Lipid compounds for nucleic acid delivery and related applications and medicaments comprising said lipid compounds

Abstract

The invention relates to a lipid compound for nucleic acid delivery, and related applications and drugs containing the lipid compound. Relates to the use of a lipid compound comprising one or more compounds having the following formula (I) for the preparation of a product for nucleic acid delivery, to a pharmaceutical composition comprising said lipid compound and a nucleic acid molecule and to the use of said pharmaceutical composition. # imgabs0 #

Description

Lipid compound for nucleic acid delivery and related applications and medicines containing the lipid compound Technical Field

[0001] The present application relates to artificially synthesized lipids capable of promoting nucleic acid delivery, and a specific combination of artificially synthesized lipids and nucleic acids capable of promoting nucleic acid delivery to target cells and target organs. Background Art

[0002] Over the past few decades, the concept of using nucleic acid molecules, including RNA, as therapeutic agents has progressed from concept to clinical reality. Nucleic acid molecules possess numerous properties that make them promising therapeutic agents. They can fold into complex conformations that allow them to bind to proteins, small molecules, or other nucleic acids, and some can even form catalytic centers. Often, siRNA, miRNA, and other small non-coding RNAs are collectively referred to as small nucleic acids or small RNAs (sRNAs). However, due to their susceptibility to degradation and short half-lives in vivo, nucleic acid molecules are generally considered a poor choice as therapeutic agents.

[0003] Therefore, how to effectively deliver nucleic acid molecules, including small RNAs, to cells and target organs in the body to achieve their biological activity and therapeutic or preventive effects is an issue that those skilled in the art need to consider.

[0004] Summary of the Invention

[0005] The present invention is based in part on the inventors' discovery of the delivery capabilities of a range of sphingosine lipids. The inventors unexpectedly discovered that combinations of sphingosine lipids within a certain carbon number range and nucleic acids, or combinations of sphingosine within a certain carbon number range and a helper lipid with nucleic acids, can effectively deliver nucleic acids into cells and into target organs.

[0006] In a first aspect, the present invention provides a use of a lipid composition in the preparation of a product / agent for delivering nucleic acids, the lipid composition comprising one or more compounds having the following formula (I):

[0007] in,

[0008] A is selected from the linear C 10-34 Alkyl and linear C 10-34 alkenyl;

[0009] Q is -OH.

[0010] In a specific embodiment, the present invention provides the use of a lipid composition in the preparation of a product / agent for delivering nucleic acids, wherein the lipid composition comprises one or more compounds having the following formula (I):

[0011] in,

[0012] A is selected from the linear C 10-32 Alkyl and linear C 10-32 alkenyl;

[0013] Q is -OH.

[0014] In a specific embodiment, the present invention provides the use of a lipid composition in the preparation of a product / agent for delivering nucleic acids, wherein the lipid composition comprises one or more compounds having the following formula (I):

[0015] in,

[0016] A is selected from the linear C 11-31 Alkyl and linear C 11-31 alkenyl;

[0017] Q is -OH.

[0018] In a specific embodiment, the present invention provides the use of a lipid composition in the preparation of a product / agent for nucleic acid delivery, wherein the lipid composition comprises one or more compounds having formula (I):

[0019] in,

[0020] A is selected from the linear C 21-34 Alkyl or linear C 21-34 alkenyl;

[0021] Q is -OH.

[0022] Preferably, the A of the present invention is selected from linear C 21-32 Alkyl and linear C 25-32 More preferably, the A is selected from a linear C 25-30 Alkyl and linear C 25-30 Alkenyl.

[0023] In a specific embodiment, the product / agent for nucleic acid delivery provided by the present invention delivers nucleic acid to a subject, preferably, the agent is used to deliver nucleic acid to a subject by oral, intramuscular, intravenous, subcutaneous, transdermal, intraarterial, intraperitoneal, intrapulmonary, intracerebrospinal, intraarticular, intrasynovial, intrathecal, intraventricular, and / or inhalation route.

[0024] In a specific embodiment, the product / reagent for nucleic acid delivery provided by the present invention delivers nucleic acid to cells in vitro, preferably, delivers nucleic acid to cells in vitro by direct contact.

[0025] In a specific embodiment, the lipid composition provided by the present invention can be used to deliver small RNA molecules, preferably, the small RNA molecules are small RNA molecules with a length of 14-32 nucleotides, preferably, the nucleic acid molecules are small RNA molecules with a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides.

[0026] In another aspect, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0027] in,

[0028] A is selected from the linear C 10-34 Alkyl or linear C 10-34 alkenyl;

[0029] Q is -OH.

[0030] In a specific embodiment, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0031] in,

[0032] A is selected from the linear C 10-32 Alkyl or linear C 10-32 alkenyl;

[0033] Q is -OH.

[0034] In a specific embodiment, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0035] in,

[0036] A is selected from the linear C 11-31 Alkyl or linear C 11-31 alkenyl;

[0037] Q is -OH.

[0038] In a specific embodiment, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0039] in,

[0040] A is selected from the linear C 21-34 Alkyl or linear C 21-34 alkenyl;

[0041] Q is -OH.

[0042] Preferably, the A of the present invention is selected from linear C 21-32 Alkyl and linear C 25-32 More preferably, the A is selected from a linear C 25-30 Alkyl and linear C 25-30 Alkenyl.

[0043] In a specific embodiment, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably, the RNA molecule is a small RNA molecule, preferably, it is a small RNA molecule with a length of 14-32 nucleotides, preferably, it is a small RNA molecule with a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides.

[0044] In another aspect, the present invention provides a method for preparing the pharmaceutical composition of the present invention as described above, the method comprising the step of mixing the lipid composition with a nucleic acid molecule.

[0045] In another aspect, the present invention provides a use of the pharmaceutical composition described herein in the preparation of a medicament for treating a disease in a subject, preferably, the medicament is administered to the subject orally, intramuscularly, intravenously, subcutaneously, transdermally, intraarterially, intraperitoneally, intrapulmonary, intracerebrospinal, intraarticularly, intrasynovially, intrathecally, intraventricularly, and / or by inhalation.

[0046] In another aspect, the present invention provides a compound as shown in formula (I):

[0047] in,

[0048] The A is selected from the group consisting of linear C 10-34 Alkyl and linear C 10-34 alkenyl;

[0049] Q is -OH.

[0050] In a specific embodiment, the present invention provides a compound as shown in formula (I):

[0051] in,

[0052] The A is selected from the group consisting of linear C 10-32 Alkyl and linear C 10-32 alkenyl;

[0053] Q is -OH.

[0054] In a specific embodiment, the present invention provides a compound as shown in formula (I):

[0055] in,

[0056] The A is selected from the group consisting of linear C 11-31 Alkyl and linear C 11-31 alkenyl;

[0057] Q is -OH.

[0058] In another aspect, the present invention provides a composition for in vitro transfection of cells, comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0059] in,

[0060] A is selected from the linear C 10-34 Alkyl or linear C 10-34 Alkenyl, preferably a straight chain C 10-32 Alkyl or linear C 10-32 alkenyl;

[0061] Q is -OH.

[0062] Preferably, the A of the present invention is selected from linear C 21-32 Alkyl and linear C 25-32 More preferably, the A is selected from a linear C 25-30 Alkyl and linear C 25-30 Alkenyl.

[0063] Specifically, the lipid composition comprises one or more compounds shown in Table 1.

[0064] In a specific embodiment, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably, the RNA molecule is a small RNA molecule, preferably, it is a small RNA molecule of 14-32 nucleotides in length, preferably, it is a small RNA molecule of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides in length;

[0065] Exemplarily, the small RNA molecule of the present invention is selected from the small RNA molecule PGY-ssRNA-26.

[0066] In a specific embodiment, the present invention provides a compound as shown in formula (I):

[0067] in,

[0068] A is selected from the linear C 21-34 Alkyl and linear C 21-34 Preferably, the A is selected from a linear C 21-32 Alkyl and linear C 25-32 More preferably, the A is selected from a linear C 25-30 Alkyl and linear C 25-30 alkenyl;

[0069] Q is -OH,

[0070] Preferably, the compound is a compound shown in Table 1.

[0071] In one embodiment of the present invention, the present invention provides a kind of package combination, it includes the compound shown in formula (I) as herein described, or lipid composition, or product / reagent for nucleic acid delivery, or pharmaceutical composition, and nucleic acid, wherein the compound shown in the formula (I), or lipid composition, or reagent for nucleic acid delivery, or pharmaceutical composition and nucleic acid are each independently provided in a first container and a second container, and the first container and the second container are identical or different. Preferably, the package combination contains any one or more of the above-mentioned compounds, preferably any one or more compounds selected from Table 1.

[0072] In one embodiment of the present invention, the present invention provides a method for nucleic acid delivery, which comprises administering to a subject a compound of formula (I), or a lipid composition, or a product / agent for nucleic acid delivery, or a pharmaceutical composition as described herein.

[0073] In one embodiment of the present invention, the present invention provides a method for treating a disease in a subject, comprising administering to the subject a compound of formula (I), or a lipid composition, or a product / agent for nucleic acid delivery, or a pharmaceutical composition as described herein.

[0074] In specific embodiments, the diseases include cancer, inflammation, fibrotic diseases, autoimmune diseases, infections, congenital and inherited diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases, and hematological diseases.

[0075] In specific embodiments, the cancer is selected from lung cancer, prostate cancer, breast cancer, head and neck cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, liver cancer, melanoma, kidney cancer, squamous cell carcinoma, or a hematological cancer.

[0076] In specific embodiments, the drug is administered to the subject orally, intramuscularly, intravenously, subcutaneously, transdermally, intraarterially, intraperitoneally, intrapulmonary, intracerebrospinal, intraarticularly, intrasynovially, intrathecally, intraventricularly, and / or by inhalation.

[0077] In another aspect, the present invention provides a method for preparing a compound as shown in formula (I), wherein the method is selected from any one of the following:

[0078] Method a.

[0079] Step a1. reacting the compound represented by Formula 1 with an olefin to produce the compound represented by Formula 2;

[0080] Step a2. converting the compound represented by formula 2 into a compound represented by formula (I) wherein A is a linear alkenyl group;

[0081] Optional step a3. Reducing the compound represented by formula (I) in which A is a linear alkenyl group to obtain the compound represented by formula (I) in which A is a linear alkyl group;

[0082] Among them, n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32.

[0083] Preferably, n=9, 10, 14, 16, 18, 19, 24.

[0084] In one embodiment, step a1 is carried out under the catalysis of benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium and tricyclohexylphosphine.

[0085] Preferably, the reaction conditions of step a1 are Grubbs 2 nd ,DCM,40℃.

[0086] In one embodiment, step a2 is performed in the presence of TFA.

[0087] Preferably, the reaction conditions of step a2 are TFA, ACN, H2O, and 80°C.

[0088] In one embodiment, step a3 is hydrogenation reduction, preferably palladium-carbon-catalyzed hydrogenation reduction.

[0089] Preferably, the reaction conditions of step a3 are Pd / C, H2, MeOH / THF, 50°C.

[0090] Method b.

[0091] Step b1. reacting the compound represented by Formula 1 with an olefin to produce the compound represented by Formula 2;

[0092] Step b2-1. The compound represented by Formula 2 is reduced to obtain a compound represented by Formula 3;

[0093] Step b3. converting the compound represented by formula 3 into a compound represented by formula (I) wherein A is a linear alkyl group;

[0094] or

[0095] Step b2-2. The compound represented by Formula 2 is converted into a compound represented by Formula (I) wherein A is a linear alkenyl group;

[0096] Among them, n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32.

[0097] Preferably, n=20, 21, 22, 23, 25, 26, 27, 28, 29, 30, 31.

[0098] In one embodiment, step b1 is the same as step a1.

[0099] In one embodiment, step b2-1 is hydrogenation reduction, preferably palladium-carbon-catalyzed hydrogenation reduction.

[0100] Preferably, the reaction conditions of step b2-1 are Pd / C, H2, MeOH / THF, 50°C.

[0101] In one embodiment, step b3 is performed in the presence of TFA.

[0102] Preferably, the reaction conditions of step b3 are TFA, ACN, H2O, and 80°C.

[0103] In one embodiment, step 2-2 is performed in the presence of TFA.

[0104] Preferably, the reaction conditions of step b3 are TFA, ACN, H2O, and 80°C.

[0105] Method c.

[0106] Preferably, step c further comprises:

[0107] Preferably, step c further comprises: BRIEF DESCRIPTION OF THE DRAWINGS

[0108] FIG1 shows the results of in vitro small nucleic acid delivery in HPAC cells.

[0109] FIG2 shows the results of in vitro small nucleic acid delivery in H460 cells.

[0110] FIG3 shows the results of in vitro small nucleic acid delivery in 293T cells. DETAILED DESCRIPTION

[0111] To further illustrate the present invention, this specification provides the following specific embodiments, which are illustrated in conjunction with the accompanying drawings. However, the embodiments disclosed herein are not limited thereto. Those skilled in the art may, in combination with common knowledge in the art, make appropriate modifications to the methods, uses, and small RNAs of the present invention. As long as such modifications can achieve the functions described herein, they are considered to fall within the scope of the present invention.

[0112] As used herein, unless otherwise defined, technical or scientific terms used herein have the same meanings as commonly understood by one skilled in the art.

[0113] In a specific embodiment of the present invention, the present invention provides the use of a lipid composition in the preparation of an agent for nucleic acid delivery, wherein the lipid composition comprises one or more compounds having formula (I):

[0114] Wherein, A is selected from a straight chain C 10-32 Alkyl and linear C 10-32 alkenyl; optionally, A is a straight chain alkyl group comprising 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms, or a straight chain alkenyl group comprising 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, or 32 carbon atoms;

[0115] Q is -OH.

[0116] In a specific embodiment, the present invention provides the use of a lipid composition in the preparation of an agent for nucleic acid delivery, the lipid composition comprising one or more compounds having formula (I):

[0117] in,

[0118] A is selected from the linear C 21-34Alkyl or linear C 21-34 alkenyl; optionally, A is a straight chain alkyl group comprising 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms, or a straight chain alkenyl group comprising 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms;

[0119] Q is -OH.

[0120] In a specific embodiment, the lipid composition provided by the present invention may include one or more compounds of formula (I) provided herein or a salt thereof, a hydrate or a solvate thereof; it may also include other lipid compounds other than one or more compounds provided herein. The other lipid compounds may be, for example, neutral lipids, charged lipids, steroids and polymer-conjugated lipids. "Neutral lipids" refer to lipid compounds that exist in an uncharged form or a neutral zwitterionic form at a selected pH value (e.g., physiological pH value). "Charged lipids" refer to lipid compounds that exist in a positively charged or negatively charged form, without being limited by a pH value within a useful physiological range (e.g., pH about 3 to about 9).

[0121] In certain embodiments, the lipid composition may further comprise one or more solvents, which can be mixed with the compound provided herein or its salt, hydrate or solvate to form a homogeneous mixture.

[0122] In the described lipid composition, can also comprise organic solvent or solvent mixture, for example chloroform, methylene chloride, diethyl ether, cyclohexane, cyclopentane, benzene, toluene, methanol or other aliphatic alcohol, for example ethanol, propyl alcohol, isopropyl alcohol, butanol, the tert-butyl alcohol, isobutyl alcohol, amyl alcohol and hexanol.These solvents can be individually, mixedly and / or optionally together with suitable buffer as the solvent in lipid composition.The selection of solvent can consider the polarity of solvent usually, removes the difficulty degree of solvent in the later stage formed in lipid nucleic acid mixture, and / or pharmaceutically acceptable property. In some embodiments, the solvent is nontoxic, or pharmaceutically acceptable. Exemplary pharmaceutically acceptable solvent comprises lower alcohol (1-6 carbon atom), for example methyl alcohol, ethanol, n-propyl alcohol, isopropyl alcohol and n-butyl alcohol. In some embodiments, can use appropriate solvent, so that nucleic acid and lipid can form clarifying single-phase mixture.

[0123] In specific embodiments, the lipid compositions provided herein comprise two or more compounds of formula (I).

[0124] In one embodiment of the present invention, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0125] Wherein, A is selected from a straight chain C 10-32 Alkyl and linear C 10-32 alkenyl; optionally, A is a straight chain alkyl group comprising 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms, or a straight chain alkenyl group comprising 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, or 32 carbon atoms;

[0126] Q is -OH;

[0127] Preferably, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably, it is a small RNA molecule, preferably, it is a small RNA molecule with a length of 14-32 nucleotides, preferably, it is a small RNA molecule with a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides.

[0128] In a specific embodiment, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds having formula (I):

[0129] in,

[0130] A is selected from the linear C 21-34 Alkyl or linear C 21-34 alkenyl;

[0131] Q is -OH;

[0132] Preferably, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably, it is a small RNA molecule, preferably, it is a small RNA molecule with a length of 14-32 nucleotides, preferably, it is a small RNA molecule with a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides.

[0133] In an embodiment of the pharmaceutical composition provided herein, the mass ratio of the lipid composition to the nucleic acid molecule is 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5:1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1, or a range between any of the above ratios.

