InDel molecular markers, primer pairs, kits and applications related to high benzyl alcohol primulosides content

Through InDel molecular markers and PCR amplification technology, high-benzyl alcohol primulosidase tea varieties can be quickly identified, solving the problems of low efficiency, high cost and environmental dependence in traditional methods, and achieving efficient and accurate tea breeding screening.

CN119979765BActive Publication Date: 2025-09-16NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510462977.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-09-16
Estimated Expiration
2045-04-14

AI Technical Summary

Technical Problem

The existing identification methods for high-benzyl alcohol primulosidase tea varieties are inefficient, costly, and greatly affected by the environment, making it difficult to quickly screen out tea varieties with high aroma potential.

Method used

An InDel molecular marker related to high benzyl alcohol primulosides was developed. The insertion or deletion polymorphic sites in the CsUGT6 promoter region were used to design specific primer pairs for PCR amplification. The PCR products were analyzed by agarose gel electrophoresis to quickly identify tea varieties with high benzyl alcohol primulosides.

Benefits of technology

The rapid and accurate screening of high-benzyl alcohol primulosidoside tea varieties was achieved, which improved the efficiency of tea breeding, reduced costs, and reduced the impact of environmental factors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979765B_ABST
    Figure CN119979765B_ABST
Patent Text Reader

Abstract

The present invention relates to an InDel molecular marker, primer pair, kit, and application related to high benzyl alcohol primulosides content, belonging to the technical fields of plant molecular biology and genetic breeding. The sequence of the InDel molecular marker is shown in SEQ ID No. 1. The method of identifying high benzyl alcohol primulosides using the InDel molecular marker is simple to operate, rapid and efficient, and highly accurate. It can significantly shorten the tea tree breeding cycle and reduce the cost and complexity of traditional phenotypic screening. The method is suitable for large-scale screening of high-benzyl alcohol primulosides tea varieties, providing important technical support for improving tea aroma quality and selecting high-quality tea varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular biology and genetic breeding, and particularly relates to an InDel molecular marker related to high benzyl alcohol primulosidoside content, a primer pair, a kit and applications. Background Art

[0002] The aroma and flavor of tea are key factors in determining its quality and market competitiveness. Benzyl primulosin is an important aroma precursor in tea. During tea processing, it hydrolyzes to form benzyl alcohol, which imparts its unique aroma characteristics. Tea varieties with high Benzyl primulosin content generally possess superior aroma potential, making the selection of high-benzylic primulosin tea varieties a key goal in tea breeding.

[0003] Traditional tea plant breeding methods rely primarily on phenotypic selection, which involves determining the benzyl primulosides content in tea leaves through sensory evaluation or chemical analysis to identify high-benzyl primulosides varieties. However, this approach has numerous limitations: First, phenotypic selection is significantly influenced by environmental factors (such as climate, soil, and cultivation conditions), resulting in unstable screening results. Second, while accurate, chemical analysis methods (such as high-performance liquid chromatography and gas chromatography-mass spectrometry) are complex, time-consuming, and costly, making them difficult to meet the demands of large-scale breeding. Furthermore, traditional breeding processes are long and inefficient, making it difficult to quickly obtain target varieties.

[0004] With the rapid development of molecular biology techniques, marker-assisted selection (MAS) technology has provided a new solution for plant breeding. Molecular marker technology can directly screen for target traits at the DNA level, offering the advantages of rapidity, accuracy, and environmental instability. Insertion / deletion (InDel) markers are polymorphic markers based on insertion or deletion variations in genomic sequences. They are highly stable and easy to detect, and have been widely used in plant genetics and breeding.

[0005] While research on molecular markers for tea aroma components has made some progress, there is still a lack of efficient and reliable technologies for the rapid identification of tea varieties high in benzyl alcohol primulosides. Currently, there are no reports on the use of InDel markers for the rapid identification of tea varieties high in benzyl alcohol primulosides. Therefore, developing an InDel marker related to high-benzyl alcohol primulosides is of great significance for improving tea breeding efficiency and accelerating the selection of tea varieties with high aroma potential. Summary of the Invention

[0006] The present invention addresses the problems of low efficiency, high cost, and significant environmental impact in existing methods for identifying high-benzyl alcohol primulosidase tea varieties. By providing an InDel molecular marker associated with high-benzyl alcohol primulosidase content, the present invention enables rapid and accurate screening of high-benzyl alcohol primulosidase tea varieties, providing a highly effective technical approach for tea breeding and tea quality improvement.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] In the first aspect of the present invention, an InDel molecular marker related to high benzyl alcohol primulosides content is provided, wherein the sequence of the InDel molecular marker is shown in SEQ ID No. 1, and the InDel molecular marker is a gene encoding a benzyl alcohol primulosides synthesis gene in tea plant. CsUGT6 Polymorphic sites of deletion or insertion in the promoter region.

