Polysaccharide hydrolase mutant library high-throughput screening method based on bioelectrochemistry

Abstract

The invention provides a polysaccharide hydrolase mutant library high-throughput screening method based on bioelectrochemistry, and belongs to the technical field of microbial biology. According to the method, the rapid marking of the mutant library is realized through the steps of cell surface ferrocene modification, polysaccharide hydrolase and glucose dehydrogenase (GDH) cell surface co-display expression, design and modification of a cell capture micro-fluidic chip, polysaccharide hydrolysis driven cell capture based on interaction of reducing ferrocene and cyclodextrin and the like; high-enzyme-activity strains are rapidly captured, high-throughput screening is achieved, the screening efficiency of the polysaccharide hydrolase mutant library can be greatly improved, and good practicability is achieved.

Description

Technical Field

[0001] The invention belongs to the field of microbial biotechnology, and in particular relates to a high-throughput screening method for a polysaccharide hydrolase mutant library based on bioelectrochemistry. Background Art

[0002] Polysaccharides are polymers composed of multiple monosaccharide molecules connected by glycosidic bonds. They are a class of carbohydrates widely found in various organisms. Their main sources include plant cellulose, hemicellulose, starch, chitosan, etc. These compounds are rich in sources and have large production volumes, making them excellent raw materials. In recent years, with the continuous growth of livestock and poultry farming, the demand for feed has increased dramatically. In order not to compete with people for food, the use of unconventional feeds has received increasing attention. Biomass polysaccharides are a type of unconventional feed raw material that has received widespread attention. However, biomass polysaccharides have a complex structure, and livestock and poultry lack corresponding polysaccharide hydrolases (lack of livestock and poultry's own hydrolases or low enzyme activity), resulting in low direct edible nutrient utilization and serious waste of biomass polysaccharide nutrients. In recent years, pretreatment of polysaccharide biomass with various polysaccharide hydrolases has been proven to be an effective way to improve the nutrient utilization efficiency of polysaccharide biomass feed. Therefore, the development of highly active polysaccharide hydrolases is the key to replacing conventional grain feed with unconventional biomass feed.

[0003] Polysaccharide hydrolases are a class of enzymes that can hydrolyze the glycosidic bonds of polysaccharide molecules, including amylase, cellulase, xylanase and cellobiase. According to conventional microbial methods, highly active polysaccharide hydrolases are mainly screened from natural strains, but the bacterial resources in nature are limited, and screening suitable strains from nature is time-consuming, labor-intensive and inefficient. In recent years, researchers have begun to use molecular biological methods extensively to perform a large number of mutations on the basis of the original enzyme genes, establish a massive mutant library, and then screen and obtain new enzymes with high activity on this basis. Compared with traditional natural screening methods, this mutation screening method breaks through the limitations of natural resources and has a shorter screening cycle. However, screening strains with high enzyme activity from massive mutant strain libraries also presents huge challenges in terms of workload.

[0004] Researchers have developed a series of high-throughput screening methods for mutant libraries, such as the traditional hydrolysis circle method, the 96-well plate method, the flow cytometry method combined with fluorescence labeling, and the microfluidic chip method. However, the current screening of polysaccharide hydrolase mutant libraries for complex sugar substrates is mainly concentrated in the traditional hydrolysis circle method and the 96-well plate method. These two methods rely on traditional single colony picking and culture techniques, and the workload is still very huge. Therefore, it is necessary to develop a convenient and rapid method for high-throughput screening of polysaccharide hydrolase mutant libraries. Summary of the invention

[0005] In view of the problems existing in the prior art such as the difficulty, time, multiple steps and low throughput in screening polysaccharide hydrolase mutants, the present invention provides a high-throughput screening method for a polysaccharide hydrolase mutant library based on bioelectrochemistry; the present invention realizes rapid labeling of the mutant library, rapid capture of strains with high enzyme activity and high-throughput screening through the steps of cell surface ferrocene modification, co-display expression of polysaccharide hydrolase and glucose dehydrogenase (GDH) on the cell surface, design and modification of a cell capture microfluidic chip and cell capture driven by polysaccharide hydrolysis based on the interaction between reductive ferrocene and cyclodextrin, which helps to greatly improve the screening efficiency of the polysaccharide hydrolase mutant library and has good practicality.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical means.