[0134] In an embodiment of the pharmaceutical composition provided by the present invention, the mass ratio of the lipid composition to the nucleic acid molecule is 1:100, 1:30, 1:10, 1:3, 1:1, 3:1, 10:1, 30:1, 100:1, or a range between any of the above ratios.

[0135] In a specific embodiment, the nucleic acid molecule is an RNA molecule or a DNA molecule for treatment; preferably, the nucleic acid molecule is used to treat a disease by targeting a specific target; optionally, the nucleic acid molecule can be used to treat cancer, inflammation, fibrotic diseases, autoimmune diseases, infections, congenital and hereditary diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases and blood system diseases.

[0136] In specific embodiments, the cancer is selected from lung cancer, prostate cancer, breast cancer, head and neck cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, liver cancer, melanoma, kidney cancer, squamous cell carcinoma, or a hematological cancer.

[0137] In a specific embodiment, the present invention provides a method for preparing a pharmaceutical composition of the present invention, said method comprising the step of mixing said lipid composition with a nucleic acid molecule.

[0138] In a specific embodiment, the method for preparing the pharmaceutical composition of the present invention comprises:

[0139] 1) a step of mixing the lipid composition with a nucleic acid molecule; and

[0140] 2) At 25°C to 150°C,

[0141] Preferably, at 25°C, 30°C, 35°C, 36°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 110°C, 120°C, 130°C, 140°C or 150°C,

[0142] or any range between these points, heating the mixture obtained in step 1) for at least 5 minutes, for example, for 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 minutes.

[0143] the term

[0144] As used herein, the term "nucleic acid" includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally refers to a DNA or RNA polymer that can be single-stranded or double-stranded, synthetic, or obtained (e.g., isolated and / or purified) from a natural source; it can contain natural, non-natural, or altered nucleotides. In some embodiments, the nucleic acid does not contain any insertions, deletions, inversions, and / or substitutions. However, as discussed herein, in some cases it may be appropriate for the nucleic acid to contain one or more insertions, deletions, inversions, and / or substitutions.

[0145] As used herein, the term "vector" refers to a recombinant expression vector that incorporates a nucleic acid described herein. The recombinant expression vector can be any suitable recombinant expression vector and can be used to transform or transfect any suitable host cell, including but not limited to plant expression vectors, animal expression vectors, viral vectors, such as retroviral vectors or lentiviral vectors. These vectors are well known to those skilled in the art and are commercially available.

[0146] The term "host cell" as used herein refers to any type of cell that can be transfected with the recombinant expression vector of the present invention. The host cell can be a eukaryotic cell, such as a plant, animal, fungus or algae, or a prokaryotic cell, such as a bacterium or protozoa.

[0147] A variety of transfection techniques are known in the art and include, but are not limited to, calcium phosphate co-precipitation, direct microinjection into cultured cells, electroporation, liposome-mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-speed microprojectiles.

[0148] As used herein, the term "C i-j " represents a range of carbon atoms, wherein i and j are integers and j is greater than i, and the range of carbon atoms includes the endpoints (i.e., i and j) and every integer point between the endpoints. For example, C 21-34 represents a range of 21 to 34 carbon atoms, including 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0149] The term "alkyl" as used herein refers to a saturated straight or branched chain hydrocarbon group. i-j "Alkyl" refers to a straight chain alkyl group having from i to j carbon atoms. In some embodiments, the alkyl group comprises from 21 to 34 carbon atoms. In some embodiments, the alkyl group comprises 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0150] In some embodiments, the alkyl group comprises 10 to 34 carbon atoms, preferably 10 to 32 carbon atoms. In some embodiments, the alkyl group comprises 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, 34 carbon atoms.

[0151] As used herein, the term "alkenyl" refers to a straight or branched chain hydrocarbon group having at least one carbon-carbon double bond, which may be optionally substituted independently with one or more substituents described herein, and includes groups having "cis" and "trans" orientations, or "E" and "Z" orientations. In some embodiments, the alkenyl group contains 21 to 34 carbon atoms. In some embodiments, the alkenyl group contains 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0152] In some embodiments, the alkenyl group contains 10 to 34 carbon atoms, preferably 10 to 32 carbon atoms. In some embodiments, the alkyl group contains 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0153] In some embodiments, the alkenyl group contains more than one carbon-carbon double bond. It should be understood that in the case where the alkenyl group contains more than one carbon-carbon double bond, the double bonds can be separated or conjugated with each other. In some embodiments, the alkenyl group is an α-alkenyl group.

[0154] As used herein, term "delivery" encompasses both local and systemic delivery. "Local delivery" refers to that the therapeutic agent (such as nucleic acid) to be delivered is directly delivered to the target site in vivo. For example, reagent can be delivered locally by being directly injected into the target site (such as disease site, as tumor or inflammation site) or target organ (such as heart, spleen, lung, kidney etc.). "Systemic delivery" refers to causing the delivery of therapeutic agent (such as nucleic acid) in vivo extensive biodistribution, thereby making the therapeutic agent of effective dose exposed to most positions of health. In order to obtain widespread biodistribution, such blood lifespan is usually required so that these therapeutic agents are not rapidly degraded or removed before arriving at the target site away from the administration site. The systemic delivery of lipid composition can be any suitable mode, including, for example, oral, suction, in the digestive tract, intravenously, subcutaneously and intraperitoneally carried out.

[0155] As used herein, the term "lipid" refers to a class of organic compounds that include, but are not limited to, esters of fatty acids and are characterized by being insoluble in water (e.g., having a solubility in water of less than about 0.01% by weight) but soluble in many organic solvents. Lipids can be, for example, simple lipids (e.g., fats, oils, waxes), compound lipids (e.g., phospholipids, glycolipids), and derivatized lipids (e.g., steroids).

[0156] As used herein, "treating" includes treating a disease state in a mammal, particularly a human, and includes: (a) inhibiting the disease state, ie, arresting its development; and / or (b) alleviating the disease state, ie, causing regression of the disease state.

[0157] As used herein, the term "subject" refers to any human or non-human organism that may potentially benefit from treatment with a nucleic acid molecule comprised in a pharmaceutical composition of the present invention. Exemplary subjects include patients suffering from a disease, in particular, patients suffering from cancer, inflammation, fibrotic diseases, autoimmune diseases, infections, congenital and hereditary diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases, and hematological diseases.

[0158] Example

[0159] The following examples are intended only to illustrate the invention disclosed herein and should not be construed in any way as limiting the scope of protection of the appended claims.

[0160] The following schemes describe the proposed synthetic routes. Using these schemes, the following guidelines and examples, one skilled in the art can develop similar or similar methods for preparing compounds within the scope of the present invention.

[0161] Example 1. Synthesis and mass spectrometric confirmation of sphingosine

[0162] Sphingosine (d14:0)

[0163] Synthesis route map:

[0164] Synthesis route:

[0165] first step

[0166] Tert-Butyl (4S)-4-[(E,1R)-1-hydroxydodecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0167] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (400 mg, 1.55 mmol), undec-1-ene (311.79 mg, 2.02 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-ylidene]-dichlororuthenium, and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 4 h. Filtered and the filtrate was spin-dried to dryness. The crude product was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to give tert-butyl (4S)-4-[(E,1R)-1-hydroxydodecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 651.78 μmol, yield 41.93%) as a brown oil.

[0168] 1 H NMR (400MHz, CDCl3) δ = 5.81-5.71 (m, 1H), 5.15-4.90 (m, 1H), 2.15-2.01 (m, 2H), 1.28 (m, 36H), 0.91 (t, J = 6.8Hz, 3H).

[0169] Step 2

[0170] (E,2S,3R)-2-Aminotetradecyl-4-ene-1,3-diol

[0171] To a solution of tert-butyl (4S)-4-[(E,1R)-1-hydroxydodecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 651.78 μmol) in acetonitrile (2 mL) was added an aqueous solution (2 mL) of trifluoroacetic acid (46.05 mg, 403.87 μmol, 30 μL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate solution was added to adjust the pH to 8. The mixture was extracted three times with ethyl acetate (10 mL). The combined organic phases were washed with saturated brine (5 mL), dried over anhydrous Na2SO4, and filtered. The filtrate was concentrated under reduced pressure to give (E,2S,3R)-2-aminotetradecyl-4-ene-1,3-diol (150 mg, 616.31 μmol, 94.56% yield) as a colorless solid.

[0172] LCMS Rt = 3.756 min in 7 min chromatography, 10-80 AB ESI calculated value C 14 H 30 NO2[M+H] + 244.3, test value 244.1

[0173] Step 3

[0174] (2S,3R)-2-Aminotetradecane-1,3-diol

[0175] Under nitrogen, wet palladium on carbon (327.94 mg, 308.15 μmol, 10% purity) was added to a solution of (E,2R,3R)-2-aminotetradec-4-ene-1,3-diol (150 mg, 616.31 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The mixture was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (50 psi) for 12 h. Tetrahydrofuran (10 mL) was added to the mixture and filtered. The filter cake was washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and the crude product was purified by prep-HPLC (chromatographic column: Phenomenex Luna C8 50*40mm*5μm; mobile phase: [water(formic acid)-methanol]; gradient: 45%-95% B in 20 min) to give (2S,3R)-2-aminotetradecane-1,3-diol (35.8 mg, 145.88 μmol, yield 23.67%) as a white solid.

[0176] LCMS Rt = 5.995 min in 7 min chromatography, 10-80AB ESI calculated value C 14 H 32 NO2[M+H] + 246.4, test value 246.2

[0177] 1 H NMR(400MHz, CDCl3)δ=5.50-5.40(m,1H),4.05-3.95(m,1H),3.87-3.70(m,2H),3.60-3.4 5(m,1H),2.66-2.39(m,2H),1.75-1.40(m,16H),1.39-1.30(m,4H),0.90(t,J=6.4Hz,3H).

[0178] Sphingosine (d15:0)

[0179] Synthesis route map:

[0180] Synthesis route:

[0181] first step

[0182] Tert-Butyl (4S)-4-[(E,1R)-1-hydroxytridecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0183] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (400 mg, 1.55 mmol), dodec-1-ene (340.14 mg, 2.02 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The crude product after concentration under reduced pressure was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to give tert-butyl (4S)-4-[(E,1R)-1-hydroxytridecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (380 mg, 955.76 μmol, yield 61.49%) as a yellow oil.

[0184] 1 H NMR(400MHz, CDCl3)δ=5.83-5.57(m,1H),5.52-5.32(m,1H),4.24-3.74(m,4H) ,2.10-1.90(m,2H),1.53-1.43(m,15H),1.40-1.14(m,16H),0.90-0.84(m,3H).

[0185] Step 2

[0186] (E,2S,3R)-2-Aminopentadec-4-ene-1,3-diol

[0187] To a solution of (4S)-4-[(E,1R)-1-hydroxytridecyl-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (380 mg, 955.76 μmol) in acetonitrile (2 mL) was added a solution of trifluoroacetic acid (544.89 mg, 4.78 mmol, 354.98 μL) in water (2 mL). The mixture was stirred at 80°C for 4 h. The pH was adjusted to 8 by adding saturated aqueous sodium bicarbonate. The mixture was filtered, and the filter cake was washed three times with water (10 mL) and dried under reduced pressure to afford (E,2S,3R)-2-aminopentadec-4-ene-1,3-diol (100 mg, 388.48 μmol, 40.65% yield) as a brown solid. This solid was used directly in the next step without further purification.

[0188] 1H NMR (400MHz, CDCl3) δ=5.82-5.69(m,1H),5.51-5.41(m,1H),4.85-4.41(m,2H),4.13-3.95(m,1H),3.77-3.5 5(m,2H),2.97-2.77(m,1H),2.12-2.00(m,2H),1.40-1.35(m,2H),1.28-1.24(m,14H),0.88(t,J=6.8Hz,3H).

[0189] Step 3

[0190] (2S,3R)-2-Aminopentadecan-1,3-diol

[0191] Under nitrogen, wet palladium on carbon (206.71 mg, 194.24 μmol, 10% purity) was added to a solution of (E,2S,3R)-2-aminopentadec-4-ene-1,3-diol (100 mg, 388.48 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (10 mL) was added to the mixture and filtered. The filter cake was washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and the crude product was purified by prep-HPLC (column: Phenomenex Luna C8 50*40mm*5μm; mobile phase: [water(formic acid)-methanol]; gradient: 10%-40% B in 20 min) to give (2S,3R)-2-aminopentadecan-1,3-diol (10.6 mg, 34.70 μmol, yield 8.93%, formate salt) as a white solid.

[0192] 1 H NMR (400MHz, CD3OD) δ = 8.54 (br s, 1H), 3.85-3.65 (m, 3H), 3.20-3.11 (m, 1H), 1.56-1.46 (m, 2H), 1.41-1.26 (m, 20H), 0.90 (t, J = 6.8Hz, 3H).

[0193] LCMS Rt = 0.830 min in 1.5 min chromatography, 5-95AB_E ESI calculated value C 15 H 34 NO2[M+H] + 260.3, test value 260.1

[0194] HPLC Rt = 0.790 min, in 8 min chromatography, ELSD, purity 98.862%.

[0195] Sphingosine (d19:1) & (d19:0)

[0196] Synthesis route map:

[0197] Synthesis route:

[0198] first step

[0199] Tert-Butyl (4S)-4-[(E,1R)-1-hydroxyheptadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0200] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (400 mg, 1.55 mmol), hexadec-1-ene (453.51 mg, 2.02 mmol, 580.68 μL), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The crude product after concentration under reduced pressure was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to give tert-butyl (4S)-4-[(E,1R)-1-hydroxyheptadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 661.24 μmol, yield 42.54%) as a yellow oil.

[0201] 1 H NMR(400MHz, CDCl3)δ=5.76-5.67(m,1H),5.58-5.36(m,1H),4.13-3.79(m,4H) ,2.04-1.96(m,2H),1.70-1.30(m,23H),1.27-1.24(m,16H),0.93-0.83(m,3H).

[0202] Step 2

[0203] (E,2S,3R)-2-Aminononadec-4-ene-1,3-diol

[0204] To a solution of tert-butyl (4S)-4-[(E,1R)-1-hydroxyheptadecan-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (300 mg, 661.24 μmol) in acetonitrile (2 mL) and water (2 mL) was added trifluoroacetic acid (753.94 mg, 6.61 mmol, 491.17 μL). The mixture was stirred at 80°C for 4 h. After concentration under reduced pressure, the crude product (200 mg, 637.92 μmol, 96.47% yield) was obtained as a yellow oil. Among them (100 mg, 318.96 μmol) was purified by prep-HPLC (chromatographic column: Phenomenex Luna C8 50*40 mm*5 μm; mobile phase: [water (formic acid)-methanol]; gradient: 50%-80% B in 20 min) to obtain (E,2S,3R)-2-aminononadec-4-ene-1,3-diol (10.9 mg, 25.49 μmol, yield 7.99%, trifluoroacetate) as a white solid.

[0205] 1 H NMR (400MHz, CD3OD) δ = 8.53 (s, 0.5H), 5.96-5.76 (m, 1H), 5.53-5.40 (m, 1H), 4.26 (t, J = 6.0Hz, 1H), 3.82-3.75 (m, 1H), 3.70-3.62 (m, 1H), 3.20-3.14 (m,2H),2.15-2.05(m,2H),1.47-1.40(m,2H),1.29(s,22H),0.90(t,J=6.8Hz,3H).

[0206] 19 F NMR (376.5MHz, CD3OD) δ = -76.926.

[0207] LCMS Rt = 1.764 min in 7 min chromatography, 50-100 AB ESI calculated value C 19 H 39 NO2[M+H] + 314.3,test value 314.3

[0208] HPLC Rt = 2.253 min, in 8 min chromatography, ELSD, purity 97.530%.

[0209] Step 3

[0210] (2S,3R)-2-Aminononadecan-1,3-diol

[0211] Under nitrogen, wet palladium on carbon (169.72 mg, 159.48 μmol, 10% purity) was added to a solution of (E,2S,3R)-2-aminononadec-4-ene-1,3-diol (100 mg, 318.96 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (10 mL) was added to the mixture and filtered. The filter cake was washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and the crude product was purified by prep-HPLC (column: Phenomenex Luna C8 50*40mm*5μm; mobile phase: [water(formic acid)-methanol]; gradient: 20%-50% B in 20 min) to give (2S,3R)-2-aminononadecan-1,3-diol (25.7 mg, 71.08 μmol, yield 22.43%, formate salt) as a white solid.

[0212] 1 H NMR (400MHz, CD3OD) δ = 8.54 (br s, 1H), 3.84-3.65 (m, 3H), 3.23-3.09 (m, 1H), 1.55-1.45 (m, 2H), 1.35-1.26 (m, 28H), 0.90 (t, J = 6.8Hz, 3H).

[0213] LCMS Rt = 0.962 min in 1.5 min chromatography, 5-95AB ESI calculated value C 19 H 42 NO2[M+H] + 316.3, test value 316.2

[0214] HPLC Rt = 2.105 min, in 8 min chromatography, ELSD, purity 99.824%.