[0009] In a second aspect, the present invention provides a primer pair for detecting the InDel molecular marker, characterized in that the primer pair comprises a forward primer and a reverse primer;

[0010] Forward primer: 5′-TTCACTCCCGTTTACTAAGC-3′;

[0011] Reverse primer: 5′-GAGAGCCGAACAGAGGAA-3′.

[0012] In a third aspect, the present invention provides a kit comprising the primer pair.

[0013] In a fourth aspect, the present invention provides a use of the InDel molecular marker, the primer pair, or the kit in identifying tea varieties containing high levels of benzyl alcohol primulosides.

[0014] In a fifth aspect, the present invention provides a method for identifying tea varieties containing high levels of benzyl alcohol primulosides, comprising the following steps:

[0015] Extracting genomic DNA of the tea variety to be tested;

[0016] Using the genomic DNA as a template, PCR amplification is performed using the primer pair;

[0017] The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or specific bands appeared at both 264 bp and 236 bp, the tea tree variety with high benzyl alcohol primulosidase was identified.

[0018] As a preferred embodiment of the present invention, the reaction procedure of PCR amplification is: initial denaturation at 95°C for 3 minutes; followed by 34 cycles, each cycle including 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and finally extension at 72°C for 5 minutes.

[0019] As a preferred embodiment of the present invention, a 25 μL PCR reaction system consists of the following components: 1 μL of 50 ng template DNA, 1 μL of each 10 μM specific primer, 2 μL of 2.5 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 2.5 μL of 10× PCR buffer, and water to make up.

[0020] In a sixth aspect, the present invention provides a use of the InDel molecular marker, the primer pair, or the kit in breeding high-benzyl alcohol primulosidase tea trees.

[0021] In a seventh aspect, the present invention provides a method for cultivating a tea tree containing high benzyl alcohol primulosides, comprising the following steps:

[0022] Extracting genomic DNA of the tea variety to be tested;

[0023] Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2;

[0024] The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or specific bands appeared at both 264 bp and 236 bp, the tea tree variety was selected as the male or female parent of high-benzyl alcohol primulosidase tea trees for breeding.

[0025] As a preferred embodiment of the present invention, the reaction procedure of PCR amplification is: initial denaturation at 95°C for 3 minutes; followed by 34 cycles, each cycle including 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and finally extension at 72°C for 5 minutes.

[0026] As a preferred embodiment of the present invention, a 25 μL PCR reaction system consists of the following components: 1 μL of 50 ng template DNA, 1 μL of each 10 μM specific primer, 2 μL of 2.5 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 2.5 μL of 10× PCR buffer, and water to make up.

[0027] Compared with the prior art, the beneficial effects of the present invention are:

[0028] The present invention first discovered that high benzyl alcohol primrose glycoside tea varieties CsUGT6A 28-bp DNA sequence was inserted into the gene's promoter region, which can be used as an InDel molecular marker to rapidly identify tea varieties high in benzyl alcohol primulosides. The PCR amplification products of tea varieties high in benzyl alcohol primulosides showed a clear 264-bp band or a clear 264-bp band and a clear 236-bp band on the electrophoresis pattern. The PCR amplification products of standard tea varieties showed only a single 236-bp band on the electrophoresis pattern. This can be used for large-scale screening of tea varieties high in benzyl alcohol primulosides, providing important technical support for improving tea aroma quality and selecting high-quality tea varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Different tea tree resources CsUGT6 Promoter sequence alignment;

[0030] Figure 2 Amplification results of InDel markers from different tea tree resources. DETAILED DESCRIPTION

[0031] The present invention will be further described in detail below with reference to specific examples, which are intended to explain the present invention rather than to limit it.

[0032] The aroma and flavor of tea are key factors in determining its quality and market competitiveness. Benzyl primulosin is an important aroma precursor in tea. During tea processing, it hydrolyzes to form benzyl alcohol, which imparts its unique aroma characteristics. Tea varieties with high Benzyl primulosin content generally possess superior aroma potential, making the selection of high-benzylic primulosin tea varieties a key goal in tea breeding.