[0007] The bioelectrochemical-based high-throughput screening method for a polysaccharide hydrolase mutant library of the present invention comprises: co-displaying a polysaccharide hydrolase and a glucose dehydrogenase on the surface of a host cell, then modifying the surface of the co-displayed host cell with ferrocene, and utilizing a microfluidic electrochemical chip with a surface modified with cyclodextrin (β-CD) to react with the reduced ferrocene modified on the surface of the host cell to capture a highly active polysaccharide hydrolase strain, thereby achieving high-throughput separation and screening of highly active strains in the polysaccharide hydrolase mutant library.

[0008] Preferably, the high-throughput separation and screening step comprises:

[0009] (1) The glucose dehydrogenase (GDH) gene was cloned into the pET28a-INP plasmid to obtain the GDH surface-displayed vector pET28a-INP-GDH;

[0010] The polysaccharide hydrolase fragment after any mutation is cloned into the pET28a-INP-GDH vector to obtain the recombinant vector pET28a-INP-GDH-hydrolase, and the recombinant vector is used to transform the host bacteria to obtain the mutant library strain of the polysaccharide hydrolase;

[0011] (2) inducing the mutant library strains of polysaccharide hydrolase to express polysaccharide hydrolase and GDH, and then labeling the mutant library strains of polysaccharide hydrolase with ferrocene and its derivatives to obtain a labeled mutant library strain library;

[0012] (3) performing β-CD array modification on the surface of the microfluidic electrochemical chip to obtain a β-CD array modified microfluidic electrochemical chip for standby use;

[0013] A monodisperse solution of a labeled mutant library strain library is prepared, and then the monodisperse solution and the enzyme reaction solution are respectively passed through a microfluidic electrochemical chip modified with a β-CD array to control the cell flow rate of the mutant library strain, so that the β-CD array on the surface of the microfluidic electrochemical chip captures the high enzyme activity strain with reduced ferrocene on the surface;

[0014] (4) Cleaning the surface of the microfluidic electrochemical chip to rinse away the uncaptured strains, and then controlling the potential of the microfluidic electrochemical chip to release and collect the captured mutant strains with high enzyme activity, so as to screen out mutant strains with high enzyme activity.

[0015] Preferably, in step (1), the host bacteria include Escherichia coli, Saccharomyces, Bacillus, Aspergillus, and Actinomycetes.

[0016] Preferably, in step (2), the labeling step is: using click chemistry to modify the surface of the polysaccharide hydrolase mutant library strain with an activated ester group (NHS), and then selecting ferrocene and its derivatives to couple with the cell surface NHS to obtain a polysaccharide hydrolase mutant library strain whose surface is modified with a ferrocene group.

[0017] Preferably, ferrocene and its derivatives include ferrocene and its derivatives modified with amino, alkynyl, thiol or azide groups, and the labeled ferrocene and its derivatives are oxidized forms or are oxidized to oxidized forms after labeling.

[0018] Preferably, in step (3), the preparation steps of the β-CD array modified microfluidic electrochemical chip are as follows: after the ITO substrate is cleaned, the surface of the ITO electrode is hydroxylated; then it is immersed in a 1% APTES toluene solution to form a surface APTES monolayer, and then rinsed and dried for use. EDC and NHS are added to the carboxymethyl-β-cyclodextrin solution for carboxyl activation, and the pH is adjusted to neutral; the APTES amino-modified ITO is placed in the above solution for reaction for 30 minutes, and after the reaction is completed, the modification is completed by rinsing with water to obtain a β-CD array modified microfluidic electrochemical chip.

[0019] Preferably, in step (3), the substrate of the microfluidic electrochemical chip is glass and its derivative materials that can be modified with β-CD array; the modified β-CD includes β-CD and its derivatives.

[0020] Preferably, in step (3), the enzyme reaction solution comprises: 0.5 g / L starch and 3 mM NAD + PBS solution;

[0021] The final concentration of NAD+ solution in the monodisperse solution of the labeled mutant library strain is 0.3 mM.

[0022] Preferably, in step (3), the cell flow rate of the mutant library strain is controlled such that the number of cells passing through the central flow channel cross section of the chip is less than 200 cells / second.