[0215] Sphingosine (d21:1) & (d21:0)

[0216] Synthesis route map

[0217] Synthesis route:

[0218] first step

[0219] (4S)-4-[(E,1R)-1-Hydroxynonadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0220] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (800 mg, 3.11 mmol), octadec-1-ene (1.02 g, 4.04 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; and tricyclohexylphosphine (263.94 mg, 310.89 μmol) in dichloromethane (12 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 4 h. The reaction solution was filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxynonadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.25 mmol, yield 40.06%) as a brown oil.

[0221] 1 H NMR(400MHz, CDCl3)δ=5.75-5.61(m,1H),5.45-5.30(m,1H),4.20-3.50(m, 4H), 1.97-1.81 (m, 2H), 1.42 (s, 15H), 1.18 (s, 28H), 0.81 (t, J = 6.4Hz, 3H).

[0222] Step 2

[0223] (E,2S,3R)-2-Aminoheneicosyl-4-ene-1,3-diol

[0224] To a solution of (4S)-4-[(E,1R)-1-hydroxynonadecan-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (600 mg, 1.25 mmol) in acetonitrile (4 mL) was added a solution of trifluoroacetic acid (1.42 g, 12.45 mmol, 925.13 μL) in water (4 mL). The mixture was stirred at 80°C for 4 h. The reaction solution was purified by prep-HPLC (column: Phenomenex Luna C8 50*40 mm*5 μm; mobile phase: [water(formic acid)-methanol]; gradient: 27% to 57% B over 20 min) and lyophilized to afford (E,2S,3R)-2-aminoheneicosyl-4-ene-1,3-diol (15.6 mg, 34.24 μmol, 2.75% yield, trifluoroacetate salt) as a white solid.

[0225] LCMS Rt = 3.223 min in 4 min chromatography, 10-80AB ESI calculated value C 21 H 44NO2[M+H] + 342.3,test value 342.3

[0226] 1 H NMR (400MHz, CD3OD) δ = 5.95-5.80 (m, 1H), 5.61-5.40 (m, 1H), 4.32-4.20 (m, 1H), 3.86-3.75 (m, 1H),3.70-3.61(m,1H),3.20-3.10(m,1H),2.21-2.05(m,2H),1.31(s,28H),0.96-0.75(m,3H).

[0227] Step 3

[0228] (2S,3R)-2-Aminoheneicosyl-1,3-diol

[0229] Under nitrogen, wet palladium on carbon (155.78 mg, 146.38 μmol, 10% purity) was added to a solution of (E,2S,3R)-2-aminoheneicosyl-4-ene-1,3-diol (100 mg, 292.77 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (10 mL) was added to the mixture and filtered. The filter cake was rinsed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and the crude product was purified by prep-HPLC (column: Phenomenex Luna C8 50*40mm*5μm; mobile phase: [water(formic acid)-methanol]; gradient: 50%-80% B in 20 min) to give (2S,3R)-2-aminoheneicosane-1,3-diol (13.0 mg, 33.37 μmol, yield 11.39%, formate salt) as a white solid.

[0230] 1 H NMR (400MHz, CD3OD) δ = 8.54 (br s,1H),3.85-3.79(m,1H),3.77-3.64(m,2H),3.18-3.05(m,1H),1.51-1.48(m,2H),1.38-1.25(m,32H),0.90(t,J=6.4Hz,3H).

[0231] LCMS Rt = 3.082 min in 7 min chromatography, 50-100 AB ESI calculated value C 21 H 46 NO2[M+H] +344.4, test value 344.3

[0232] HPLC Rt = 3.162 min, in 8 min chromatography, ELSD, purity 96.003%.

[0233] Sphingosine (d22:0)

[0234] Synthesis route map

[0235] Synthesis route:

[0236] first step

[0237] α-Pinene (1A, 3.0 kg, 22.4 mol, 1.0 eq) was dissolved in acetone (30 L) and water (3 L). Potassium permanganate (6.0 kg, 38.5 mol, 1.7 eq) was added in multiple portions over 2 hours at 0-5°C. After addition, the mixture was stirred at 0-5°C overnight, and the reaction solution turned dark black. GC indicated complete consumption of the starting material. The reaction solution was filtered to remove manganese dioxide, and the filtrate was concentrated to yield the crude product. The crude product was dissolved in ethyl acetate (5 L), filtered again to remove insoluble matter, and the filtrate was washed with water (5 L) and saturated sodium bicarbonate (5 L). The product was dried over anhydrous sodium sulfate, filtered, and concentrated to yield a crude oil (1.7 kg). This crude oil was then distilled (collecting the 3-4 mmHg, 100-104°C fractions) to yield compound 1 (1.2 kg, 32% yield) with a GC purity >97%.

[0238] Step 2

[0239] Compound 1 (1.0 kg, 5.9 mol, 1.0 eq) was dissolved in toluene (10 L), and glycine ethyl ester hydrochloride (2, 1.7 kg, 11.9 mol, 2.0 eq), triethylamine (1.3 kg, 13.1 mol, 2.2 eq), and boron trifluoride etherate (8.9 g, 59.5 mmol, 0.01 eq) were added. Under argon, the mixture was heated to reflux and reacted for 2-3 hours. LC-MS showed approximately 5% of compound 1 remained. The reaction mixture was cooled to room temperature and filtered. The filter cake was rinsed with ethyl acetate (5 L), and the filtrate was concentrated to obtain a crude oil. The crude product was purified by basic silica gel column chromatography (petroleum ether / ethyl acetate = 15 / 1 to ethyl acetate) to obtain compound 3 (900 g) as a yellow oil. After low-temperature crystallization from n-hexane (2.7 L), compound 3 (360 g, 24% yield) was obtained as an off-white solid.

[0240] Step 3

[0241] 1-Eicosanol (4A, 1.0 kg, 3.4 mol, 1.0 eq) and pyridine (0.8 kg, 10.1 mol, 3.0 eq) were dissolved in dichloromethane (15 L), cooled to 10°C, and Dess-Martin reagent (1.7 kg, 4.0 mol, 1.2 eq) was added. The mixture was allowed to react at room temperature for 2 hours. TLC indicated that compound 4A was completely consumed. The reaction solution was quenched with saturated sodium sulfite (10 L), and the aqueous phase was extracted with dichloromethane (5 L). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a crude oil. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 200 / 1 to 80 / 1) to obtain compound 4 (670 g, 67% yield) as an off-white solid.

[0242] TLC: PE / EA=20 / 1 (2,4-dinitrophenylhydrazine)

[0243] R f (Compound 4A) = 0.3

[0244] R f (Compound 4) = 0.8

[0245] Step 4

[0246] Compound 3 (0.98 kg, 3.9 mol, 1.0 eq) was dissolved in dichloromethane (4 L). Under argon, a solution of triisopropoxytitanium chloride (1.4 kg, 5.3 mol, 2.5 eq) in dichloromethane (4 L), triethylamine (1.2 L, 3.0 eq), and a solution of compound 4 (0.69 kg, 2.3 mol, 1.1 eq) in dichloromethane (4 L) were added sequentially at 0°C. After 10 minutes of reaction, TLC indicated that compound 3 was completely consumed, and the reaction was quenched by the addition of saturated brine (3 L). The reaction mixture was filtered to remove the titanium salt, the filter cake was rinsed with dichloromethane (2 L), and the aqueous phase was extracted with dichloromethane (2 L). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain the crude product. The crude product was dissolved in ethyl acetate (2 L), the insoluble matter was removed by filtration, and the mixture was concentrated to give compound 5 (2.1 kg, yield 91%) as an orange oil, which was a mixture of ethyl ester and isopropyl ester.

[0247] TLC: PE / EA=3 / 1(I2)

[0248] R f (Compound 3) = 0.4

[0249] R f (Compound 5) = 0.6

[0250] Step 5

[0251] Compound 5 (3 kg, 5.5 mol) was dissolved in tetrahydrofuran (12 L), and 1.0 M dilute hydrochloric acid (32 L) was added. The mixture was stirred at 35°C for 48-72 hours. TLC indicated complete consumption of compound 5. The reaction mixture was concentrated to yield a crude solid. The crude product was slurried in ethanol / ethyl acetate (2 / 5) (14 L) and dried to afford compound 6 (1.7 kg, 71% yield) as a pale yellow solid.

[0252] TLC:PE / EA=3 / 1

[0253] Rf(Compound 5)=0.6

[0254] Rf(Compound 6)=0.1

[0255] Step 6

[0256] Compound 6 (0.9 kg, 2.5 mol, 1.0 eq) was dispersed in deionized water (5.4 L) and ethanol (16.2 L). The mixture was cooled to 0-10°C and sodium borohydride (0.6 kg, 20.1 mol, 8.0 eq) was added. The reaction was allowed to react at room temperature overnight. LCMS showed no starting material. The reaction was quenched by adding saturated ammonium chloride (5 L) and stirred for 30 minutes.

[0257] The two batches of reaction liquid were combined and processed as follows:

[0258] The reaction solutions were combined and filtered, the aqueous phase was extracted with chloroform (10 L), and the organic phases were combined and concentrated to obtain an off-white solid. After the solid was combined with the aforementioned filter cake, it was dissolved in deionized water (20 L) and methanol (5 L) at 100 ° C and stirred for 1 hour. It was naturally cooled to room temperature, stirred overnight, filtered, and the filter cake was dried to obtain a light yellow solid (1.8 kg). The solid was dissolved in methanol (30 L) under reflux, cooled to room temperature, filtered, and dried to obtain a light yellow solid (1.5 kg). The solid was dissolved in chloroform / methanol = 8 / 1 (100 L), and after removing the insoluble matter through a filter membrane, the filtrate was concentrated to obtain an off-white solid sphingosine (d22: 0) (1.2 kg, yield 77%).

[0259] TLC:PE / EA=1 / 1(I2)

[0260] Rf(Compound 6)=0.4

[0261] Rf(sphingosine(d22:0))=0.1

[0262] LC-MS:358.23[M+1]+

[0263] 1H NMR (400 MHz, methanol-d4) δ 3.73 (dd, J = 8.0, 4.0 Hz, 1H), 3.52-3.45 (m, 2H), 2.77-2.74 (m, 1H), 1.51 (s, 2H), 1.27 (s, 34H), 0.88 (t, J = 6.8 Hz, 3H).

[0264] Sphingosine (d23:1) & (d23:0)

[0265] Synthesis route map

[0266] Synthesis route:

[0267] first step

[0268] Tert-Butyl (4S)-4-[(E,1R)-1-hydroxyheneicosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0269] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (400 mg, 1.55 mmol), eicos-1-ene (566.89 mg, 2.02 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The reaction solution was concentrated under reduced pressure and the crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to give tert-butyl (4S)-4-[(E,1R)-1-hydroxyheneicosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 549.23 μmol, yield 35.33%) as a yellow oil.

[0270] 1 H NMR (400MHz, CDCl3) δ = 5.78-5.69 (m, 1H), 5.48-5.36 (m, 1H), 4.16- 3.80(m,4H),2.08-2.00(m,2H),1.76-1.25(m,31H),1.25-1.22(m,15H),0.92-0.84(m,3H).

[0271] Step 2

[0272] (E,2S,3R)-2-Aminotricosyl-4-ene-1,3-diol

[0273] To a solution of (4S)-4-[(E,1R)-1-hydroxyhenicosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 549.23 μmol) in acetonitrile (2 mL) was added trifluoroacetic acid (626.24 mg, 5.49 mmol, 407.97 μL) in water (2 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was concentrated under reduced pressure to obtain a crude product, which was purified by prep-HPLC (column: Phenomenex Luna C8 50*40 mm*5 μm; mobile phase: [water(formic acid)-methanol]; gradient: 50%-85% B over 20 min) and lyophilized to afford (E,2S,3R)-2-aminotricosyl-4-ene-1,3-diol (4 mg, 8.27 μmol, 0.15% yield, trifluoroacetate salt) as a white solid.

[0274] 1 H NMR (400MHz, CD3OD) δ = 8.54 (br s,1H),5.90-5.79(m,1H),5.53-5.43(m,1H),4.27(t,J=5.6Hz,1H),3.82-3.75(m,1H),3.69-3.61(m, 1H), 3.23-3.14 (m, 1H), 2.10 (q, J = 7.2Hz, 2H), 1.46-1.40 (m, 2H), 1.29 (s, 30H), 0.90 (t, J = 6.8Hz, 3H).

[0275] 19 F NMR (376.5MHz, CD3OD) δ = -76.926.

[0276] LCMS Rt = 1.107 min in 1.5 min chromatography, 5-95AB ESI calculated value C 23 H 48 NO2[M+H] + 370.4, test value 370.3

[0277] HPLC Rt=3.661 min, in 8 min chromatography, ELSD, purity 100.000%.

[0278] Step 3

[0279] (2S,3R)-2-Aminotricosyl-1,3-diol

[0280] Under nitrogen, wet palladium on carbon (143.96 mg, 135.27 μmol, 10% purity) was added to a solution of (E,2S,3R)-2-aminotricosan-4-ene-1,3-diol (100 mg, 270.55 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (10 mL) was added to the mixture and filtered. The filter cake was washed three times with tetrahydrofuran (10 mL). The crude product obtained by concentrating the filtrate was purified by prep-HPLC (chromatographic column: Phenomenex Luna C8 50*40mm*5μm; mobile phase: [water(formic acid)-methanol]; gradient: 50%-85% B in 20 min) to give (2S,3R)-2-aminotricosanyl-1,3-diol (5.4 mg, 12.93μmol, yield 4.80%, formate salt) as a white solid.

[0281] 1 H NMR (400MHz, CD3OD) δ = 8.55 (s, 1H), 3.82-3.75 (m, 1H), 3.65-3.55 (m, 2H), 3.0 1-2.89(m,1H),1.56-1.50(m,2H),1.33-1.28(m,36H),0.90(t,J=6.4Hz,3H).

[0282] LCMS Rt = 1.118 min in 1.5 min chromatography, 5-95AB ESI calculated value C 23 H 50 NO2[M+H] + 372.4, test value 372.2

[0283] HPLC Rt = 3.820 min, in 8 min chromatography, ELSD, purity 94.809%.

[0284] Sphingosine (d24:1) & (d24:0)

[0285] Synthesis route map

[0286] Synthesis route:

[0287] first step

[0288] Tert-Butyl (4S)-4-(1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate

[0289] To a solution of tert-butyl (S)-4-formyl-2,2-dimethyloxazolidine-3-carboxylate (7.5 g, 32.71 mmol, 1 eq) in THF (75 mL) was added vinylmagnesium bromide (1 M, 49.07 mL, 1.5 eq) dropwise at -78°C over half an hour. The mixture was stirred at -78°C for 2 h, then warmed to 25°C and stirred for another 5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride (50 mL), and the aqueous phase was extracted with ethyl acetate (50 mL x 3). The combined organic phases were washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by silica gel flash column chromatography (eluent: ethyl acetate in petroleum ether 0-25%) to give tert-butyl (4S)-4-(1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate (7 g, 27.20 mmol, yield 83.1%) as a colorless oil.

[0290] 1 H NMR (400MHz, CDCl3) δ = 5.92-5.80 (m, 1H), 5.43-5.34 (m, 1H), 5.26-5.19 (m, 1H), 4.31-4.20 (m, 1H), 4.08-3.82 (m, 3H), 1.56-1.47 (m, 15H).

[0291] Step 2

[0292] Tert-Butyl (S)-4-((R)-1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate

[0293] Tert-butyl (4S)-4-(1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate (5 g) was purified by SFC (column: DAICEL CHIRALCEL OX (250 mm x 30 mm, 10 μm); mobile phase: [CO2–EtOH (0.1% NH3H2O)]; B%: 10%, isocratic elution mode) to give tert-butyl (S)-4-((R)-1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate (2.1 g, 8.16 mmol, yield 42.0%, ee 100%) as a colorless oil.

[0294] 1 H NMR (400MHz, CDCl3) δ = 5.92-5.78 (m, 1H), 5.43-5.33 (d, J = 17.2Hz, 1H), 5.26-5.17 (d, J = 10.4Hz, 1H), 4.33-3.86 (m, 4H), 1.58-1.45 (m, 15H).

[0295] SFC Rt = 0.540 min in 3 min. Column: Chiral OX-3 50 x 4.6 mm ID, 3 μm; Mobile phase: Phase A (CO2), Phase B: (EtOH (0.05% DEA)); Elution gradient: B in A from 5% to 40%; Flow rate: 3 mL / min; Detector: PDA; Column temperature: 35°C; Back pressure: 100 bar.

[0296] Step 3

[0297] Eicosapentadenine-1-aldehyde

[0298] To a solution of eicosan-1-ol (8.5 g, 28.47 mmol, 1 eq) in DCM (400 mL) was added pyridinium chlorochromate (PCC) (6.75 g, 31.32 mmol, 1.1 eq). The mixture was stirred at 25°C for 16 h. Silica gel (10 g) was added to the brown suspension. The resulting mixture was stirred for 30 min, and the concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-5% ethyl acetate in petroleum ether) to afford eicosan-1-aldehyde (6.5 g, 21.04 mmol, 73.9% yield) as a white solid.