[0033] Traditional tea plant breeding methods rely primarily on phenotypic selection, which involves determining the benzyl primulosides content in tea leaves through sensory evaluation or chemical analysis to identify high-benzyl primulosides varieties. However, this approach has numerous limitations: First, phenotypic selection is significantly influenced by environmental factors (such as climate, soil, and cultivation conditions), resulting in unstable screening results. Second, while accurate, chemical analysis methods (such as high-performance liquid chromatography and gas chromatography-mass spectrometry) are complex, time-consuming, and costly, making them difficult to meet the demands of large-scale breeding. Furthermore, traditional breeding processes are long and inefficient, making it difficult to quickly obtain target varieties.

[0034] While research into molecular markers for tea aroma components has made some progress, there is still a lack of efficient and reliable techniques for rapidly identifying tea varieties high in benzyl alcohol primulosides. Currently, there are no reports on the use of InDel markers for rapid identification of tea varieties high in benzyl alcohol primulosides.

[0035] Based on this, the present invention provides an InDel molecular marker related to high benzyl alcohol primulosides content, the sequence of the InDel molecular marker is shown in SEQ ID No.1, and the InDel molecular marker is a marker for the synthesis of benzyl alcohol primulosides in tea plants. CsUGT6 The polymorphic site of deletion or insertion in the promoter region can be used to quickly identify tea varieties with high benzyl alcohol primulosides using this InDel molecular marker.

[0036] The different tea varieties involved in the embodiments of the present invention include:

[0037] The samples include: BY1H, Baiye No. 1; HJC2H, Huangjincha No. 2; XYJB, Xiaoye Jibai; SZNB, Shengzhou Naibai; JB, Jibai; SBC, Subei tea; NBC, Naibai tea; RG, cinnamon; ZH1H, Zhonghuang No. 1; ZB1H, Zhongbai No. 1; SXH, Shengxian Huang; HD, Huangdan; TGY, Tieguanyin; EC1H, Echa No. 1; TZH, Tezaohuang; ZJ, Zijuan; SCZ, Shucha Zao; ZMG, Zimeigui; SPL, Shanpolv; XN-3-55, AH1H, Anhui No. 1; ZZ1H, Zhongzi No. 1; PYTZ, Pingyang Tezao; FS, Buddha's hand.

[0038] Example 1

[0039] InDel marker screening and primer design

[0040] 1. Test materials:

[0041] The LC-MS / MS method was used to detect the content of benzyl alcohol primulosidoside in 363 Shaanxi tea plant populations.

[0042] 2. Genomic DNA extraction:

[0043] The genomic DNA of 363 tea plants was extracted using the Plant Genomic DNA Kit (DP305) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific operation was referred to the instruction manual.

[0044] 3. Genome sequence alignment:

[0045] The whole genome of 363 tea plants was sequenced. Bioinformatics GWAS software was used to screen out InDel sites associated with high benzyl alcohol primulosidase content. Combined with the analysis of tea plant genome data, it was found that compared with low benzyl alcohol primulosidase tea varieties, high benzyl alcohol primulosidase tea varieties had a higher benzyl alcohol primulosidase content. CsUGT6 A 28 bp DNA sequence was inserted into the promoter region of the gene ( Figure 1 ), the sequence of which is shown in SEQ ID NO: 1:

[0046] CGTCATTTTCTTTGGTCCCAAGTCGACT

[0047] 4. Primer design:

[0048] Design a pair of specific primers based on the screened InDel sites:

[0049] Forward primer: 5'-TTCACTCCCGTTTACTAAGC-3' (SEQ ID NO: 2)

[0050] Reverse primer: 5'-GAGAGCCGAACAGAGGAA-3' (SEQ ID NO: 3).

[0051] The primers were synthesized by a professional biological company.

[0052] Example 2

[0053] DNA extraction and PCR amplification

[0054] 1. DNA extraction:

[0055] The CTAB method was used to extract genomic DNA from the leaves of the tea species to be tested. The specific steps are as follows:

[0056] 0.1 g of fresh leaves were taken and ground into powder in liquid nitrogen.

[0057] Add 1 mL of CTAB extraction buffer and incubate in a 65°C water bath for 30 minutes.

[0058] An equal volume of chloroform-isoamyl alcohol (24:1) was added, mixed, and centrifuged (12,000 rpm, 10 min).

[0059] The supernatant was collected and an equal volume of isopropanol was added to precipitate DNA. The precipitate was washed after centrifugation, dried, and then dissolved in 50 μL TE buffer.

[0060] The DNA concentration and purity were measured using a spectrophotometer and adjusted to 50 ng / μL for later use.

