35-45 s, 32-36 cycles; 25℃ 10-20 min.

[0014] In a fifth aspect, the present application provides any of the following applications of the SNP molecular marker, the KASP primer combination, or the detection reagent or kit:

[0015] (1) used for identifying, breeding and improving the protein content of wheat;

[0016] (2) used for early prediction of quality traits of wheat;

[0017] (3) used for molecular marker-assisted breeding of wheat;

[0018] (4) used for screening or breeding plants with high yield

[0019] Advantages:

[0020] The present application provides a SNP molecular marker related to plant protein content and application thereof, wherein the SNP molecular marker contains a nucleotide sequence with a polymorphism of T or C at position 167440648 bp of chromosome 7B of wheat. The present application determines that the site is a SNP site closely related to protein content, and a specific KASP primer combination designed based on the SNP site can realize rapid and accurate identification of wheat protein content. The technical solution provided by the present application can not only improve the selection efficiency, but also shorten the breeding period, and is helpful for rapid identification and cultivation of wheat varieties with ideal protein content. The KASP primer combination provided by the present application provides an effective tool for molecular marker assisted selection of wheat nutritional quality related traits. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the present application or prior art, the drawings needed to be used in the embodiments or prior art description will be described below.

[0022] Figure 1 FIG. 1 is a SNP site map of exons of TraesCS7B03G0350300 gene analyzed by exon capture sequencing technology provided in Embodiment 1 of the present application.

[0023] Figure 2 FIG. 2 is a statistical diagram of protein content of different genotypes of 167440648 site of chromosome 7B provided in Embodiment 2 of the present application.

[0024] Figure 3 FIG. 3 is a genotyping result of wheat genotype of 167440648 site of chromosome 7B provided in Embodiment 2 of the present application; wherein CC represents 167440648-C, and TT represents 167440648-T.

[0025] Figure 4 FIG. 4 is a sequencing peak diagram of different genotypes of 167440648 site of chromosome 7B provided in Embodiment 2 of the present application. The genome of the gene is forward, and the sequencing result is forward sequencing. DETAILED DESCRIPTION

[0026] The present application provides a SNP marker related to plant protein content and application thereof, the SNP site is located at 167440648 bp of wheat 7B chromosome, the reference genome is IWGSC V2.1, and the polymorphism is C / T. Through haplotype analysis, it is determined that the site is a SNP site closely related to protein content, and a specific KASP primer combination is designed to realize rapid and accurate identification of wheat protein content. The technology provided by the present application has significant significance for improving wheat quality: not only can improve the selection efficiency, but also can shorten the breeding period, and is helpful for rapid identification and cultivation of wheat varieties with ideal protein content. The KASP primer combination provided by the present application provides an effective tool for molecular marker assisted selection of wheat nutritional quality related traits, and can improve the protein content of crops.

[0027] Firstly, the present application provides a SNP molecular marker related to plant protein content, which contains a nucleotide sequence with a polymorphism of C / T at 167440648 bp of wheat 7B chromosome.

[0028] Further, the plant with genotype TT at the polymorphism site of the marker has higher protein content than the plant with genotype CC.

[0029] Further, the present application provides a KASP primer combination for amplifying the marker, which comprises a forward primer 1 (TGACCTCGTCATCAGCGC) as shown in SEQ ID NO:1, a forward primer 2 (TGACCTCGTCATCAGCGT) as shown in SEQ ID NO:2 and a reverse primer (GCTCAAGAGTGCTGGGATCC) as shown in SEQ ID NO:3.

[0030] Further, the 5' end of the forward primer 1 and the forward primer 2 in the KASP primer combination can be further connected to a fluorescent label sequence, for example, FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO:8) or HEX (GAAGGTCGGAGTCAACGGATT, SEQ ID NO:9).

[0031] In one specific embodiment of the present application, the KASP primer combination is as follows:

[0032] 167440648 F1 (SEQ ID NO:4):

[0033] 5' GAAGGTGACCAAGTTCATGCTTGACCTCGTCATCAGCGC 3'.

[0034] 167440648 F2 (SEQ ID NO:5):

[0035] 5' GAGGTCGGAGTCAACGGATTGACCTCGTCATCAGCGT 3'.

[0036] 167440648 R (SEQ ID NO: 3):

[0037] 5' GCTCAAGAGTGCTGGGATCC 3'.