[0299] 1 H NMR (400MHz, CDCl3) δ=9.77 (t, J=2.0Hz, 1H), 2.46-2.39 (m, 2H), 1.66-1.60 (m, 2H), 1.31-1.25 (m, 32H), 0.91-0.86 (t, J=2.8Hz, 3H).

[0300] Step 4

[0301] Heneicos-1-ene

[0302] To a solution of methyl(triphenyl)phosphonium bromide (7.23 g, 20.23 mmol, 3 eq) in THF (40 mL) at 0°C was added potassium tert-butoxide (2.27 g, 20.23 mmol, 3 eq). The resulting yellow suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of eicosan-1-aldehyde (2 g, 6.74 mmol, 1 eq) in THF (20 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 h. Water (10 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (15 mL x 3). The combined organic phases were washed with saturated brine (5 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford heneicosan-1-ene (1.7 g, 5.77 mmol, 85.5% yield) as a colorless solid.

[0303] 1 H NMR (400MHz, CDCl3) δ = 5.89-5.76 (m, 1H), 5.04-4.90 (m, 2H), 2.08-2.01 (m, 2H), 1.40-1.36 (m, 2H), 1.30-1.24 (m, 32H), 0.91-0.87 (t, J = 5.2Hz, 3H).

[0304] Step 5

[0305] Tert-Butyl (4S)-4-[(E,1R)-1-hydroxydocosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0306] Under nitrogen, benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (98.98 mg, 116.58 μmol, 0.1 eq) was added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300.00 mg, 1.17 mmol, 1 eq) and heneicos-1-ene (446.43 mg, 1.52 mmol, 1.3 eq) in dichloromethane (10 mL). The mixture was stirred at 40°C for 16 h. The reaction solution was concentrated under reduced pressure to obtain a crude product, which was purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to obtain tert-butyl (4S)-4-[(E,1R)-1-hydroxydocosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.28 g, 534.53 μmol, yield 45.8%) as a yellow solid.

[0307] 1 H NMR(400MHz, CDCl3)δ=5.81-5.69(m,1H),5.50-5.40(m,1H),4.22-3.83(m,4H),2.0 9-2.01(m,2H),1.56-1.48(m,15H),1.31-1.22(m,34H),0.91-0.86(t,J=6.4Hz,3H).

[0308] Step 6

[0309] (E,2S,3R)-2-Aminotetracosyl-4-ene-1,3-diol

[0310] To a solution of (4S)-4-[(E,1R)-1-hydroxydocosahexadecyl-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (230.00 mg, 439.07 μmol, 1 eq) in acetonitrile (2 mL) was added a 2 mL solution of trifluoroacetic acid (30.70 mg, 269.24 μmol, 0.02 mL, 0.6 eq). The mixture was stirred at 80°C for 4 h. The crude product was concentrated in vacuo, and the pH was adjusted to 8 with saturated aqueous sodium bicarbonate. The product was filtered, and the filter cake was dried in vacuo to afford (E,2S,3R)-2-aminotetracosyl-4-ene-1,3-diol (120 mg, 307.78 μmol, 70.1% yield, 98.4% purity) as a white solid.

[0311] LCMS Rt = 1.786 min in 3 min chromatography, 30-100 AB ESI calculated value C 24 H 49 NO2[M+1] + 384.6, test value 384.4

[0312] 1 H NMR (400MHz, CDCl3) δ = 5.85-5.63 (m, 1H), 5.57-5.43 (m, 1H), 4.24- 3.93(t,J=6.0Hz,1H),3.74-3.57(m,2H),2.95-2.78(m,1H),2.10-2.04(m,2H), 1.90-1.67(m,4H),1.41-1.36(m,2H),1.26(s,32H),0.91-0.87(t,J=2.4Hz,3H).

[0313] Step 7

[0314] (2S,3R)-2-Aminotetracosyl-1,3-diol

[0315] Under nitrogen, wet palladium on carbon (40 mg, 37.59 μmol, 10% purity) was added to a solution of (E,2S,3R)-2-aminotetracosyl-4-ene-1,3-diol (200 mg, 521.31 μmol, 1 eq) in methanol (6 mL). The mixture was stirred at 25°C for 6 h under a hydrogen atmosphere. The mixture was filtered. The filtrate was concentrated to obtain a crude product, which was purified by prep-HPLC (column: Phenomenex Luna C18 150 x 25 mm, 10 μm; mobile phase: [water (formic acid)-methanol]; gradient: 60%-90% B over 8 min) to afford (2S,3R)-2-aminotetracosyl-1,3-diol (7 mg, 18.13 μmol, 3.4% yield, 99.9% purity) as a white solid.

[0316] LCMS Rt = 1.86 min in 3 min chromatography, 30-100 AB ESI calculated value C 24 H 51 NO2[M+1] + 386.6, test value 386.4

[0317] 1 H NMR (400MHz, CDCl3) δ=3.75-3.67(s,2H),3.65-3.58(s,1H),2.91-2.81(s,1H),2.00(br s, 4H), 1.51-1.48 (s, 2H), 1.28-1.25 (s, 38H), 0.90-0.87 (t, J = 5.6Hz, 3H).

[0318] Sphingosine (d25:0) & (d25:1)

[0319] Synthesis route map

[0320] Synthesis route:

[0321] first step

[0322] (4S)-4-[(E,1R)-1-Hydroxytricosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0323] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (1 g, 3.89 mmol), docos-1-ene (1.56 g, 5.05 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; and tricyclohexylphosphine (329.92 mg, 388.61 μmol) in dichloromethane (15 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 4 h. The reaction solution was filtered, and the filtrate was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxytricosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (910 mg, 1.69 mmol, yield 43.54%) as a brown oil.

[0324] 1 H NMR(400MHz, CDCl3)δ=5.80-5.70(m,1H),5.50-5.40(m,1H),4.24-3.85(m, 4H), 2.10-2.00 (m, 2H), 1.51 (s, 15H), 1.28 (s, 36H), 0.90 (t, J = 6.4Hz, 3H).

[0325] Step 2

[0326] (4S)-4-[(1R)-1-Hydroxytricosyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0327] To a mixed solution of (4S)-4-[(E,1R)-1-hydroxytricosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (730 mg, 1.36 mmol) in methanol (4 mL) and tetrahydrofuran (4 mL) was added Pd / C (722.19 mg, 678.62 μmol, 10% purity) under nitrogen. The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (50 psi) for 16 h. Tetrahydrofuran (10 mL) was added to the mixture and filtered. The filter cake was washed three times with tetrahydrofuran (10 mL). The crude product obtained by concentration of the filtrate was purified by flash silica gel column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain compound (4S)-4-[(1R)-1-hydroxytricosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (560 mg, 1.04 mmol, yield 76.43%) as a white solid.

[0328] 1H NMR (400MHz, CDCl3) δ = 4.20-3.75 (m, 4H), 1.65-1.55 (m, 15H), 1.27 (s, 42H), 0.95-0.85 (m, 3H).

[0329] Step 3

[0330] (2S,3R)-2-Aminopentacosane-1,3-diol

[0331] To a solution of (4S)-4-[(1R)-1-hydroxytricosyl]-2,2-dimethyloxazolidine-3-carboxylate (560 mg, 1.04 mmol) in acetonitrile (3 mL) was added trifluoroacetic acid (591.36 mg, 5.19 mmol, 385.25 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate was added to adjust the pH to 8 and then filtered. The filter cake was stirred in HCl / dioxane (2 M, 10 mL) at room temperature and filtered. The product was slurried with methanol (10 mL) and lyophilized to afford (2S,3R)-2-aminopentacosyl-1,3-diol (241 mg, 552.56 μmol, 53.27% yield, hydrochloride salt) as a white solid.

[0332] MS Rt = 1.92-2.14 min in 4 min chromatography, 50-100 AB ESI calculated value C 25 H 54 NO2[M+H] + 400.4,test value 400.4

[0333] 1 H NMR (400 MHz, DMSO-d 6 )δ=7.90-7.70(m,3H),5.10-4.85(m,2H),3.75-3.65(m,2H),3.60-3.50(m,1H ), 3.10-3.00 (m, 1H), 1.50-1.35 (m, 2H), 1.27 (s, 40H), 0.88 (t, J = 6.8Hz, 3H).

[0334] Step 4

[0335] (E,2S,3R)-2-Aminopentacosyl-4-ene-1,3-diol

[0336] To a solution of (4S)-4-[(E,1R)-1-hydroxytricosan-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (80 mg, 148.74 μmol) in acetonitrile (1 mL) was added trifluoroacetic acid (169.59 mg, 1.49 mmol, 110.48 μL) in water (1 mL). The mixture was stirred at 80°C for 16 h. The reaction mixture was concentrated and the crude product was purified by prep-HPLC (column: Phenomenex Luna C8 50*40 mm*5 μm; mobile phase: [water(formic acid)-methanol]; gradient: 30%-60% B over 20 min) and lyophilized to afford (E,2S,3R)-2-aminopentacosan-4-ene-1,3-diol (9.7 mg, 21.86 μmol, 14.70% yield, formate salt) as a white solid.

[0337] LCMS Rt = 1.140 min in 1.5 min chromatography, 5-95AB ESI calculated value C 25 H 52 NO2[M+H] + 398.4, test value 398.3.

[0338] 1 H NMR (400MHz, CD3OD) δ = 8.57 (s, 1H), 5.94-5.80 (m, 1H), 5.55-5.45 (m, 1H), 4.25-4.21 (m, 1H), 3.81-3.75 (m, 1H), 3.72-3.61(m,1H),3.16-3.05(m,1H),2.23-2.15(m,2H),1.51-1.41(m,2H),1.31(s,34H),0.92(t,J=6.8Hz,3H).

[0339] Sphingosine (d26:0) & (d26:1)

[0340] Synthesis route map

[0341] Synthesis route:

[0342] first step

[0343] Docosane-1-aldehyde

[0344] To a solution of docosan-1-ol (10 g, 30.62 mmol, 1 eq) in DCM (400 mL) was added pyridinium chlorochromate (PCC) (7.92 g, 36.74 mmol, 1.2 eq). The mixture was stirred at 30°C for 16 h. Silica gel (20 g) was added to the brown suspension. The resulting mixture was stirred for 30 min. The concentrated crude product was purified by flash silica gel chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to afford docosan-1-aldehyde (7.3 g, 22.49 mmol, 73.4% yield) as a white solid.

[0345] 1 H NMR (400MHz, CDCl3) δ = 9.78-9.76 (t, J = 2.0Hz, 1H), 2.48-2.38 (m, 2H), 1.67-1.59 (m, 2H), 1.26 (s, 36H), 0.93-0.83 (t, J = 6.4Hz, 3H).

[0346] Step 2

[0347] Tricosene-1

[0348] To a solution of methyl(triphenyl)phosphonium bromide (13.21 g, 36.97 mmol, 3 eq) in THF (40 mL) at 0°C was added potassium tert-butoxide (4.15 g, 36.97 mmol, 3 eq). The resulting yellow suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of docosan-1-aldehyde (4 g, 12.32 mmol, 1 eq) in THF (40 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 h. Water (30 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (40 mL x 3). The combined organic phases were washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by flash silica gel chromatography (eluent: petroleum ether) to afford tricos-1-ene (3.4 g, 10.54 mmol, 85.5% yield) as a white solid.

[0349] 1 H NMR (400MHz, CDCl3) δ=5.88-5.77(m,1H),5.03-4.97(m,1H),4.96- 4.91(m,1H),2.08-2.02(m,2H),1.41-1.36(m,2H),1.29-1.25(m,36H),0.91-0.87(t,J=6.8Hz,3H).

[0350] Step 3

[0351] (4S)-4-[(E,1R)-1-Hydroxytetracosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0352] Under nitrogen, benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (188.64 mg, 222.20 μmol, 0.1 eq) was added to a solution of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (571.78 mg, 2.22 mmol, 1 eq) and tricos-1-ene (2 g, 6.20 mmol, 2.79 eq) in dichloromethane (20 mL). The mixture was stirred at 40°C for 16 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxytetracosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.6 g, 1.09 mmol, yield 48.9%) as a brown solid.

[0353] 1 HNMR(400MHz, CDCl3)δ=5.79-5.71(m,1H),5.48(m,1H),4.19-3.87(m,4H),2.0 8-2.02(m,2H),1.54-1.49(m,15H),1.26(s,38H),0.91-0.86(t,J=6.0Hz,3H).

[0354] Step 4

[0355] (4S)-4-[(1R)-1-Hydroxytetracosyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0356] To a solution of (4S)-4-[(E,1R)-1-hydroxytetracosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 543.59 μmol, 1 eq) in methanol (6 mL) was added Pd / C (40 mg, 37.59 μmol, 10% purity) under nitrogen. The mixture was stirred at 25°C under a hydrogen atmosphere for 6 h. The filtrate was filtered and concentrated to afford (4S)-4-[(1R)-1-hydroxytetracosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.28 g, 505.51 μmol, 93.0% yield) as a white solid.

[0357] 1H NMRδ=4.07-3.77(m,4H),3.60-3.46(s,1H),1.60-1.58(s,2H),1.54-1.49(m,15H),1.26(s,42H),0.91-0.87(t,J=6.4Hz,3H).

[0358] Step 5

[0359] (2S,3R)-2-Aminohexacosanyl-1,3-diol

[0360] To a 3 mL solution of trifluoroacetic acid (92.10 mg, 807.73 μmol, 1.72 eq) in water was added a 3 mL solution of (4S)-4-[(1R)-1-hydroxytetracosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (260 mg, 469.40 μmol, 1 eq). The mixture was stirred at 85°C for 16 h. The reaction mixture was concentrated to obtain a crude product, which was adjusted to pH 8 by adding saturated aqueous sodium bicarbonate. The filtrate was purified by prep-HPLC (column: Welch Xtimate C1 100 x 30 mm, 5 μm; mobile phase: [water (formic acid)-methanol]; gradient: 65%-95% B in 8 min) to give (2S,3R)-2-aminohexacosanyl-1,3-diol (10 mg, 23.42 μmol, yield 5.0%, purity 96.88%) as a white solid.

[0361] LCMS Rt = 1.989 min in 3 min chromatography, 30-100 AB ESI calculated value C 26 H 55 NO2[M+1] + 414.7, test value 414.4

[0362] 1 H NMR (400MHz, CD3OD) δ = 8.56-8.50 (s, 1H), 3.86-3.80 (dd, J = 4.0, 11.2Hz, 1H), 3.79-3.74 (m, 1H), 3.73-3.66 (d d,J=8.8,11.6Hz,1H),3.21-3.14(m,1H),1.51-1.45(m,2H),1.35-1.28(m,42H),0.92-0.88(t,J=6.4Hz,3H).

[0363] Step 6

[0364] (E,2S,3R)-2-Aminohexadecyl-4-ene-1,3-diol

[0365] To a 3 mL solution of trifluoroacetic acid (92.10 mg, 807.73 μmol, 1.49 eq) in water was added a solution of (4S)-4-[(E,1R)-1-hydroxytetracosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 543.59 μmol, 1 eq) in acetonitrile (3 mL). The mixture was stirred at 85°C for 6 h. The reaction mixture was concentrated to obtain a crude product, which was adjusted to pH 8 by adding saturated aqueous sodium bicarbonate. The filtrate was purified by prep-HPLC (column: Welch Xtimate C1 100 x 30 mm, 5 μm; mobile phase: [water (formic acid)-methanol]; gradient: 65%-95% B in 20 min) and lyophilized to obtain (E,2S,3R)-2-aminohexacosan-4-ene-1,3-diol (12.7 mg, 30.82 μmol, yield 5.6%, purity 99.9%) as a white solid.

[0366] LCMS Rt = 1.839 min in 3 min chromatography, 30-100 AB ESI calculated value C 26 H 53 NO2[M+1] + 412.7, test value 412.4

[0367] 1 H NMR (400MHz, CD3OD) δ = 8.59-8.50 (s, 1H), 5.83-5.72 (m, 1H), 5.53-5.44 (m, 1H), 4.12-4.06 (m, 1H), 3.76-3.68 (m, 1H), 3.6 0-3.51(m,1H),2.97-2.88(m,1H),2.12-2.06(m,2H),1.44-1.40(m,2H),1.33-1.27(m,36H),0.93-0.87(t,J=5.2Hz,3H).

[0368] Sphingosine (d27:1) & (d27:0)

[0369] Synthesis route map

[0370] Synthesis route:

[0371] first step

[0372] Tetracosane-1-bromide

[0373] To a solution of tetracosan-1-ol (5 g, 14.10 mmol) in DCM (50 mL) was added triphenylphosphine (4.44 g, 16.92 mmol). N-bromosuccinimide (3.01 g, 16.92 mmol) was then added to the mixture at 0°C. The mixture was stirred at 25°C for 1 h. Saturated Na2SO3 solution (50 mL) was added, and the aqueous phase was extracted with DCM (50 mL x 3). The combined organic phases were washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated. The crude product was purified by flash column chromatography on silica gel (eluent: petroleum ether) to afford tetracosan-1-bromide (3.8 g, 9.10 mmol, 64.55% yield) as a white solid.