[0023] Preferably, in step (4), the uncaptured strains include strains with low enzyme activity and strains that do not express enzyme activity;

[0024] The captured mutant strain with high enzyme activity was released by controlling the microfluidic electrochemical chip so that the potential range was greater than 0V and the voltage application time was greater than 10s.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] Compared with the traditional screening of polysaccharide hydrolase mutant library, which requires enzyme activity determination and comparison for each strain one by one in the later stage, which has the problems of long time, many steps and low throughput, the high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry of the present invention utilizes the discharge reduction of glucose generated by polysaccharide hydrolysis under the action of GDH to anchor ferrocene on the cell surface, thereby promoting the high enzyme activity strain to be captured by the electrode modified with β-CD array, and rapidly realizes the high-throughput capture screening of high enzyme activity mutant strains with the help of microfluidic chip and electrochemical cell rapid capture technology, which helps to greatly improve the screening efficiency of polysaccharide hydrolase mutant library.

[0027] The principle of high-throughput screening described in the present invention is: highly active polysaccharide hydrolase and glucose dehydrogenase (GDH) drive polysaccharide hydrolysis and oxidation, and the electrons released to the cell surface can reduce the ferrocene modified with the cell surface to form reduced ferrocene, and the reduced ferrocene can be coupled with β-cyclodextrin (β-CD), so that the cells modified with reduced ferrocene are captured by the β-CD modified substrate, while the oxidized ferrocene has no coupling effect with β-CD. Induce the expression of polysaccharide hydrolase and GDH and modify the cell surface with oxidized ferrocene at the same time, control the modified cells to enter the microfluidic electrochemical chip in a monodisperse state, and control the conditions to achieve the reduction of ferrocene on the cell surface by the high enzyme activity strain driven by the polysaccharide hydrolase; under the condition of no voltage application, the high enzyme activity strain (with reduced ferrocene on the surface) is captured by the β-CD array on the surface of the microfluidic electrochemical chip. By controlling the conditions, strains with low enzyme activity and those that do not express enzyme activity can be washed out of the chip, while strains with high enzyme activity can be captured by the chip substrate; finally, by applying a positive voltage, the connection between β-CD and ferrocene is untied, thereby releasing mutant strains with high enzyme activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a flow chart of the high-throughput screening method for the amylase mutant library in Example 1 of the present invention.

[0029] Figure 2 This is the plasmid map of the plasmid pET28a-INP-GDH-GA constructed in Example 1 of the present invention.

[0030] Figure 3 This is a design diagram of the microfluidic chip used in Examples 1 and 2 of the present invention.

[0031] Figure 4 This is the CV graph of the mutant library strain after ferrocene modification in Example 1 of the present invention.

[0032] Figure 5 This is a comparison chart of the enzyme activity values ​​of 5 mutant strains obtained after five rounds of screening in Example 1 of the present invention.

[0033] Figure 6 This is a comparison chart of the enzyme activity values ​​of 5 mutant strains obtained after five rounds of screening in Example 2 of the present invention. DETAILED DESCRIPTION

[0034] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. Various processes and methods not described in detail are conventional methods known in the art. The sources, trade names and components of the reagents used are indicated when they first appear, and the same reagents used thereafter are the same as those indicated for the first time unless otherwise specified; the reagents, materials, etc. involved are all obtained from commercial channels unless otherwise specified.

[0035] In the following examples, amylase and mannosidase are used as examples to screen the polysaccharide hydrolase mutant library of the present invention, mainly using conventional genetic engineering molecular biology cloning methods and electrochemical methods. These methods are well known to ordinary technicians in the field and will not be described in detail.

[0036] Example 1: High-throughput screening of amylase mutant libraries

[0037] In this example, amylase was selected as the polysaccharide hydrolase and Escherichia coli was used as the host bacteria to screen the polysaccharide hydrolase mutant library. The screening process is as follows: Figure 1 As shown, the specific steps are:

[0038] (1) Construction of amylase mutant library strains:

[0039] The chemically synthesized INP gene fragment (SEQ ID NO.1) was cloned into the pET28a plasmid (purchased from Shanghai Biotech Co., Ltd.) to obtain the E. coli surface display plasmid vector pET28a-INP; the glucose dehydrogenase (GDH, SEQ ID NO.2) gene was cloned into the pET28a-INP plasmid to obtain the GDH surface display vector pET28a-INP-GDH.

[0040] The original target amylase (GA) gene fragment (SEQ ID NO.3) was amplified by error-prone PCR, and a mutation site was introduced at any position in the PCR product to obtain an amylase PCR product fragment of error-prone PCR; the amylase PCR product fragment of error-prone PCR was cloned into the pET28a-INP-GDH plasmid to obtain the GA mutant and GDH co-expression plasmid pET28a-INP-GDH-GA ( Figure 2 ), and then transformed pET28a-INP-GDH-GA into Escherichia coli BL21 strain (purchased from Shanghai Biotechnology Co., Ltd.) to obtain the amylase mutant library strain.