[0061] 2. PCR amplification:

[0062] PCR reaction system (25 μL):

[0063] Template DNA: 1 μL (50 ng)

[0064] Forward primer: 1 μL (10 μM)

[0065] Reverse primer: 1 μL (10 μM)

[0066] dNTPs: 2 μL (2.5 mM each)

[0067] 10× PCR buffer: 2.5 μL

[0068] Taq DNA polymerase: 0.2 μL (5 U / μL)

[0069] ddH2O: Make up to 25 μL

[0070] PCR reaction procedure:

[0071] Pre-denaturation: 94°C, 5 minutes;

[0072] 35 cycles: 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds;

[0073] Final extension: 72°C, 10 min.

[0074] The PCR products were stored at 4°C.

[0075] Example 3

[0076] Electrophoresis analysis and result determination

[0077] 1. Agarose gel electrophoresis:

[0078] Prepare 1.5% agarose gel and add 0.5 μg / mL ethidium bromide (EB) for staining.

[0079] 5 μL of PCR product was mixed with 1 μL of 6× loading buffer and spotted on the gel wells.

[0080] Electrophoresis was performed at 100 V for 30 min, and the gel was visualized and photographed using a gel imaging system.

[0081] Result judgment:

[0082] The PCR amplification products of high-benzyl alcohol primulosidase tea varieties showed a clear 264 bp band or a clear 264 bp band and a clear 236 bp band on the electrophoresis pattern, while the PCR amplification products of ordinary tea varieties showed only a 236 bp band on the electrophoresis pattern ( Figure 2 ).

[0083] Based on the position and size of the bands, it is possible to quickly distinguish whether the tea tree variety is a high-benzyl alcohol primrose glycoside variety.

[0084] Example 4

[0085] Validation of a method for rapid identification of tea varieties with high benzyl alcohol primulosides using InDel

[0086] Determination of benzyl alcohol primrose glycoside content:

[0087] The accuracy of the method of the present invention was verified by measuring the content of benzyl alcohol primulosides in the screened tea varieties using LC-MS / MS. The results are shown in Table 1.

[0088] Table 1 Primrose glycoside content in different tea varieties

[0089]

[0090] As shown in Table 1, the content of benzyl alcohol primulosidoside in tea varieties with PCR amplification products of 264 bp or 264 bp and 236 bp is significantly higher than that in ordinary tea varieties, which verifies the reliability of the method of the present invention.

[0091] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications of the present invention fall within the scope of the claims and their equivalents, such changes and modifications are intended to be included.

Claims

1. An InDel molecular marker associated with high benzyl alcohol primulosides content, characterized in that: The sequence of the InDel molecular marker is shown in SEQ ID No. 1, and the InDel molecular marker is located in the tea tree benzyl alcohol primrose glycoside synthesis gene CsUGT6 Polymorphic sites of deletion or insertion in the promoter region.

2. A primer pair for detecting the InDel molecular marker according to claim 1, characterized in that: The primer pair includes a forward primer and a reverse primer; Forward primer: 5′-TTCACTCCCGTTTACTAAGC-3′; Reverse primer: 5′-GAGAGCCGAACAGAGGAA-3′.

3. A kit comprising the primer pair according to claim 2.

4. Use of the primer pair according to claim 2 in identifying tea varieties with high benzyl alcohol primulosides content.

5. A method for identifying high-benzyl alcohol primulosidase tea varieties, characterized in that: The following steps are involved: Extracting genomic DNA of the tea variety to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or specific bands appeared at both 264 bp and 236 bp, the tea tree variety with high benzyl alcohol primulosidase was identified.

6. The method for identifying high-benzyl alcohol primulosidase tea varieties according to claim 5, characterized in that: The PCR amplification reaction program was as follows: initial denaturation at 95°C for 3 minutes; followed by 34 cycles, each cycle consisting of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and finally extension at 72°C for 5 minutes.

7. The method for identifying high-benzyl alcohol primulosidase tea varieties according to claim 5, characterized in that: The 25 μL PCR reaction system consisted of the following components: 1 μL of 50 ng template DNA, 1 μL of each 10 μM specific primer, 2 μL of 2.5 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 2.5 μL of 10× PCR buffer, and made up with water.

8. Use of the InDel molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in breeding tea trees containing high levels of benzyl alcohol primulosides.

9. A method for cultivating tea trees high in benzyl alcohol primulosides, characterized in that: The following steps are involved: Extracting genomic DNA of the tea variety to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or specific bands appeared at both 264 bp and 236 bp, the tea tree variety was selected as the male or female parent of high-benzyl alcohol primulosidase tea trees for breeding.