[0374] 1 H NMR (400MHz, CDCl3) δ=3.41 (t, J=6.8Hz, 2H), 1.92-1.82 (m, 2H), 1.48-1.39 (m, 2H), 1.36-1.13 (m, 40H), 0.89 (t, J=6.8Hz, 3H).

[0375] Step 2

[0376] Tetracosa-1-ene

[0377] To a cyclohexane solution (40 mL) of tetracosane-1-bromide (3.8 g, 9.10 mmol) and 18-crown-6 (577.32 mg, 2.18 mmol) was added potassium tert-butoxide (2.45 g, 21.84 mmol) at 25°C. The mixture was stirred at 80°C for 0.5 h. The mixture was added to water (50 mL), and the aqueous layer was extracted with EtOAc (50 mL x 3). The combined organic phases were washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by flash column chromatography on silica gel (eluent: petroleum ether) to afford tetracosane-1-ene (2.1 g, 6.24 mmol, 68.55% yield) as a white solid.

[0378] 1 H NMR (400MHz, CDCl3) δ = 5.98-5.73 (m, 1H), 5.05-4.92 (m, 2H), 2.10-2.00 (m, 2H), 1.41-1.37 (m, 2H), 1.30-1.28 (m, 38H), 0.89 (t, J = 6.8Hz, 3H).

[0379] Step 3

[0380] (4S)-4-[(E,1R)-1-Hydroxypentacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0381] Under nitrogen, a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (504.51 mg, 1.96 mmol), tetracos-1-ene (600 mg, 1.78 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; and tricyclohexylphosphine (151.32 mg, 178.23 μmol) in dichloromethane (6 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. This reaction mixture was combined with another batch of reaction mixture prepared from tetracos-1-ene (600 mg). The concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxypentacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (880 mg, 1.56 mmol, yield 43.62%) as a yellow oil.

[0382] 1 H NMR (400MHz, CDCl3) δ = 5.82-5.68 (m, 1H), 5.47-5.38 (m, 1H), 4.15-3.74 (m, 4H), 1.49-1.25 (m, 57H), 0.89-0.85 (m, 3H).

[0383] Step 4

[0384] (E,2S,3R)-2-Aminoheptacosyl-4-ene-1,3-diol

[0385] To a solution of (4S)-4-[(E,1R)-1-hydroxypentacosan-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (880 mg, 1.56 mmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (1.77 g, 15.55 mmol, 1.16 mL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was concentrated to yield (E,2S,3R)-2-aminoheptacosan-4-ene-1,3-diol (660 mg, 1.55 mmol, 99.70% yield). A portion of the product (330 mg, 775.14 μmol) was purified by prep-HPLC (column: Welch Xl timate C4 100x30x 10 μm; mobile phase: [water (formic acid)-methanol]; gradient: 70%-55% B over 20 min) to give (E,2S,3R)-2-aminoheptacosan-4-ene-1,3-diol (10.8 mg, 20.01 μmol, 2.57% yield, trifluoroacetate salt) as a white solid.

[0386] 1 H NMR (400MHz, CD3OD) δ = 8.52 (br s,1H),5.96-5.74(m,1H),5.58-5.43(m,1H),4.34-4.26(m,1H),3.80-3.60(m,2H),3.21- 3.14(m,1H),2.15-2.05(m,2H),1.43-1.39(m,2H),1.34-1.26(m,38H),0.93-0.85(m,3H).

[0387] 19 F NMR (376.5MHz, CD3OD) δ = -76.907.

[0388] LCMS Rt = 1.191 min in 1.5 min chromatography, 5-95AB ESI calculated value C 27 H 56 NO2[M+H] + 426.4, test value 426.3

[0389] HPLC Rt = 4.980 min, in 8 min chromatography, ELSD, purity 98.085%.

[0390] Step 5

[0391] (4S)-4-[(1R)-1-Hydroxypentacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0392] To a mixture of (4S)-4-[(E,1R)-1-hydroxypentacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 1.77 mmol) in methanol (5 mL) and tetrahydrofuran (5 mL) was added Pd / C (188.05 mg, 176.71 μmol, 10% purity) under nitrogen. The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (50 mL) was added to the mixture and filtered. The filter cake was washed three times with tetrahydrofuran (30 mL). The crude product obtained by concentration of the filtrate was purified by flash silica gel column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to give compound (4S)-4-[(1R)-1-hydroxypentacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.06 mmol, yield 59.79%) as a yellow solid.

[0393] 1 H NMR (400MHz, CDCl3) δ = 4.26-3.75 (m, 4H), 3.72-3.36 (m, 1H), 1.58 (s, 9H), 1.49 (s, 6H), 1.45-1.19 (m, 46H), 0.88 (t, J = 6.8Hz, 3H).

[0394] Step 6

[0395] (2S,3R)-2-Aminoheptacosyl-1,3-diol

[0396] To a solution of (4S)-4-[(E,1R)-1-hydroxypentacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.06 mmol) in acetonitrile (3 mL) was added an aqueous solution of trifluoroacetic acid (602.30 mg, 5.28 mmol, 392.38 μL) (3 mL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate was added to adjust the pH to 8. The mixture was filtered and the filter cake was dried under reduced pressure. The filter cake was stirred in hydrochloric acid / dioxane (2 M, 10 mL) at room temperature and concentrated. The crude product was slurried with methanol (10 mL) and filtered. The filter cake was freeze-dried to obtain the compound (2S,3R)-2-aminoheptacosanyl-1,3-diol (105 mg, 215.07 μmol, yield 20.36%, purity 95.082%, hydrochloride) as a white solid.

[0397] 1H NMR (400MHz, DMSO-d6) δ = 8.04 (br s, 3H), 5.03 (br s,2H),3.78-3.55(m,3H),3.06-2.94(m,1H),1.46-1.39(m,2H),1.37-1.15(m,44H),0.86(t,J=6.8Hz,3H).

[0398] LCMS Rt = 5.664 min in 7 min chromatography, 50-100 AB ESI calculated value C 27 H 58 NO2[M+H] + 428.4,test value 428.4

[0399] HPLC Rt = 5.630 min, in 8 min chromatography, ELSD, purity 95.082%.

[0400] Sphingosine (d28:1) & (d28:0)

[0401] Synthesis route map

[0402] Synthesis route:

[0403] first step

[0404] Tetracosaldehyde-1-aldehyde

[0405] To a solution of tetracosan-1-ol (8 g, 22.56 mmol, 1 eq) in DCM (400 mL) was added pyridinium chlorochromate (PCC) (7.29 g, 33.84 mmol, 1.5 eq). The mixture was stirred at 30°C for 16 h. Silica gel (20 g) was added to the brown suspension. The resulting mixture was stirred for 30 min. The concentrated crude product was purified by flash silica gel chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to afford tetracosan-1-aldehyde (5.65 g, 16.03 mmol, 71.0% yield) as a white solid.

[0406] 1 H NMR (400MHz, CDCl3) δ=9.78-9.76 (t, J=2.0Hz, 1H), 2.48-2.38 (m, 2H), 1.67-1.59 (m, 2H), 1.26 (s, 40H), 0.90-0.86 (t, J=6.8Hz, 3H).

[0407] Step 2

[0408] Pentacosa-1-ene

[0409] To a solution of methyl(triphenyl)phosphonium bromide (20.26 g, 56.72 mmol, 5 eq) in THF (15 mL) at 0°C was added potassium tert-butoxide (6.36 g, 56.72 mmol, 5 eq). The resulting yellow suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of tetracos-1-aldehyde (4 g, 11.34 mmol, 1 eq) in THF (40 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 h. Water (30 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (40 mL x 3). The combined organic phases were washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by flash silica gel chromatography (eluent: petroleum ether) to afford pentacos-1-ene (3.20 g, 9.13 mmol, 80.4% yield) as a light yellow solid.

[0410] 1 H NMR (400MHz, CDCl3) δ = 5.88-5.77 (m, 1H), 5.03-4.91 (m, 2H), 2.06- 2.03 (m, 2H), 1.29-1.25 (m, 42H), 0.91-0.86 (t, J = 6.4Hz, 3H).

[0411] Step 3

[0412] (4S)-4-[(E,1R)-1-Hydroxyhexacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0413] Under nitrogen, benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (183.44 mg, 216.07 μmol, 0.1 eq) was added to a solution of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (556 mg, 2.16 mmol, 1 eq) and pentacosa-1-ene (2.11 g, 6.03 mmol, 2.79 eq) in dichloromethane (20 mL). The mixture was stirred at 40°C for 16 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxyhexadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (438 mg, 755.26 μmol, yield 34.9%) as a yellow solid.

[0414] 1HNMR(400MHz, CDCl3)δ=5.76-5.71(m,1H),5.48(m,1H),4.19-3.87(m,4H),2.0 8-2.02(m,2H),1.54-1.49(m,15H),1.26(s,44H),0.91-0.86(t,J=6.4Hz,3H).

[0415] Step 4

[0416] (4S)-4-[(1R)-1-Hydroxyhexacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0417] To a solution of (4S)-4-[(E,1R)-1-hydroxyhexacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 517.30 μmol, 1 eq) in methanol (3 mL) was added Pd / C (30 mg, 28.19 μmol, 10% purity) under nitrogen. The mixture was stirred at 25°C for 6 h under a hydrogen atmosphere. The mixture was filtered. The filtrate was concentrated to afford (4S)-4-[(1R)-1-hydroxyhexacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (231 mg, 396.94 μmol, 76.7% yield) as a white solid.

[0418] 1 H NMRδ=4.07-3.77(m,4H),3.60-3.46(s,1H),1.60-1.58(s,2H),1.54-1.49(m,15H),1.26(s,48H),0.91-0.87(t,J=6.4Hz,3H).

[0419] Step 5

[0420] (2S,3R)-2-Aminooctadecyl-1,3-diol

[0421] To a solution of (4S)-4-[(1R)-1-hydroxyhexacosyl]-2,2-dimethyloxazolidine-3-carboxylate (231 mg, 396.94 μmol, 1 eq) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (92.10 mg, 807.75 μmol, 60 μL, 2.03 eq) in water (3 mL). The mixture was stirred at 80°C for 6 h. The reaction mixture was concentrated, adjusted to pH 8 with saturated aqueous sodium bicarbonate, and filtered. The filtrate was purified by prep-HPLC (column: Welch Xl timate C1 100 x 30 mm, 5 μm; mobile phase: [water (formic acid)-methanol]; gradient: 65%-95% B in 8 min) to give (2S,3R)-2-aminooctadecyl-1,3-diol (9 mg, 20.37 μmol, yield 5.1%, purity 100%) as a white solid.

[0422] LCMS Rt = 2.854 min in 3 min chromatography, 30-100 AB ESI calculated value C 28 H 59 NO2[M+1] + 442.7, test value 442.4

[0423] 1 H NMR (400MHz, CD3OD) δ = 8.54 (s, 1H), 3.86-3.80 (dd, J = 7.2, 11.2Hz, 1H), 3.77-3.74 (m, 1H), 3.73-3.66 (dd, J=8.8,11.6Hz,1H),3.16-3.13(m,1H),1.52-1.45(m,2H),1.35-1.28(m,46H),0.92-0.88(t,J=6.0Hz,3H).

[0424] Step 6

[0425] (E,2S,3R)-2-Aminooctadecane-4-ene-1,3-diol

[0426] To a solution of trifluoroacetic acid (110.52 mg, 969.30 μmol, 72.00 μL, 1.56 eq) in water (7 mL) was added a solution of (4S)-4-[(E,1R)-1-hydroxyhexacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (360 mg, 620.76 μmol, 1 eq) in acetonitrile (4 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was concentrated, adjusted to pH 8 with saturated sodium bicarbonate, and filtered. The filtrate was purified by prep-HPLC (column: Welch Xtimate C1 100 x 30 mm, 5 μm; mobile phase: [water (formic acid)-methanol]; gradient: 60%-90% B over 8 min) to give (E,2S,3R)-2-aminooctadecane-4-ene-1,3-diol (6.99 mg, 15.90 μmol, yield 2.3%, purity 100%) as a white solid.

[0427] LCMS Rt = 0.478 min in 0.8 min chromatography, 30-100 AB ESI calculated value C 28 H 57 NO2[M+1] + 440.7, test value 440.4

[0428] 1 H NMR (400MHz, CDCl3) δ=5.85-5.63(m,1H),5.57-5.43(m,1H),4.24-3.93(m,1H),3.74-3.57(m,2H),2.95-2 .78(m,1H),2.45-2.10(m,4H),2.10-1.90(m,2H),1..6-1.41(m,2H),1.4-1.0(s,40H),0.91-0.70(m,3H).

[0429] Sphingosine (d29:1) & (d29:0)

[0430] Synthesis route map

[0431] Synthesis route:

[0432] first step

[0433] (4S)-4-[(E,1R)-1-Hydroxyheptacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0434] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (500 mg, 1.94 mmol), hexacos-1-ene (921.20 mg, 2.53 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium, and tricyclohexylphosphine (164.96 mg, 194.31 μmol) in dichloromethane (6 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxyheptacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 471.41 μmol, yield 24.26%) as a yellow oil.

[0435] 1 H NMR(400MHz, CDCl3)δ=5.81-5.67(m,1H),5.50-5.38(m,1H),4.20-3.84(m,4H),2 .06-2.00(m,2H),1.60-1.26(m,44H),1.25-1.24(m,15H),0.88(t,J=6.4Hz,3H).

[0436] Step 2

[0437] (E,2S,3R)-2-Aminononacosyl-4-ene-1,3-diol

[0438] To a solution of (4S)-4-[(E,1R)-1-hydroxyheptacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 471.41 μmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (537.50 mg, 4.71 mmol, 350.16 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 by adding saturated aqueous sodium bicarbonate. The mixture was filtered and the filter cake was washed three times with water (10 mL). The filter cake was dried to yield (E,2S,3R)-2-aminononacosyl-4-ene-1,3-diol (200 mg, 440.74 μmol, 93.49% yield) as a brown solid. A portion of the product (70 mg, 154.26 μmol) was purified twice by prep-HPLC (column: Welch Xltimate C4 100 x 30 x 10 μm; mobile phase: [water (formic acid)-methanol]; gradient: 70%-85% B over 20 min) to afford (E,2S,3R)-2-aminononacosane-4-ene-1,3-diol (4.3 mg, 8.25 μmol, yield 0.05%, purity 95.870%, formate salt) as a white solid.

[0439] 1 H NMR(400MHz,DMSO-d6)δ=8.43(br s,3H),5.77-5.18(m,2H),3.89-3.77(m,1H),3.63-3.35(m,1H),3.22-3.20(m,1 H),2.74-2.58(m,1H),2.04-1.98(m,2H),1.40-1.16(m,44H),0.90-0.83(m,3H).

[0440] LCMS Rt = 5.960 min in 7 min chromatography, 50-100 AB ESI calculated value C 29 H 60 NO2[M+H] + 454.5,test value 454.5

[0441] HPLC Rt = 5.996 min in 15 min chromatography, ELSD, purity 95.870%.

[0442] Step 3

[0443] (2S,3R)-2-Aminononacosane-1,3-diol

[0444] To a mixture of (E,2S,3R)-2-aminononacosane-4-ene-1,3-diol (130 mg, 286.48 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL) was added Pd / C (152.44 mg, 143.24 μmol, 10% purity) under nitrogen. The reaction mixture was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (10 mL) was added to the reaction mixture. The filter cake was washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and purified by prep-HPLC (column: Welch Xltimate C4 100 x 30 x 10 μm; mobile phase: [water (formic acid)-methanol]; gradient: 70%-85% B in 20 min) to obtain the compound (2S,3R)-2-aminononacosane-1,3-diol (6.4 mg, 12.54 μmol, yield 4.38%, purity 98.296%, formate salt) as a white solid.

[0445] 1 H NMR (400MHz, DMSO-d6) δ = 8.37 (s, 3H), 3.64-3.45 (m, 1H), 3.28-3.27 (m, 2H), 2.71-2.60 (m, 1H), 1.45-1.23 (m, 50H), 0.88-0.82 (m, 3H).

[0446] LCMS Rt = 6.199 min in 7 min chromatography, 50-100 AB ESI calculated value C 29 H 62 NO2[M+H] + 456.5,test value 456.5.

[0447] HPLC Rt = 6.735 min in 15 min chromatography, ELSD, purity 98.296%.

[0448] Sphingosine (d30:0)

[0449] Synthesis route map:

[0450] Synthesis route:

[0451] first step

[0452] (4S)-4-[(E,1R)-1-Hydroxyoctadec-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0453] To a solution of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (500 mg, 1.94 mmol) and hexacos-1-ene (1.30 g, 3.43 mmol) in dichloromethane (10 mL) was added benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (224.17 mg, 264.05 μmol). The mixture was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to give (4S)-4-[(E,1R)-1-hydroxyoctadec-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (280 mg, 460.54 μmol, yield 17.44%) as a brown solid.