[0041] SEQ ID NO.1:

[0042] ATGAACGATGACAAAGTTTTGGTCTTGCGCACCTGTGCCAATAACATGGCCGATCACTGCGGCCAGATATGGCCTGTTTCCGGTGTTGTCGAATGTAAATATTGGGAACCCACCCG AAAGCTCGAGAATGGGCTGGCCGGGCTGCTATGGGGCAAAGGGGCGAGCACGCATTTGAATATGCAGGCTGACGCCCGGTGGGTTATTTGTGAAGTTGCGGTGAGCGATATCATCTTTCTGGATGCGCAGGGCGGGGTCAAGTTTCCGCGTGCTGAAGTTGTTCACGTCGGCACAAGAAACAGCGCGGCG GGCTATATTTCGGCGAATATTGCCAGTTATGCGTCTTCCACAGTTGCGTTGAATGAAACATTTGTTTTTCCTGAAGTTCGCACAGAAACGAAGGTGGATTTCCCCGCTTCGCCCGCGACCGCTGATAGCACTTTTGATATTGATCGACACGCAACTATTCAAGGCCCACAAACGCTGGAGACAGCGGTG;

[0043] SEQ ID NO.2:

[0044] ATGTATCCGGATTTAAAAGGAAAAGTCGTCGCTATCACAGGAGCTGCTTCAGGATTAGGAAAGGCAATGGCCATTCGCTTCGGCAAGGAGCAGGCGAAAGTGGTCATCAACTATTACAGTAATAAACAGGATCCAAACGAGGTAAAAGAAGAGGTCATCAAGGCGGGCGGTGAAGCCATTGTCGTCCAAGGAGACGTAACGAAAGAGGAAGATGTGAAAAATATCGTTCAAACAGCGATTAAAGAGTTCGGCACACTCGATATTATGATTAATAATGCCGGTCTTGAAAATCCCGTGCCGTCTCATGAAATGCCGCTCAAGGATTGGGAAAAAGTCATCAGCACGAACTTAACGGGCGCCTTTTTAGGAAGCCGTGAAGCGATTAAATATTTTGTTGAAAACGATATAAAAGGAAATGTCATTAATATGTCGAGCGTACATGAAGTGATTCCGTGGCCATTATTTGTTCACTATGCGGCAAGTAAAGGCGGAATCAAGCTGATGACGGAAACATTGGCATTGGAATATGCGCCGAAAGGCATTCGTGTCAACAATATCGGGCCAGGCGCGATCAACACGCCAATCAATGCTGAAAAATTTGCTGATCCTAAGCAGAGAGCAGATGTAGAAAGCATGATTCCGATGGGATATATCGGTGAACCGGAGGAAATTGCGGCAGTGGCAGCCTGGCTTGCTTCGAAGGAAGCCAGCTACGTCACAGGCATTACGTTATTCGCGGACGGCGGTATGACACAATACCCTTCATTCCAGGCAGGCCGCGGTTAA;

[0045] SEQ ID NO.3:

[0046]

[0047] (2) Induced expression and surface modification of amylase mutant library strains:

[0048] The amylase mutant library strain was directly cultured in LB medium (kanamycin 50 μg / mL) for 2.5 hours until the bacterial concentration OD600 was greater than 0.8, and then 0.5 mM IPTG solution was added thereto and induced at 20°C for 10-20 hours to simultaneously induce the expression of GA and GDH enzymes.

[0049] The surface of the amylase mutant library strain after induced expression was modified with activated ester groups (NHS) by click chemistry, and then aminoferrocene was selected to couple with the cell surface NHS to obtain the amylase mutant library strain with ferrocene groups modified on the surface. The specific steps are as follows:

[0050] The amylase mutant library strain obtained by induction culture was washed with PBS buffer, and the OD was controlled to be 10, and the volume was 1 mL; 0.2 mM NHS-N3 was added to react in PBS containing 10% DMSO for 30-60 minutes, and after the reaction was completed, it was washed with PBS and PBS buffer with 10% DMSO respectively, and the surface of the modified amylase mutant library strain contained azide; 0.2 mM NHS-DBCO was added to the azide-modified amylase mutant library strain, and it was reacted in PBS containing 10% DMSO for 30-60 minutes; after the reaction was completed, it was washed with PBS and PBS buffer with 10% DMSO respectively, and the azide reacted with DBCO to modify NHS on the strain surface.