[0038] The application further provides a detection reagent or kit containing the primer combination.

[0039] The application also provides a method for identifying the protein content (high, low, or size) of a plant, comprising: using the DNA of a plant sample to be tested as a template, and using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and determining the protein content of the plant sample to be tested according to the amplification result.

[0040] Preferably, the system used for PCR amplification includes 2xKASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the rest is water, based on a total system of 10 μL.

[0041] Preferably, the primer mixture includes 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the rest is water, based on 100 μL.

[0042] Preferably, the reaction program used for PCR amplification is: 95℃ 8-12 min; 95℃ 15-25 s, 61℃ 60 s, 8-12 cycles, with a decrease of 0.5-0.7℃ in annealing temperature for each cycle; 95℃ 15-25 s, 55℃ 35-45 s, 32-36 cycles; 25℃ 10-20 min.

[0043] Further, the application determines the protein content of the plant sample to be tested according to the amplification result, and the determination criteria include: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and plants with genotype TT have higher protein content than plants with genotype CC.

[0044] Further, the plant is wheat.

[0045] The application also provides any of the following applications of the marker, the marker combination, or the detection reagent or kit:

[0046] (1) for identifying, selecting, and improving the protein content of wheat;

[0047] (2) early prediction of wheat protein content traits;

[0048] (3) wheat molecular marker-assisted breeding;

[0049] (4) screening or breeding high-yield plants.

[0050] The present application successfully identifies a SNP site closely related to plant protein content through phenotype difference analysis and exon capture sequencing technology. The polymorphism detection of the site can accurately and quickly evaluate the protein content characteristics of plants. Using KASP technology, the SNP site and the corresponding primer combination provided by the present application not only improve the efficiency of plant variety selection, but also help to shorten the breeding cycle and accelerate the breeding of high-quality plant varieties. These markers have good genetic stability, high resolution, are suitable for high-throughput detection, and have significant application value in the field of plant breeding.

[0051] To make the objectives, technical solutions, and advantages of the present application clearer, the technical solutions in the present application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present application.

[0052] The endpoints of the ranges and any values disclosed in the specification are not limited to the precise values stated. The endpoints of the ranges and any values are understood to be approximate values. The endpoints of the ranges and the individual values are not to be construed as being meant to be exact limitations. The ranges and individual values are understood to be approximate values intended to cover values around the ending point ranges and the individual values. For numeric value ranges, the endpoints of the ranges, the endpoints of the ranges and individual points, and individual points can be combined with each other to obtain one or more new numeric value ranges, which should be considered as being specifically disclosed herein.

[0053] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "specific embodiments", or "some specific embodiments" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, those skilled in the art can combine and combine the different embodiments or examples described in the present specification and the features of the different embodiments or examples without contradiction.

[0054] In the examples provided in the present specification, if a specific technique or condition is not specified, the technique or condition described in the literature in the art or according to the product manual is used. If the manufacturer of the reagent or instrument is not specified, it is a conventional product that can be purchased through a regular channel.

[0055] The relevant wheat varieties (lines) involved in the following examples are provided by Professor Zhang Xueyong of the Crop Science Institute of the Chinese Academy of Agricultural Sciences, and the relevant wheat is sown in Xinxiang, Henan, and harvested after physiological maturity, naturally dried and used for subsequent analysis. It should be noted that as a professional agricultural research institution, the applicant has long-term preservation of relevant germplasm materials, and the relevant wheat varieties are publicly available in the market or existing germplasm banks.

[0056] Example 1

[0057] This example describes the process of obtaining SNP markers related to plant protein content and the design of KASP primers.

[0058] 1. 182 exome capture sequencing.

[0059] The process of whole exome sequencing includes the following steps:

[0060] 1) Sample detection: Before DNA sequencing, the quality and quantity of the sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration should be no less than 20 ng / ul, and the total amount should be no less than 800 ng to ensure the accuracy and repeatability of the sequencing.

[0061] 2) Library construction: The genomic DNA is randomly fragmented to 180-280 bp fragments using a Covaris disruptor. Then, the DNA is end-repaired, phosphorylated, and tailed with poly A using the Agilent Sure Select kit. The exon region is enriched by liquid hybridization, and the biotin-labeled probe is specifically hybridized with the library with specific index, followed by PCR amplification. Finally, the quality of the amplified library is detected to ensure that the quality of the library before sequencing meets the standard.