[0454] 1 H NMR(400MHz, CDCl3)δ=5.81-5.67(m,1H),5.50-5.35(m,1H),4.25-3.77(m,4H),2 .10-1.91(m,2H),1.58-1.45(m,15H),1.40-1.08(m,46H),0.88(t,J=6.8Hz,3H).

[0455] Step 2

[0456] (4S)-4-[(1R)-1-Hydroxyoctadecyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0457] To a solution of (4S)-4-[(E,1R)-1-hydroxyoctadecane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (280 mg, 460 μmol) in tetrahydrofuran (10 mL) and methanol (5 mL) was added Pd / C (50 mg, 10% purity) under nitrogen. The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (50 psi) for 16 h. The filter cake was filtered and washed three times with tetrahydrofuran (30 mL). The crude product obtained by concentration of the filtrate was purified by silica gel chromatography (developing solvent: petroleum ether: ethyl acetate 4:1) to obtain compound (4S)-4-[(1R)-1-hydroxydioctadecyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (160 mg, 262.29 μmol, yield 56.95%) as a white solid.

[0458] 1H NMR (400MHz, CDCl3) δ = 4.15-3.43 (m, 4H), 1.58 (s, 6H), 1.49 (s, 9H), 1.45-1.10 (m, 52H), 0.88 (t, J = 7.2Hz, 3H).

[0459] Step 3

[0460] (2S,3R)-2-Aminotriacontane-1,3-diol

[0461] To a mixed solvent of tert-butyl (4S)-4-[(1R)-1-hydroxyoctadecyl]-2,2-dimethyl-oxazolidine-3-carboxylate (160 mg, 262 μmol) in acetonitrile (1.5 mL) and water (1.5 mL) was added trifluoroacetic acid (307 mg, 2.69 mmol, 0.2 mL). The mixture was stirred at 80°C for 4 h under a nitrogen atmosphere. Saturated aqueous sodium bicarbonate was added to the reaction mixture to adjust the pH to 8. The mixture was filtered in batches, and the filter cake was rinsed with methanol (5 mL). The filter cake was dispersed in hydrochloric acid / dioxane (2 M, 5 mL) and stirred for 20 min. The crude product was slurried with methanol (3 mL) and filtered. The filter cake was lyophilized to yield (2S,3R)-2-aminotriacontane-1,3-diol (53.8 mg, 92.15 μmol, 35.13% yield, trifluoroacetate salt) as a white solid.

[0462] MS Rt = 0.464 min in 0.8 min chromatography, 30-100 AB, ESI calcd for C30H64NO2[M+H]+ 470.5, found 470.4.

[0463] 1 H NMR(400MHz,DMSO-d6)δ=7.71(br s,3H),4.95-4.82(m,2H),3.74-3.64(m,2H),3.62-3.53(m,1H),3.10-3.01(m,1H),1.32-1.25(m,52H),0.87(t,J=6.8Hz,3H).

[0464] 19 F NMR (282MHz, DMSO-d6) δ = -73.413.

[0465] Step 4

[0466] Hexacosadec-1-aldehyde

[0467] To a solution of hexacosan-1-ol (5 g, 13.06 mmol) in DCM (350 mL) were added silica gel (5 g) and pyridinium chlorochromate (PCC) (5.63 g, 26.12 mmol). The mixture was stirred at 25°C for 20 h. The reaction mixture was filtered through celite, and the filtrate was concentrated to afford hexacosan-1-aldehyde (4.97 g, 13.06 mmol) as a white solid, which did not require further purification.

[0468] 1 H NMR (400MHz, CDCl3) δ = 9.76 (s, 1H), 2.45-2.34 (m, 2H), 1.70-1.57 (m, 2H), 1.34-1.20 (m, 44H), 0.88 (t, J = 6.8Hz, 3H).

[0469] Step 5

[0470] Heptacos-1-ene

[0471] To a solution of methyl(triphenyl)phosphonium bromide (13.99 g, 39.17 mmol) in THF (120 mL) at 0°C was added potassium tert-butoxide (4.39 g, 39.17 mmol). The resulting suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of hexacosin-1-aldehyde (4.97 g, 13.06 mmol) in THF (60 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 h. Water (100 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (100 mL x 3). The combined organic phases were washed with saturated brine (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford heptacosin-1-ene (3.85 g, 10.17 mmol, two-step yield: 77.87%) as a white solid.

[0472] 1 H NMR (400MHz, CDCl3) δ = 5.88-5.75 (m, 1H), 5.04-4.88 (m, 2H), 2.04 (q, J = 7.2Hz, 2H), 1.45-1.32 (m, 2H), 1.40-1.15 (m, 44H), 0.88 (t, J = 6.8Hz, 3H).

[0473] Sphingosine (d30:1)

[0474] Synthesis route map

[0475] Synthesis route:

[0476] first step

[0477] Hexacosadec-1-aldehyde

[0478] To a solution of hexacosan-1-ol (1.9 g, 4.96 mmol, 1 eq) in DCM (85 mL) was added pyridinium chlorochromate (PCC) (1.61 g, 7.38 mmol, 1.5 eq). The mixture was stirred at 40°C for 16 h. Silica gel (3.5 g) was added to the brown suspension. The resulting mixture was stirred for 30 min. The concentrated crude product was purified by flash silica gel chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to afford hexacosan-1-aldehyde (690 mg, 1.81 mmol, 36.5% yield) as a white solid.

[0479] 1 H NMR (400MHz, CDCl3) δ = 9.80-9.75 (t, J = 2.0Hz, 1H), 2.48-2.38 (m, 2H), 1.60 (br s, 2H), 1.29-1.25 (m, 44H), 0.91-0.87 (t, J = 6.8Hz, 3H).

[0480] Step 2

[0481] Heptacos-1-ene

[0482] To a solution of methyl(triphenyl)phosphonium bromide (1.69 g, 4.73 mmol, 3 eq) in THF (5 mL) at 0°C was added potassium tert-butoxide (530.57 mg, 4.73 mmol, 3 eq). The resulting yellow suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of hexacosin-1-aldehyde (0.6 g, 1.58 mmol, 1 eq) in THF (5 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 12 h. Water (10 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (15 mL x 3). The combined organic phases were washed with saturated brine (5 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by flash silica gel chromatography (eluent: petroleum ether) to afford heptacosin-1-ene (0.31 g, 0.87 mmol, 45.0% yield) as a colorless solid.

[0483] 1H NMR (400MHz, CDCl3) δ=5.89-5.75(m,1H),5.04-4.97(d,J=17.2Hz,1H),4.97-4.90(d,J=10 .0Hz,1H),2.08-2.02(m,2H),1.40-1.36(m,2H),1.27(s,44H),0.91-0.87(t,J=6.4Hz,3H).

[0484] Step 3

[0485] (4S)-4-[(E,1R)-1-Hydroxyoctadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0486] Under nitrogen, benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (24.10 mg, 28.39 μmol, 0.1 eq) was added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (146.12 mg, 567.85 μmol, 2 eq) and heptacos-1-ene (300 mg, 792.15 μmol, 2.79 eq) in dichloromethane (15 mL). The mixture was stirred at 40°C for 16 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to give (4S)-4-[(E,1R)-1-hydroxydioctadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (55 mg, 90.46 μmol, yield 31.9%) as a gray solid.

[0487] 1 H NMR (400MHz, CDCl3) δ = 5.79-5.71 (m, 1H), 5.48 (br s,1H),4.19-3.87(m,4H),2.08-2.02(m,2H),1.54-1.49(m,15H),1.26(m,46H),0.91-0.86(t,J=6.4Hz,3H).

[0488] Step 4

[0489] (E,2S,3R)-2-Aminotriacontane-4-ene-1,3-diol

[0490] To a 1 mL solution of trifluoroacetic acid (30.70 mg, 269.24 μmol, 0.02 mL, 3.64 eq) in water was added a solution of (4S)-4-[(E,1R)-1-hydroxyoctadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (45 mg, 74.01 μmol, 1 eq) in acetonitrile (1 mL). The mixture was stirred at 85°C for 16 h. The reaction mixture was concentrated and adjusted to pH 8 with saturated sodium bicarbonate. Filtration and cake drying afforded (E,2S,3R)-2-aminotriacontyl-4-ene-1,3-diol (9 mg, 18.57 μmol, 25.1% yield, 96.5% purity) as a white solid.

[0491] LCMS Rt = 2.066 min in 3 min chromatography, 30-100 ESI calculated value C 30 H 61 NO2[M+1] + 468.8,test value 468.5.

[0492] 1 H NMR (400MHz, CDCl3) δ=5.83-5.70(m,1H),5.55-5.42(m,1H),4.15-4.00(m,1H),3.77-3.59( m,2H),2.98-2.83(m,1H),2.10-2.04(m,2H),1.82-1.73(m,4H),1.43-1.39(m,2H),1.26(br s, 44H), 0.91-0.87 (t, J = 6.4Hz, 3H).

[0493] Sphingosine (d31:1) & (d31:0)

[0494] Synthesis route map

[0495] Synthesis route:

[0496] first step

[0497] Octacosa-1-bromo

[0498] To a solution of octacosan-1-ol (5 g, 12.17 mmol) in DCM (50 mL) was added PPh₃ (3.83 g, 14.61 mmol). N-bromosuccinimide (2.60 g, 14.61 mmol) was then added to the mixture at 0°C. The mixture was stirred at 25°C for 1 h. Saturated Na₂SO₃ solution (50 mL) was added, and the aqueous phase was extracted with DCM (50 mL x 3). The combined organic phases were washed with saturated brine (100 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford octacosan-1-bromide (5.77 g, 12.18 mmol, 100.00% yield) as a white solid.

[0499] 1 H NMR (400MHz, CDCl3) δ = 3.42 (t, J = 7.6Hz, 2H), 1.95-1.80 (m, 2H), 1.44 (s, 2H), 1.30-1.24 (m, 48H), 0.89 (t, J = 6.8Hz, 3H).

[0500] Step 2

[0501] Octacosa-1-ene

[0502] To a cyclohexane solution (5 mL) of octacosane-1-bromide (4.77 g, 10.07 mmol) and 18-crown-6 (638.85 mg, 2.42 mmol) was added potassium tert-butoxide (2.71 g, 24.17 mmol) at 25°C. The mixture was stirred at 80°C for 0.5 h. The mixture was added to water (50 mL), and the aqueous phase was extracted with EtOAc (50 mL x 3). The combined organic phases were washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford octacosane-1-ene (3.15 g, 8.02 mmol, 79.64% yield) as a white solid.

[0503] 1 H NMR (400MHz, CDCl3) δ = 5.87-5.70 (m, 1H), 5.07-4.85 (m, 2H), 1.25-1.24 (m, 50H), 0.86 (t, J = 6.8Hz, 3H).

[0504] Step 3

[0505] (4S)-4-[(E,1R)-1-Hydroxynonacosyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0506] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (800 mg, 3.11 mmol), octacos-1-ene (1.59 g, 4.04 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium, and tricyclohexylphosphine (263.94 mg, 310.89 μmol) in dichloromethane (12 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxynonacosadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (450 mg, 723.46 μmol, yield 23.27%) as a yellow oil.

[0507] 1 H NMR(400MHz, CDCl3)δ=5.78-5.70(m,1H),5.50-5.38(m,1H),4.08-3.69(m,4H) ,2.09-2.00(m,2H),1.79-1.29(m,48H),1.25-1.24(m,15H),0.89-0.86(m,3H).

[0508] Step 4

[0509] (E,2S,3R)-2-Aminotriacontadecan-4-ene-1,3-diol

[0510] To a solution of (4S)-4-[(E,1R)-1-hydroxynonacosadec-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (450 mg, 723.46 μmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (824.88 mg, 7.23 mmol, 537.38 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 by adding saturated aqueous sodium bicarbonate. The mixture was filtered, and the filter cake was washed three times with water (10 mL) and dried under reduced pressure to yield (E,2S,3R)-2-aminotriacontadecan-4-ene-1,3-diol (340 mg, 705.64 μmol, 97.54% yield) as a brown solid. A portion of the product (170 mg, 352.82 μmol) was purified twice by prep-HPLC (column: Welch Xltimate C4 100 x 30 x 10 μm; mobile phase: [water (formic acid)-methanol]; gradient: 70%-90% B over 20 min) to afford (E,2S,3R)-2-aminotriacontadecan-4-ene-1,3-diol (2 mg, 3.64 μmol, yield 1.03%, purity 96.127%, formate salt) as a white solid.

[0511] 1 H NMR(400MHz,DMSO-d6)δ=8.21(br s,2H),5.60-5.25(m,2H),3.65-3.46(m,2H),3.40-3.37(m,1H),2.69-2.66(m,1 H),2.03-1.97(m,2H),1.52-1.46(m,2H),1.30-1.23(m,46H),0.88-0.85(m,3H).

[0512] LCMS Rt = 6.247 min in 7 min chromatography, 50-100 AB ESI calculated value C 31 H 64 NO2[M+H] + 482.5,test value 482.5.

[0513] HPLC Rt = 7.018 min in 15 min chromatography, ELSD, purity 96.127%.

[0514] Step 5

[0515] (4S)-4-[(1R)-1-Hydroxynonacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0516] To a solution of (4S)-4-[(E,1R)-1-hydroxynonacosadecyl-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (1 g, 1.61 mmol) in methanol (5 mL) and tetrahydrofuran (5 mL) was added Pd / C (171.09 mg, 160.77 μmol, 10% purity) under nitrogen. The mixture was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (50 mL) was added to the reaction mixture. The mixture was filtered, and the filter cake was washed three times with tetrahydrofuran (30 mL). The filtrate was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to give compound (4S)-4-[(1R)-1-hydroxynonacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 448.70 μmol, yield 27.91%) as a yellow solid.

[0517] 1 H NMR (400MHz, CDCl3) δ = 4.18-3.72 (m, 4H), 3.67-3.31 (m, 1H), 1.57 (s, 9H), 1.49 (s, 6H), 1.48-1.13 (m, 54H), 0.88 (t, J = 6.8Hz, 3H).

[0518] Step 6

[0519] (2S,3R)-2-Aminotriacontane-1,3-diol

[0520] To a solution of (4S)-4-[(1R)-1-hydroxynonacosyl]-2,2-dimethyloxazolidine-3-carboxylate (280 mg, 448.70 μmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (255.80 mg, 2.24 mmol, 166.65 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 with saturated sodium bicarbonate and filtered. The filter cake was dried under reduced pressure. The filter cake was stirred in hydrochloric acid / dioxane (2 M, 10 mL) at room temperature and concentrated. The crude product was slurried with methanol (10 mL) and filtered. The filter cake was lyophilized to yield (2S,3R)-2-aminotriacontacyl-1,3-diol (51 mg, 88.33 μmol, 19.69% yield, 90.112% purity, hydrochloride salt) as a white solid.

[0521] 1H NMR(400MHz,DMSO-d6)δ=7.83(br s,1.5H),5.04-4.89(m,1H),3.78-3.38(m,3H),3.04-2.99(m,1H),1.46-1.42(m,2H),1.32-1.24(m,52H),0.86(t,J=7.6Hz,3H).

[0522] LCMS Rt = 6.614 min in 7 min chromatography, 50-100 AB ESI calculated value C 31 H 66 NO2[M+H] + 484.5,test value 484.5.

[0523] HPLC Rt = 6.672 min, in 8 min chromatography, ELSD, purity 90.112%.

[0524] Sphingosine (d32:1) & (d32:0)

[0525] Synthesis route map

[0526] Synthesis route:

[0527] first step

[0528] Octacosa-1-aldehyde

[0529] To a solution of octacosan-1-ol (10 g, 24.35 mmol, 1 eq) in DCM (400 mL) was added pyridinium chlorochromate (PCC) (6.30 g, 29.21 mmol, 1.2 eq). The mixture was stirred at 30°C for 16 h. Silica gel (15 g) was added to the brown suspension. The resulting mixture was stirred for 30 min. The concentrated crude product was purified by flash silica gel chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to afford octacosan-1-aldehyde (4.5 g, 11.01 mmol, 45.2% yield) as a white solid.

[0530] 1 H NMR (400MHz, CDCl3) δ = 9.79-9.76 (s, 1H), 2.46-2.39 (m, 2H), 1.67-1.61 (m, 2H), 1.31-1.25 (m, 48H), 0.91-0.87 (t, J = 6.4Hz, 3H).

[0531] Step 2

[0532] Nonacosadec-1-ene

[0533] To a solution of methyl(triphenyl)phosphonium bromide (11.80 g, 33.03 mmol, 3 eq) in THF (40 mL) at 0°C was added potassium tert-butoxide (3.71 g, 33.03 mmol, 3 eq). The resulting yellow suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of octacosadec-1-aldehyde (4.5 g, 11.01 mmol, 1 eq) in THF (50 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 h. Water (30 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (40 mL x 3). The combined organic phases were washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by flash silica gel chromatography (eluent: petroleum ether) to afford nonacosadec-1-ene (3.4 g, 8.36 mmol, 75.9% yield) as a white solid.