[0051] Add 1mM aminoferrocene to the NHS-modified strain and react in PBS containing 10% DMSO for 30 minutes. After the reaction is completed, wash with PBS containing 10% DMSO and PBS buffer respectively. NHS reacts with amino groups to modify the cell surface with ferrocene. Finally, fix the bacterial sludge on the glassy carbon electrode with Nafion and scan and verify with DPV ( Figure 4 ), Figure 4 The results showed that the cells were successfully modified with ferrocene.

[0052] Dilute the ferrocene-modified mutant library with PBS to 10 5 cells / mL concentration, and pure oxygen was introduced for 10 minutes to fully oxidize ferrocene to obtain a monodisperse solution of the mutant library strain for later use.

[0053] (3) Preparation and surface modification of ITO microfluidic electrochemical chip:

[0054] Using ITO glass as substrate and PDMS substrate, according to Figure 3The microfluidic electrochemical chip is processed and prepared according to the design diagram shown in the figure. The microfluidic electrochemical chip uses ITO as a working electrode, and Ag / AgCl microwires are added above the PDMS in the middle of the microchannel as a reference electrode and a counter electrode. The surface β-CD array is modified on the ITO substrate of the microchannel of the microfluidic electrochemical chip. The β-CD array modification steps are as follows:

[0055] First, the microfluidic ITO substrate was cleaned with acetone, ethanol and water for 5 minutes respectively; the ITO electrode surface was hydroxylated by immersion at 85°C for 30 minutes in a solution of 28% ammonia water / 30% hydrogen peroxide / water with a volume ratio of 1:1:6; the microfluidic ITO substrate was immersed in a toluene solution containing 1% APTES, and an APTES monolayer was formed on the surface after reaction at 37°C for 30 minutes, and then the substrate was rinsed and dried; 1.92 mg of EDC and 2.87 mg of NHS were added to a 10 mM carboxymethyl-β-cyclodextrin solution for carboxyl activation, and the pH was adjusted to 7.4 with sodium hydroxide after 5 minutes; the APTES amino-modified ITO was placed in the above solution for reaction for 30 minutes, and after the reaction was completed, the modification was completed by rinsing with water to obtain a β-CD array-modified microfluidic electrochemical chip for use.

[0056] (4) Microfluidic electrochemical capture and screening:

[0057] The β-CD array modified microfluidic electrochemical chip is connected to a microfluidic control system, an electrochemical workstation, and an inverted microscope. The monodisperse solution of the mutant library strain in step (2) or the bacterial solution (10 5 cells / mL, PBS solution), and the enzyme reaction solution (starch 0.5 g / L, NAD + (3 mM) dissolved in PBS solution).

[0058] Using a microscope to observe the cell flow rate, the flow rate was first controlled at 10 cells / second (AB pump flow rate was about 0.1μL / s). Without applying a potential, the mutant library strain labeled with ferrocene drove the reduction of ferrocene on the cell surface under the condition of starch hydrolysis, and further coupled the reduced ferrocene with the β-CD array of the ITO electrode substrate, thereby achieving the coupling capture of high enzyme activity cells with the ITO substrate. After the first round of microfluidic reaction capture, the microchannel was washed with PBS for 10 minutes to wash away unstable or free cells; then a 0.6V (vs Ag / AgCl) potential was applied to the ITO electrode, and the potential was maintained for 10 minutes until all captured cells were released under microscope observation; the released cells were collected into a centrifuge tube and the next round of capture screening was carried out. The AB liquid flow rate was gradually increased in each subsequent round, by 0.1μL / s per round, and the amount of cells finally captured was observed at the same time.

[0059] In this example, five rounds of repeated screening were performed, and the cell culture obtained by multiple rounds of capture and release was diluted and plated, and a single cell clone was obtained by overnight culture at 37°C. The single clone was picked into a fresh LB liquid culture medium (containing 50 μg / mL of kanamycin), and the shake flask culture was cultured for about 2.5 hours until the bacterial concentration OD600 was greater than 0.8, and a 0.5 mM IPTG solution was added, the induction temperature was 20°C, the induction time was 20 hours, and the expression of GA and GDH enzymes was induced at the same time.