[0062] 3) Library detection: After library construction, the library is first quantified by Qubit 2.0. Then, the Agilent 2100 Bioanalyzer detects the insert size to ensure the appropriate size. After passing the test, the library is accurately quantified to 3 nmol / L by Q-PCR to ensure the quality and accuracy of the sequencing library.

[0063] 4) Sequencing: After passing the library inspection, according to the effective concentration of the library and the data requirement, PE150 sequencing was performed on the Illumina HiSeq platform. PE150 refers to double-end sequencing, each end reads 150 bp, and the use of small fragment library inserts for high-throughput sequencing facilitates subsequent sequence alignment and analysis, improving data accuracy and reliability.

[0064] 2. Obtain the protein content of different wheat and develop SNP molecular markers

[0065] In order to screen the key genes affecting the protein content of wheat, the protein content of 182 wheat varieties in 2022 and 2023 was determined to evaluate the phenotypic variation. This basic data collection work is the first step to understand the genetic background of protein content. The determination results are shown in Table 1, which lays the foundation for further gene analysis and breeding research.

[0066] Based on the two-year phenotypic data of 182 protein contents determined in step 2, combined with the results of exon capture sequencing analysis, the contribution of SNP sites of important genes to protein content was mined, and the SNP site of TraesCS7B03G0350300 gene exon on chromosome 7B of wheat genome was screened. The protein content of the SNP site SNP variation was significantly increased, and a significant site affecting the protein content of wheat was identified (7B: 167440648 bp) (part of the results are shown in Figure 1 ), and the site was named: 167440648. It should be noted that the gene is in the forward direction in the genome, and the designed sequencing and KASP primers are forward sequences.

[0067] Based on the above sequence differences, and based on the KASP principle, further development and design of PCR amplification to obtain the primer set for the wheat molecular marker, the specific design is as follows:

[0068] 167440648-F1 (SEQ ID NO: 4):

[0069] 5'- GAAGGTGACCAAGTTCATGCTTGACCTCGTCATCAGCGC-3'.

[0070] 167440648-F2 (SEQ ID NO: 5):

[0071] 5'- GAAGGTCGGAGTCAACGGATTGACCTCGTCATCAGCGT -3'.

[0072] 167440648-R (SEQ ID NO: 3):

[0073] 5'-GCTCAAGAGTGCTGGGATCC-3'.

[0074] The 167440648-F1 and 167440648-R primer pairs are combined to amplify the sequence of the 167440648 locus on the 7B chromosome in the wheat molecular marker, and the base at the 167440648 locus is C.

[0075] The 167440648-F2 and 167440648-R primer pairs are combined to amplify the sequence of the 167440648 locus on the 7B chromosome in the wheat molecular marker, and the base at the 167440648 locus is T.

[0076] Example 2

[0077] The above SNP marker is used to identify the protein content of wheat.

[0078] 1. Based on the primer pair design of Example 1, the genotype (CC 29, TT 29) of 182 wheat materials is detected, and the correlation between the genotype and the protein content phenotype is identified, and the specific process is as follows.

[0079] First, the genomic DNA of each wheat variety is extracted.

[0080] Then, according to the primer designed in Example 1, the above extracted DNA is used as a template to perform PCR (using Quant Studio 1 fluorescent quantitative PCR instrument) detection analysis on different wheat samples.

[0081] The 10 μL amplification system is designed as follows:

[0082] KASP Mix (2x), 5 μL; HiGeno 2x Probe Mix (provided at 2x concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2 and reference dye ROX; Primer Mix (primer mixture), 0.14 μL; DNA, 30 ng; ddH2O, supplemented to 10 μL. Among them, the Primer Mix in 100 μL: 167440648-F1, 100 μM, 12 μL; 167440648-F2, 100 μM, 12 μL; 167440648-R, 100 μM, 30 μL; ddH2O, 46 μL.

[0083] The PCR reaction program (which can be adjusted according to the amplification results) is as follows:

[0084] 95°C 10 min; 95°C 20 s, 61°C 60 s (10 cycles, each cycle decreasing by 0.6°C); 95°C 20 s, 55°C 40 s, 34 cycles; 25°C 15 min.

[0085] 2. Using the genomic DNA extracted in step 1 for each wheat variety, common PCR was performed, and sequencing was performed to verify the accuracy of KASP genotyping.