[0534] 1 H NMR (400MHz, CDCl3) δ = 5.91-5.75 (m, 1H), 5.07-4.88 (m, 2H), 2.08-2.01 (m, 2H), 1.40-1.36 (m, 2H), 1.28-1.25 (m, 48H), 0.91-0.87 (t, J = 6.4Hz, 3H).

[0535] Step 3

[0536] (4S)-4-[(E,1R)-1-Hydroxytriacont-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0537] Under nitrogen, benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (149.61 mg, 176.23 μmol, 0.1 eq) was added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (453.48 mg, 1.76 mmol, 1 eq) and nonacosa-1-ene (2 g, 4.92 mmol, 2.79 eq) in dichloromethane (20 mL). The mixture was stirred at 40°C for 16 h. The reaction solution was concentrated under reduced pressure and the crude product was purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxytriacont-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.3 g, 471.67 μmol, yield 26.8%) as a brown solid.

[0538] 1H NMR(400MHz, CDCl3)δ=5.79-5.68(m,1H),5.48-5.41(m,1H),4.10-3.76(m,4H),2.0 5-2.01(m,2H),1.54-1.49(m,15H),1.28-1.24(m,50H),0.91-0.86(t,J=6.4Hz,3H).

[0539] Step 4

[0540] (E,2S,3R)-2-Aminotriacontidine-4-ene-1,3-diol

[0541] To a 3 mL solution of trifluoroacetic acid (92.10 mg, 807.73 μmol, 60.00 μL, 1.71 eq) in water was added a solution of (4S)-4-[(E,1R)-1-hydroxytriacont-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (0.3 g, 471.67 μmol, 1 eq) in acetonitrile (3 mL). The mixture was stirred at 85°C for 16 h. The reaction mixture was concentrated and adjusted to pH 8 by adding saturated aqueous sodium bicarbonate. The mixture was filtered, and the filter cake was dried under reduced pressure to yield (E,2S,3R)-2-aminotriacont-4-ene-1,3-diol (110 mg, 216.29 μmol, 45.9% yield, 97.5% purity) as a white solid.

[0542] LCMS Rt = 2.137 min in 3 min chromatography, 30-100 AB ESI calculated value C 32 H 65 NO2[M+1] + 496.8,test value 496.5.

[0543] 1 H NMR (400MHz, CDCl3) δ = 5.82-5.70 (m, 1H), 5.53-5.42 (m, 1H), 4.14-3.97 (s, 1H), 3.74-3.58 (m, 2H), 2.96-2. 82(s,1H),2.10-2.03(m,2H),1.91-1.70(m,4H),1.41-1.36(m,2H),1.29-1.24(m,48H),0.91-0.86(m,3H).

[0544] Step 5

[0545] (4S)-4-[(1R)-1-Hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0546] Under nitrogen protection, Pd / C (50 mg, 10% purity) was added to a mixed solution of (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (300 mg, 471.67 μmol) in tetrahydrofuran (5 mL) and methanol (5 mL). The suspension was degassed and replaced with hydrogen three times, then stirred at 50 ° C under a hydrogen atmosphere (50 psi) for 16 hours. Filter and wash the filter cake with tetrahydrofuran (50 mL) three times. The filtrate was concentrated to give (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (250 mg, 391.81 μmol) as a brown solid.

[0547] 1 H NMR (400MHz, CDCl3) δ = 4.15-3.67 (m, 4H), 1.56 (s, 6H), 1.43 (s, 9H), 1.38-1.15 (m, 56H), 0.88 (t, J = 6.8Hz, 3H).

[0548] Step 6

[0549] (2S,3R)-2-Aminotriacontane-1,3-diol

[0550] To a solution of tert-butyl (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 391.81 μmol) in acetonitrile (2 mL) and water (2 mL) was added trifluoroacetic acid (307.00 mg, 2.69 mmol, 0.2 mL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate was added to the reaction mixture to adjust the pH to 8. The mixture was filtered in batches, and the filter cake was rinsed with methanol (5 mL). The filter cake was dispersed in hydrochloric acid / dioxane (2 M, 5 mL), stirred, and concentrated. The crude product was slurried with methanol (10 mL) and filtered. The filter cake was lyophilized to yield (2S,3R)-2-aminotriacontane-1,3-diol (44.7 mg, 83.65 μmol, 21.35% yield, hydrochloride salt) as a white solid.

[0551] MS Rt = 0.497 min in 0.8 min chromatography, 30-100 AB, ESI calculated value C 32 H 68 NO2[M+H] + 498.5,test value 498.6.

[0552] 1H NMR (400MHz, DMSO-d6) δ = 7.76 (s, 3H), 4.90 (s, 2H), 3.74-3.64 (m, 2H), 3.63-3.53 (m, 1H), 3.10-3.00 (m, 1H), 1.48-1.35 (m, 2H), 1.41-1.15 (m, 54H), 0.87 (t, J = 6.8Hz, 3H).

[0553] Sphingosine (d33:1) & (d33:0)

[0554] Synthesis route map

[0555] Synthesis route:

[0556] first step

[0557] Tricontazone-1-bromo

[0558] To a solution of triacontan-1-ol (3 g, 6.84 mmol) in DCM (50 mL) was added triphenylphosphine (2.15 g, 8.20 mmol). N-bromosuccinimide (1.46 g, 8.20 mmol) was then added to the mixture at 0°C. The mixture was stirred at 25°C for 1 h. Saturated Na₂SO₃ solution (50 mL) was added, and the aqueous phase was extracted with DCM (50 mL x 3). The combined organic phases were washed with saturated brine (100 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford triacontan-1-bromide (3.43 g, 6.84 mmol, 100.00% yield) as a white solid.

[0559] 1 H NMR (400MHz, CDCl3) δ = 3.42 (t, J = 6.8Hz, 2H), 1.86 (q, J = 7.2Hz, 2H), 1.47–1.15 (m, 54H), 0.89 (t, J = 6.8Hz, 3H).

[0560] Step 2

[0561] Triacontadec-1-ene

[0562] To a cyclohexane solution (5 mL) of triacontan-1-bromide (2.43 g, 4.84 mmol) and 18-crown-6 (307.25 mg, 1.16 mmol) was added potassium tert-butoxide (1.30 g, 11.62 mmol) at 25°C. The mixture was stirred at 80°C for 0.5 h. The mixture was added to water (50 mL), and the aqueous phase was extracted with EtOAc (50 mL x 3). The combined organic phases were washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford triacontan-1-ene (1.35 g, 3.21 mmol, 66.24% yield) as a white solid.

[0563] 1 H NMR (400MHz, CDCl3) δ = 5.95-5.68 (m, 1H), 5.02-4.83 (m, 2H), 1.26-1.24 (m, 54H), 0.86 (t, J = 6.8Hz, 3H).

[0564] Step 3

[0565] (4S)-4-[(E,1R)-1-Hydroxytriacontanedecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0566] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (800 mg, 3.11 mmol), triacontan-1-ene (1.70 g, 4.04 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium, and tricyclohexylphosphine (263.94 mg, 310.89 μmol) in dichloromethane (12 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C under nitrogen for 8 h. The reaction mixture was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxytriacontadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (260 mg, 399.96 μmol, yield 12.86%) as a yellow liquid.

[0567] 1H NMR(400MHz, CDCl3)δ=5.78-5.55(m,1H),5.47-5.23(m,1H),4.09-3.75(m,4H) ,2.02–1.87(m,2H),1.75-1.20(m,52H),1.18-1.17(m,15H),0.83-0.79(m,3H).

[0568] Step 4

[0569] (E,2S,3R)-2-Aminotricaracanthane-4-ene-1,3-diol

[0570] To a solution of (4S)-4-[(E,1R)-1-hydroxytriacontanoyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (240 mg, 369.19 μmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (420.95 mg, 3.69 mmol, 274.24 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 by adding saturated aqueous sodium bicarbonate. The mixture was filtered, and the filter cake was washed three times with water (10 mL) and dried under reduced pressure to yield (E,2S,3R)-2-aminotriacontanoyl-4-ene-1,3-diol (180 mg, 353.02 μmol, 95.62% yield). Among them (90 mg, 176.51 μmol) was purified by prep-HPLC (column: Welch Xltimate C4 100x30x10 μm; mobile phase: [water (formic acid)-methanol]; gradient: 70%-90% B in 20 min) to obtain the compound (E,2S,3R)-2-aminotriacontanoyl-4-ene-1,3-diol (7.8 mg, 14.03 μmol, yield 7.95%, formate salt) as a white solid.

[0571] 1 H NMR(400MHz,DMSO-d6)δ=8.27(br s,1H),5.66-5.55(m,1H),5.50-5.40(m,1H),3.93-3.85(m,1H),3.48-3.47(m,2H),2.71- 2.65(m,1H),2.04-1.95(m,2H),1.36-1.31(m,2H),1.30-1.21(m,50H),0.89-0.83(m,3H).

[0572] LCMS Rt = 1.336 min in 1.5 min chromatography, 5-95AB ESI calculated value C 33 H 68 NO2[M+H]+ 510.5, test value 510.4.

[0573] HPLC Rt = 7.948 min in 15 min chromatography, ELSD, purity 98.751%.

[0574] Step 5

[0575] (4S)-4-[(1R)-1-Hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0576] Under nitrogen, to a mixed solution of (4S)-4-[(E,1R)-1-hydroxytriacontadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 430.72 μmol) in methanol (5 mL) and tetrahydrofuran (5 mL) was added Pd / C (45.84 mg, 43.07 μmol, 10% purity). The mixture was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 h. Tetrahydrofuran (50 mL) was added to the reaction solution. The mixture was filtered, and the filter cake was washed three times with tetrahydrofuran (30 mL). The crude product after concentration of the filtrate was purified by flash column chromatography on silica gel (eluent: 0-14% ethyl acetate in petroleum ether) to give compound (4S)-4-[(1R)-1-hydroxytriacontidine]-2,2-dimethyl-oxazolidine-3-carboxylate (240 mg, 368.05 μmol, yield 85.45%) as a yellow oil.

[0577] 1 H NMR (400MHz, CDCl3) δ = 4.06-3.85 (m, 4H), 3.74-3.49 (m, 1H), 1.59 (s, 6H), 1.49 (s, 9H), 1.48-1.13 (m, 58H), 0.88 (t, J = 6.8Hz, 3H).

[0578] Step 6

[0579] (2S,3R)-2-Aminotricaracanthane-1,3-diol

[0580] To a solution of (4S)-4-[(1R)-1-hydroxytriacontanoyl]-2,2-dimethyl-oxazolidine-3-carboxylate (240 mg, 368.05 μmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (209.83 mg, 1.84 mmol, 136.69 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 with saturated sodium bicarbonate and filtered. The filter cake was dried under reduced pressure. The filter cake was stirred in hydrochloric acid / methanol (4 M, 10 mL) at room temperature and concentrated. The crude product was slurried with methanol (10 mL) and filtered. The filter cake was lyophilized to yield (2S,3R)-2-aminotriacontanoyl-1,3-diol (226.3 mg, 349.87 μmol, 95.06% yield, 84.780% purity, hydrochloride salt) as a white solid.

[0581] 1 H NMR (400MHz, DMSO-d6) δ = 7.89 (br s, 2H), 4.98 (br s,1H),3.73-3.56(m,2H),3.54-3.40(m,1H),3.04-2.99(m,1H),1.45-1.41(m,2H),1.34-1.21(m,56H),0.87(t,J=6.4Hz,3H).

[0582] HPLC Rt = 7.079 min, in 8 min chromatography, ELSD, purity 84.780%.

[0583] MS Rt = 2.97-3.14 min in 4 min chromatography, 50-100 AB ESI calculated value C 33 H 70 NO2[M+H] + 512.5328, test value 512.5456.

[0584] Sphingosine (d34:0) & (d34:1)

[0585] Synthesis route map

[0586] Synthesis route:

[0587] first step

[0588] (4S)-4-[(E,1R)-1-Hydroxytriacont-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0589] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (800 mg, 3.11 mmol), hexadecene-1-ene (1.2 g, 2.76 mmol), benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium, and tricyclohexylphosphine (234.30 mg, 275.98 μmol) in dichloromethane (12 mL) was degassed and replaced with nitrogen three times. The mixture was stirred at 40°C for 4 h. The reaction solution was filtered, and the filtrate was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxytriacont-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 1.51 mmol, yield 54.56%) as a black oil.

[0590] 1 H NMR (400MHz, CDCl3) δ=5.80-5.70(m,1H),5.55-5.40(m,1H),4.10-3.75(m,4H),2.07(s,2H),1.51(s,15H),1.27(s,54H),0.95-0.85(m,3H).

[0591] Step 2

[0592] (4S)-4-[(1R)-1-Hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate

[0593] Under nitrogen, to a mixed solution of (4S)-4-[(E,1R)-1-hydroxytriacont-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (1 g, 1.51 mmol) in methanol (10 mL) and tetrahydrofuran (10 mL) was added Pd / C (800 mg, 751.40 μmol, 10% purity). The mixture was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (50 psi) for 16 h. Tetrahydrofuran (10 mL) was added to the reaction solution. The mixture was filtered, and the filter cake was washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to give compound (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (460 mg, 690.58 μmol, yield 45.86%) as a white solid.

[0594] 1H NMR (400MHz, CDCl3) δ = 4.05-3.82 (m, 4H), 1.67 (s, 15H), 1.28 (s, 60H), 0.95-0.84 (m, 3H).

[0595] Step 3

[0596] (2S,3R)-2-Aminotetratriacontyl-1,3-diol

[0597] To a solution of (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (460 mg, 690.58 μmol) in acetonitrile (3 mL) was added a solution of trifluoroacetic acid (393.70 mg, 3.45 mmol, 256.48 μL) in water (3 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 with saturated sodium bicarbonate and filtered. The filter cake was dried under reduced pressure. The filter cake was stirred in hydrochloric acid / dioxane (2 M, 10 mL) at room temperature for 10 min and concentrated. The crude product was slurried with methanol (10 mL) and filtered. The filter cake was lyophilized to yield (2S,3R)-2-aminotriacontyl-1,3-diol (377.4 mg, 671.06 μmol, 97.17% yield, hydrochloride salt) as a white solid.

[0598] MS Rt = 1.06-1.43 min in 4 min chromatography, 80-100 AB, ESI calculated value C 34 H 72 NO2[M+H] + 526.5, test value 526.6

[0599] 1 H NMR (400 MHz, DMSO-d 6 )δ=8.10-7.90(m,3H),5.10-4.85(m,1H),3.75-3.65(m,2H),3.65-3.55(m, 1H),3.04-3.00(m,1H),1.45-1.35(m,2H),1.27(s,60H),0.90-0.80(m,3H).

[0600] Step 4

[0601] (E,2S,3R)-2-Aminotetratriacontyl-4-ene-1,3-diol

[0602] To a solution of (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (480 mg, 722.79 μmol) in acetonitrile (4 mL) was added a solution of trifluoroacetic acid (824.12 mg, 7.23 mmol, 536.89 μL) in water (4 mL). The mixture was stirred at 80°C for 4 h. The reaction mixture was adjusted to pH 8 by adding saturated aqueous sodium bicarbonate and filtered. The filter cake was dried under reduced pressure to yield (E,2S,3R)-2-aminotriacontyl-4-ene-1,3-diol (300 mg, 572.61 μmol, 79.22% yield). The mother liquor was purified by prep-HPLC (column: Welch Xltimate C4 100x30x10μm; mobile phase: [water(formic acid)-methanol]; gradient: 70%-90% B over 20 min) to obtain (E,2S,3R)-2-aminotetratriacont-4-ene-1,3-diol (8.2 mg, 14.39 μmol, yield 1.99%, formate salt) as a white solid.

[0603] LCMS Rt = 1.342 min in 1.5 min chromatography, 5-95AB ESI calculated value C 34 H 70 NO2[M+H] + 524.5, test value 525.4.

[0604] 1 H NMR (400 MHz, DMSO-d 6 )δ=8.35(s,2H),5.65-5.40(m,3H),5.40-5.30(m,1H),3.90-3.87(m,1H),3.50-3.46(m,1H) ,3.35-3.25(m,1H),2.70-2.66(m,1H),2.05-1.95(m,2H),1.27(s,54H),0.90-0.80(m,3H).

[0605] Step 5

[0606] Triacontan-1-aldehyde

[0607] To a solution of triacontan-1-ol (2 g, 4.56 mmol) in DCM (100 mL) were added pyridinium chlorochromate (PCC) (1.08 g, 5.01 mmol) and silica gel (3.00 g, 49.93 mmol). The mixture was stirred at 25°C for 16 h. The mixture was filtered, and the filtrate was concentrated. The crude product was purified by flash silica gel chromatography (eluent: 0-30% ethyl acetate in petroleum ether) to afford triacontan-1-aldehyde (1 g, 2.29 mmol, 50.23% yield) as a brown solid.

[0608] 1 H NMR (400MHz, CDCl3) δ = 9.85-9.75 (m, 1H), 2.50-2.35 (m, 2H), 1.70-1.60 (m, 2H), 1.30-1.20 (m, 52H), 0.95-0.85 (m, 3H).