[0060] The induced cells were collected by centrifugation, and the cells were broken by ultrasound to separate the crude enzyme solution. On the one hand, the protein content of the crude enzyme solution was determined; on the other hand, starch substrate was added to the PBS solution, and the consumption rate of the starch substrate was monitored to calculate and obtain the enzymatic activity of the amylase.

[0061] After 5 rounds of screening, 20 monoclonal cells were obtained on the plate. The enzyme activities of all strains were significantly improved compared with the original strains. The enzyme activities of 5 monoclonal cells were compared with the original strains. The results are as follows: Figure 5 shown.

[0062] from Figure 5 It can be seen that strain 4 has the highest amylase activity, which is 6.3 times that of the original starting strain. This shows that, apart from the construction of the mutant library, cell culture induction and analysis of the enzyme activity characteristics of the mutant strains that are unavoidable in all methods, this method can complete the screening of a cell mutant library with a capacity of 100,000 mutants within 8 hours, and finally obtain mutant strains with high enzyme activity.

[0063] Example 2: High-throughput screening of a mannosidase mutant library

[0064] In this example, mannosidase (SEQ ID NO.4) was selected as the polysaccharide hydrolase and Escherichia coli was used as the host bacteria to screen the polysaccharide hydrolase mutant library. The screening process was basically the same as that in Example 1, except that mannosidase was used to replace amylase.

[0065] SEQ ID NO.4:

[0066] ATGAAAGCATTACATTTTGGCGCAGGTAATATCGGTCGTGGCTTTATCGGTAAACTGCTGGCAGACGCGGGTATCCAACTGACGTTTGCCGATGTCAATCAGGTGGTACTTGATGCCCTGAATGCCCGTCATAGCTATCAGGTACATGTGGTTGGTGAAACCGAGCAGGTAGATACCGTTTCCGGCGTCAATGCTGTCAGCAGCATTGGTGATGATGTCGTTGATCTGATTGCTCAGGTTGATTTAGTCACTACCGCCGTTGGCCCGGTTGTGCTGGAACGTATTGCTCCGGCAATCGCCAAAGGGCAGGTGAAACGTAAAGAACAAGGTAATGAATCCCCGCTGAACATCATCGCCTGTGAAAACATGGTACGCGGTACCACGCAGCTGAAAGGCCATGTGATGAACGCCCT;

[0067] After 5 rounds of screening from steps (1) to (4), the cell fluid released by the chip is further separated into single cells directly into a test tube containing LB liquid culture medium (containing 50 μg / mL of kanamycin) using a universal microfluidic single-cell separation chip. The single-cell culture fluid is then cultured and the enzyme expression is induced. The induced cells are collected by centrifugation, and the cells are broken by ultrasonication to separate and obtain the crude enzyme solution of the cells. On the one hand, the protein content of the crude enzyme solution is determined; on the other hand, the mannose substrate is added to the PBS solution, and the enzyme activity of the mannosidase is calculated and obtained by monitoring the consumption rate of the mannose substrate.

[0068] After 5 rounds of screening, 16 monoclonal cells were obtained on the plate. The enzyme activities of all strains after screening were greatly improved compared with the original strains. The enzyme activities of 5 monoclonal cells were compared with the original strains. The comparison results are as follows: Figure 6 shown.

[0069] from Figure 6 It can be seen that the enzyme activity of strain 3 is the highest, which is 12.1 times that of the original starting strain. This result shows that a mutant strain with high enzyme activity is obtained by rapid screening through the high-throughput screening method of the present invention.

[0070] In summary, the present invention realizes rapid labeling of mutant libraries, rapid capture of strains with high enzyme activity, and high-throughput screening through the steps of cell surface ferrocene modification, co-display expression of polysaccharide hydrolase and glucose dehydrogenase (GDH) on the cell surface, design and modification of cell capture microfluidic chip, and polysaccharide hydrolysis-driven cell capture based on the interaction of reduced ferrocene and cyclodextrin, which helps to greatly improve the screening efficiency of polysaccharide hydrolase mutant library and has good practicality.