[0086] First, specific primers were designed for amplification at 167440648 bp of wheat chromosome 7B (reference sequence: Chinese Spring wheat), and the primer sequences were as follows:

[0087] F (SEQ ID NO: 6): 5’ GCATTGGCATGAAGGTGTCGTG 3’.

[0088] R (SEQ ID NO: 7): 5’ CTTCCCATCACTAAGTAGGCTATTG 3’.

[0089] Six wheat varieties with CC / TT genotypes in KASP genotyping results were randomly selected, and common PCR was performed for amplification. Sequencing was performed after electrophoresis detection, so as to verify the reliability of the genotyping results.

[0090] The 25 μL amplification system was designed as follows during specific PCR amplification:

[0091] Full-style Jinbio 2x EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; primers WAF / WAR, each 1 μL; primer concentration 10 μM; DNA, 60 ng; ddH2O, supplemented to 25 μL.

[0092] The PCR reaction program (which can be adjusted according to the amplification results) is as follows:

[0093] 94°C 5 min; 94°C 30 s, 90°C 30 s, 72°C 40 s (35 cycles); 72°C 10 min; 16°C end.

[0094] The specific genotype and wheat protein content statistical results are shown in Tables 1 and Figures 1-4 .

[0095] Table 1. Corresponding results of genotypes of different wheat varieties and their protein contents

[0096]

[0097]

[0098]

[0099] .

[0100] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, and are not intended to limit the same; although the present application has been described in detail with reference to the foregoing examples, those of ordinary skill in the art will understand that they can still modify the technical solutions described in the foregoing examples, or make equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. Use of a SNP molecular marker, or a KASP primer combination, or a detection reagent or kit in the selection of wheat grain protein content, characterized in that, The SNP molecular marker is located at 167440648 bp of wheat chromosome 7B based on the reference genome IWGSC V2.1, and the polymorphism is T or C; Wheat with genotype TT of the polymorphic site has higher protein content than wheat with genotype CC; The KASP primer combination for amplifying the SNP molecular marker comprises forward primer 1, forward primer 2 and reverse primer; The nucleotide sequence of the forward primer 1 is shown as SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown as SEQ ID NO. 2; The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3; The detection reagent or kit comprises the KASP primer combination.

2. A method for identifying wheat with high protein content, characterized in that, Comprise: Using the KASP primer combination or the detection reagent or kit mentioned in the application of claim 1 as a template, PCR amplification is carried out, and the genotype of the polymorphic site located at 167440648 bp of wheat chromosome 7B in the amplification product is analyzed; wheat with genotype TT of the polymorphic site has higher protein content than wheat with genotype CC.

3. The method for identifying high protein content in wheat according to claim 2, characterized in that, The PCR amplification system comprises 2xKASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the rest is water, with a total system of 10 μL; the primer mixture, 100 μL, comprises 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 10-14 μL, and the rest is water.

4. The method for identifying high protein content in wheat according to claim 3, characterized in that, The reaction program for PCR amplification is as follows: 95℃ 8-12 min; 95℃ 15-25 s, 61℃ 60 s, 8-12 cycles, and the annealing temperature decreases by 0.5-0.7℃ in each cycle; 95℃ 15-25 s, 55℃ 35-45 s, 32-36 cycles; 25℃ 10-20 min.

5. Any one of the following applications of the SNP molecular marker, or the KASP primer combination, or the detection reagent or kit: (1) used for identification, breeding and improvement of wheat protein content; (2) used for early prediction of wheat grain protein content; (3) used for wheat molecular marker screening of wheat grain protein content for assisted breeding; (4) used for screening or breeding wheat with high grain protein content; The SNP molecular marker is located at 167440648 bp of wheat chromosome 7B based on the reference genome IWGSC V2.1, and the polymorphism is T or C; wheat with genotype TT of the polymorphic site has higher protein content than wheat with genotype CC; The KASP primer combination for amplifying the SNP molecular marker comprises forward primer 1, forward primer 2 and reverse primer; The nucleotide sequence of the forward primer 1 is shown as SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown as SEQ ID NO. 2; The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3; The detection reagent or kit comprises the KASP primer combination. The detection reagent or kit comprises the KASP primer combination.

Citation Information

Patent Citations

  • Primer, kit and detection method for detecting wheat high grain protein content and application

    CN106282395A

  • Gene underlying the number of spikelets per spike QTL in wheat on chromosome 7a

    US20200362366A1