[0071] The embodiments are preferred implementations of the present invention, but the present invention is not limited to the above-mentioned implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. A high-throughput screening method for polysaccharide hydrolase mutant library based on bioelectrochemistry, characterized in that: The polysaccharide hydrolase mutant library high-throughput screening method comprises: Polysaccharide hydrolase and glucose dehydrogenase are co-displayed on the surface of host cells, and then ferrocene is modified on the surface of the co-displayed host cells. The microfluidic electrochemical chip with surface modified cyclodextrin (β-CD) is used to interact with the reduced ferrocene modified on the surface of the host cells to capture the highly active polysaccharide hydrolase strains, thereby achieving high-throughput separation and screening of highly active strains in the polysaccharide hydrolase mutant library.

2. The high-throughput screening method for polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 1, characterized in that: The steps of the high-throughput screening method for the polysaccharide hydrolase mutant library are as follows: (1) The glucose dehydrogenase GDH gene was cloned into the pET28a-INP plasmid to obtain the GDH surface-displayed vector pET28a-INP-GDH; The polysaccharide hydrolase fragment after any mutation is cloned into the pET28a-INP-GDH vector to obtain the recombinant vector pET28a-INP-GDH-hydrolase, and the recombinant vector is used to transform the host bacteria to obtain the mutant library strain of the polysaccharide hydrolase; (2) inducing the mutant library strains of polysaccharide hydrolase to express polysaccharide hydrolase and GDH, and then labeling the mutant library strains of polysaccharide hydrolase with ferrocene and its derivatives to obtain a labeled mutant library strain library; (3) performing β-CD array modification on the surface of the microfluidic electrochemical chip to obtain a β-CD array modified microfluidic electrochemical chip for standby use; A monodisperse solution of a labeled mutant library strain library is prepared, and then the monodisperse solution and the enzyme reaction solution are respectively passed through a microfluidic electrochemical chip modified with a β-CD array to control the cell flow rate of the mutant library strain, so that the β-CD array on the surface of the microfluidic electrochemical chip captures the high enzyme activity strain with reduced ferrocene on the surface; (4) Cleaning the surface of the microfluidic electrochemical chip to rinse away the uncaptured strains, and then controlling the potential of the microfluidic electrochemical chip to release and collect the captured mutant strains with high enzyme activity, so as to screen out mutant strains with high enzyme activity.

3. The high-throughput screening method for polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (1), the host bacteria include Escherichia coli, Saccharomyces, Bacillus, Aspergillus, and Actinomycetes.

4. The high-throughput screening method for polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (2), the labeling step is: using click chemistry to modify the surface of the polysaccharide hydrolase mutant library strain with an activated ester group (NHS), and then selecting ferrocene and its derivatives to couple with the cell surface NHS to obtain a polysaccharide hydrolase mutant library strain with a surface modified with a ferrocene group.

5. The method for high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: Ferrocene and its derivatives include ferrocene and its derivatives modified with amino, alkynyl, thiol and azide groups. The labeled ferrocene and its derivatives are oxidized forms or are oxidized to oxidized forms after being labeled.

6. The method for high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (3), the preparation steps of the β-CD array modified microfluidic electrochemical chip are as follows: after the ITO substrate is cleaned, the surface of the ITO electrode is hydroxylated; then it is immersed in a 1% APTES toluene solution to form a surface APTES monolayer, and then rinsed and dried for use. EDC and NHS are added to the carboxymethyl-β-cyclodextrin solution for carboxyl activation, and the pH is adjusted to neutral; the APTES amino-modified ITO is placed in the above solution for reaction for 30 minutes, and after the reaction is completed, the modification is completed by rinsing with water to obtain a β-CD array modified microfluidic electrochemical chip.

7. The method for high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (3), the substrate of the microfluidic electrochemical chip is glass and its derivative materials that can be modified with β-CD array; the modified β-CD includes β-CD and its derivatives.

8. The method for high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (3), the enzyme reaction solution includes: 0.5 g / L starch and 3 mM NAD + PBS solution; the final concentration of NAD+ solution in the monodisperse solution of the labeled mutant library strain is 0.3mM.

9. The method for high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (3), the cell flow rate of the mutant library strain is controlled so that the number of cells passing through the central flow channel section of the chip is less than 200 cells / second.

10. The method for high-throughput screening of polysaccharide hydrolase mutant library based on bioelectrochemistry according to claim 2, characterized in that: In step (4), the uncaptured strains include strains with low enzyme activity and strains that do not express enzyme activity; The captured mutant strain with high enzyme activity was released by controlling the microfluidic electrochemical chip so that the potential range was greater than 0V and the voltage application time was greater than 10s.

Images