[0609] Step 6

[0610] Henriettadec-1-ene

[0611] To a solution of methyl(triphenyl)phosphonium bromide (5.89 g, 16.48 mmol) in THF (50 mL) at 0°C was added potassium tert-butoxide (1.85 g, 16.48 mmol). The resulting yellow suspension was stirred at 25°C for 1 hour and then cooled again to 0°C. A solution of triacontan-1-aldehyde (2.4 g, 5.49 mmol) in THF (25 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 hours. The reaction solution was combined with another batch prepared from triacontan-1-aldehyde (1 g). Water (50 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (50 mL x 3). The combined organic phases were washed with saturated brine (10 mL), dried over sodium sulfate, filtered, and concentrated. The crude product was purified by flash silica gel chromatography (eluent: petroleum ether) to obtain henriaconta-1-ene (1.1 g, 2.53 mmol, yield 32.42%) as a colorless oil.

[0612] 1 H NMR (400MHz, CDCl3) δ = 5.90-5.80 (m, 1H), 5.05-4.93 (m, 2H), 2.09-2.02 (m, 2H), 1.28 (s, 54H), 0.91 (t, J = 6.8Hz, 3H).

[0613] Sphingosine (d35:1) & (d35:0)

[0614] Synthesis route map:

[0615] Synthesis route:

[0616] first step

[0617] (4S)-4-[(E,1R)-1-Hydroxytriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0618] To a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyalkenyl]-2,2-dimethyl-oxazolidine-3-carboxylate (500 mg, 1.94 mmol) and triacontidine-1-ene (1.13 g, 2.53 mmol) in dichloromethane (7.5 mL) was added Grubbs second-generation catalyst benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-yl]-dichlororuthenium-tricyclohexylphosphine (164.96 mg, 194.31 umol). The mixture was degassed and replaced with nitrogen three times, and then stirred at 40 ° C under a nitrogen atmosphere for 8 h. The reaction solution was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 0-15% ethyl acetate in petroleum ether) to obtain (4S)-4-[(E,1R)-1-hydroxytriacontidine-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (90.0 mg, 132.72 umol, yield 6.83%) as a white solid.

[0619] 1 H NMR(400MHz, CDCl3)δ=5.78-5.68(m,1H),5.48-5.35(m,1H),4.24-3.76(m,4H),2 .07-1.98(m,2H),1.55-1.47(m,15H),1.40-1.11(m,56H),0.88(t,J=6.8Hz,3H).

[0620] Step 2

[0621] (E,2S,3R)-2-Aminopentatriacontane-4-ene-1,3-diol

[0622] To a mixture of tert-butyl (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyloxazolidine-3-carboxylate (90.0 mg, 132.7 μmol) in acetonitrile (1.5 mL) and water (1.5 mL) was added trifluoroacetic acid (307 mg, 2.69 mmol, 0.2 mL). The mixture was stirred at 80°C for 6 h. Saturated aqueous sodium bicarbonate was added to the reaction mixture to adjust the pH to 8. The mixture was filtered in batches, and the filter cake was rinsed with methanol (5 mL). The filter cake was dispersed in hydrochloric acid / dioxane (2 M, 5 mL) and stirred for 20 min. The concentrated crude product was slurried with methanol (3 mL) and filtered. The filter cake was freeze-dried to obtain the compound (E, 2S, 3R)-2-aminopentatriacontane-4-ene-1,3-diol (15.0 mg, 26.11 umol, yield 19.68%, hydrochloride) as a white solid.

[0623] MS Rt = 0.519 min in 0.8 min chromatography, 30-100 AB, ESI calculated value C 35 H 72 NO2[M+H] + 538.5,test value 538.5.

[0624] 1 H NMR (400MHz, DMSO-d6) δ = 7.81-7.39 (m, 3H), 5.79-5.66 (m, 1H), 5.51-5.41 (m,1H),5.24-5.14(m,1H),4.93-4.81(m,1H),4.26-4.16(m,1H),3.69-3. 59(m,1H),3.58-3.47(m,1H),3.58-3.47(m,1H),3.18-3.07(m,1H),2.07- 1.99(m,2H),1.42-1.32(m,2H),1.40-1.15(m,56H),0.87(t,J=6.8Hz,3H).

[0625] Step 3

[0626] (4S)-4-[(1R)-1-Hydroxytriacontanoyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0627] Under nitrogen, to a mixed solution of (4S)-4-[(E,1R)-1-hydroxytriacontanoyl-2-enyl]-2,2-dimethyl-oxazolidine-3-3-carboxylic acid tert-butyl ester (150 mg, 221.20 μmol) in tetrahydrofuran (2 mL) and methanol (2 mL) was added Pd / C (117.70 mg, 110.60 μmol, 10% purity). The suspension was degassed and replaced with hydrogen three times, then stirred at 50°C under a hydrogen atmosphere (50 psi) for 16 hours. Tetrahydrofuran (10 mL) was added. The mixture was filtered and the filter cake was washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and the crude product was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to give (4S)-4-[(1R)-1-hydroxytriacontanoyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (110 mg, 161.73 μmol, yield 73.12%) as a white solid.

[0628] 1 H NMR (400MHz, CDCl3) δ = 4.14-3.67 (m, 4H), 1.64-1.58 (m, 15H), 1.36-1.12 (m, 62H), 0.88 (t, J = 6.8Hz, 3H).

[0629] Step 4

[0630] (2S,3R)-2-Aminopentatriacontane-1,3-diol

[0631] To a solution of (4S)-4-[(1R)-1-hydroxytriacontanoyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (110 mg, 161.73 μmol) in acetonitrile (2 mL) was added trifluoroacetic acid (92.20 mg, 808.66 μmol, 60.07 μL) in water (2 mL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate was added to the reaction mixture to adjust the pH to 8. The mixture was filtered in batches, and the filter cake was concentrated under reduced pressure. The filter cake was dispersed in hydrochloric acid / dioxane (2 M, 10 mL) at room temperature and concentrated. The crude product was slurried with methanol (10 mL) and filtered. The filter cake was lyophilized to yield (2S,3R)-2-aminopentatriacontanoic acid-1,3-diol (35.4 mg, 61.41 μmol, 37.97% yield, hydrochloride salt) as a white solid.

[0632] MS Rt = 2.158 min in 3 min chromatography, ESI calculated value C 35 H 74 NO2[M+H] + 540.6,test value 540.6.

[0633] 1 H NMR(400MHz, DMSO-d6)δ=7.23-6.74(m,3H),4.39-4.19(m,2H),3.16-3.06(m,2H),2.95-2 .88(m,1H),2.70-2.64(m,1H),0.86-0.77(m,4H),0.69-0.66(m,58H),0.30-0.24(m,3H).

[0634] Sphingosine (d36:1) & (d36:0)

[0635] Synthesis route map:

[0636] Synthesis route:

[0637] first step

[0638] Dotriacont-1-aldehyde

[0639] To a solution of dotriacontane-1-ol (20 g, 42.84 mmol) in DCM (1 L) was added pyridinium chlorochromate (PCC) (10.16 g, 47.12 mmol) and silica gel (20.00 g, 332.87 mmol). The mixture was stirred at 25°C for 1 h. The reaction mixture was combined with another batch of reaction solution (prepared from 20 g of 1A). Filtration and concentration of the filtrate afforded dotriacontane-1-aldehyde (14 g, 30.12 mmol, 35.15% yield) as a white solid.

[0640] 1 H NMR (400MHz, CDCl3) δ = 9.79 (s, 1H), 2.45-2.38 (m, 2H), 2.03-1.96 (m, 2H), 1.27-1.30 (m, 56H), 0.88 (t, J = 6.8Hz, 3H).

[0641] Step 2

[0642] Dotriacont-1-ene

[0643] To a solution of methyl(triphenyl)phosphonium bromide (6.92 g, 19.36 mmol) in THF (50 mL) at 0°C was added potassium tert-butoxide (2.17 g, 19.36 mmol). The resulting yellow suspension was stirred at 25°C for 1 h and then cooled again to 0°C. A solution of dotriacontaldehyde (3 g, 6.45 mmol) in THF (25 mL) was added dropwise at 0°C. The mixture was stirred at 25°C for 16 h. Water (50 mL) was added to the mixture, and the mixture was extracted with ethyl acetate (50 mL x 3). The combined organic phases were washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to afford dotriacontaldehyde-1-ene (880 mg, 1.90 mmol, yield: 29.46%) as a white solid.

[0644] 1 H NMR (400MHz, CDCl3) δ=5.85-5.77(m,1H),5.04-4.92(m,1H),4.90-4.86(m,1H),2.09-1.95(m,2H),1.31-1.25(m,58H),0.88(t,J=6.8Hz,3H).

[0645] Step 3

[0646] (4S)-4-[(E,1R)-1-Hydroxytetratriacont-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0647] Under a nitrogen atmosphere, to a solution of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyloxazolidine-3-carboxylate (532.02 mg, 2.07 mmol) and tritriacont-1-ene (870 mg, 1.88 mmol) in dichloromethane (12 mL) was added benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichlororuthenium; tricyclohexylphosphine (159.57 mg, 187.96 μmol). The mixture was stirred at 40°C under nitrogen for 4 h. The reaction mixture was filtered, and the filtrate was concentrated. The crude product was purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to give (4S)-4-[(E,1R)-1-hydroxytriacontane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (70 mg, 101.13 μmol, yield 5.38%) as a white solid.

[0648] 1H NMR(400MHz, CDCl3)δ=5.80-5.70(m,1H),5.48-5.40(m,1H),4.17-3.95(m,4H),2 .09-1.98(m,2H),1.61-1.55(m,15H),1.31-1.24(m,58H),0.88(t,J=6.8Hz,3H).

[0649] Step 4

[0650] (E,2S,3R)-2-Aminohexatriacontane-4-ene-1,3-diol

[0651] To a solution of (4S)-4-[(E,1R)-1-hydroxytriacontane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (70 mg, 101.13 μmol) in acetonitrile (1 mL) was added an aqueous solution (1 mL) of trifluoroacetic acid (57.66 mg, 505.67 μmol, 37.56 μL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate was added to the reaction mixture to adjust the pH to 8. The mixture was filtered in batches and the filter cake was dried under reduced pressure. The filter cake was dispersed in hydrochloric acid / dioxane (2 M, 10 mL) and concentrated. The mixture was slurried with methanol (10 mL) and lyophilized to obtain the compound (E,2S,3R)-2-aminotriacontane-4-ene-1,3-diol (32 mg, 54.38 μmol, 53.77% yield, hydrochloride salt) as a white solid.

[0652] MS Rt = 1.348 min in 1.5 min chromatography, 5-95AB, ESI calculated value C 36 H 74 NO2[M+H] + 552.6, test value 552.5.

[0653] 1 H NMR (400 MHz, DMSO-d 6 )δ=7.82-7.58(m,2H),5.84-5.68(m,1H),5.50-5.43(m,1H),5.28-5.19(m,1H),5.00-4.89(m,1H),4.30-4.19(m,1H), 3.71-3.62(m,1H),3.58-3.52(m,1H),3.35-3.32(m,1H),2.08-2.00(m,2H),1.31-1.25(m,58H),0.88(t,J=6.8Hz,3H).

[0654] Step 5

[0655] (4S)-4-[(1R)-1-Hydroxytetratriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester

[0656] To a mixed solution of (4S)-4-[(E,1R)-1-hydroxytriacontane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (170 mg, 245.61 μmol) in tetrahydrofuran (2 mL) and methanol (2 mL) was added Pd / C (130.69 mg, 122.81 μmol, 10% purity) under nitrogen. The suspension was degassed and replaced with hydrogen three times. The mixture was stirred at 50°C under a hydrogen atmosphere (50 psi) for 16 h. Tetrahydrofuran (10 mL) was added and filtered. The filter cake was washed three times with tetrahydrofuran (10 mL). The crude product obtained by concentration of the filtrate was purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain compound (4S)-4-[(1R)-1-hydroxytriacontanoyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (70 mg, 100.84 μmol, yield 41.06%) as a white solid.

[0657] 1 H NMR (400MHz, CDCl3) δ = 4.13-3.77 (m, 4H), 1.81-1.52 (m, 15H), 1.44-1.42 (m, 2H), 1.35-1.10 (m, 62H), 0.88 (t, J = 6.8Hz, 3H).

[0658] Step 6

[0659] (2S,3R)-2-Aminohexatriacontyl-1,3-diol

[0660] To a solution of (4S)-4-[(1R)-1-hydroxytriacontanoyl]-2,2-dimethyl-oxazolidine-3-carboxylic acid tert-butyl ester (70 mg, 100.84 μmol) in acetonitrile (2 mL) was added trifluoroacetic acid (57.49 mg, 504.20 μmol, 37.45 μL) in water (2 mL). The mixture was stirred at 80°C for 4 h. Saturated aqueous sodium bicarbonate was added to the reaction mixture to adjust the pH to 8. The mixture was filtered in batches, and the filter cake was dried under reduced pressure. The filtrate was dispersed in hydrochloric acid / dioxane (2 M, 10 mL) and stirred at room temperature. The crude product was slurried with methanol (10 mL) and lyophilized to obtain the compound (2S,3R)-2-aminohexacontanoyl-1,3-diol (15.2 mg, 25.74 μmol, 25.53% yield, hydrochloride salt) as a white solid.

[0661] MS Rt = 1.586 min in 3 min chromatography, ESI calculated value C 36 H 76 NO2[M+H] + 554.6, test value 554.5.

[0662] 1 H NMR (400 MHz, DMSO-d 6 )δ=7.70-7.55(m,3H),5.10-4.63(m,2H),3.70-3.62(m,2H),3.58-3.51(m,1H), 3.18-3.10(m,1H),1.40-1.38(m,2H),1.28-1.25(m,62H),0.88(t,J=6.8Hz,3H).

[0663] The lipids used in the examples of the present invention are sphingosines as shown in Table 1 below.

[0664]

[0665]

[0666]

[0667]

[0668]

[0669]

[0670] Example 2. In vitro small nucleic acid delivery study of lipid-nucleic acid complexes

[0671] 1. Cell Culture

[0672] The human pancreatic acinar epithelial carcinoma cell line HPAC, the human large cell lung cancer cell line H460, and the human embryonic kidney cell line HEK293T (purchased from the Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences) were cultured in a 37°C, 5% CO2 incubator. HPAC cells were cultured in DMEM / F12 medium, H460 cells in RPMI-1640 medium, and 293T cells in DMEM medium supplemented with 10% fetal bovine serum and 1% antibiotics (penicillin 100 U / mL and streptomycin 100 mg / mL). Cells were cultured until the logarithmic growth phase at a cell density of 6 × 10 5 / 1mL culture medium / well; plate into 12-well plates (1mL culture medium / well), incubate at 37℃ overnight (12h) before subsequent experiments.

[0673] 2. Preparation of Lipid-RNA Mixture

[0674] Add 5 μL of nucleic acid and 95 μL of DEPC-treated water to a 2 mL glass tube, mix well, then add a certain amount of lipid monomer, mix thoroughly, heat in a 90°C water bath for 15 min, and then cool naturally to obtain a nucleic acid-lipid mixture.

[0675] For example, the RNA PGY-ssRNA-26 used in this example has the sequence UCCGGAAUGAUUGGGCGUAAAGCGU (SEQ ID NO: 1).

[0676] 3. Flow cytometry (CFlow) to detect the cellular uptake of lipid-delivered nucleic acids

[0677] 1) Main experimental instruments and equipment:

[0678] 10 cm cell culture dishes, 12-well cell culture plates, pipettes, pipettes, optical microscope, flow cytometer CytoFLEX instrument (purchased from Beckman, USA)

[0679] 2) Main experimental reagents:

[0680] Model establishment and transfection: artificially synthesized lipid monomers and nucleic acids as shown in the table

[0681] 3) The human pancreatic acinar epithelial cancer cell line HPAC cells, human large cell lung cancer cell line H460 cells, and human embryonic kidney cell line HEK293T cells used in the experiment were cultured to the logarithmic growth phase and then plated into 12-well plates at a cell density of 6×10 5 / mL culture medium / well; 12-well plate, incubated at 37°C overnight (12h) before subsequent experiments.

[0682] 4) The experimental groups are as follows:

[0683] a) Blank group: refers to cells that have not been treated, and this group serves as the blank control group.

[0684] b) Free uptake group: 5 μL of fluorescently labeled nucleic acid solution (stock concentration 20 μM) was directly added, and this group served as the negative control group.

[0685] c) Lipid-nucleic acid mixture treatment group: The mixture of lipids and fluorescently labeled nucleic acids prepared in step 2 was added to the cells and mixed evenly. The final concentration of nucleic acids was 100 nM.

[0686] 5) After incubation with cells for 9 h, the cells were washed three times with PBS, resuspended in PBS (self-prepared), and the fluorescence intensity of the cells in the sample wells was detected using a flow cytometer CytoFLEX instrument (purchased from Beckman Company, USA).

[0687] The results of in vitro small nucleic acid delivery in this example are shown in Tables 2 to 4 below and Figures 1 to 3 .

[0688] The small nucleic acids used in Tables 2 to 4 were all PGY-ssRNA-26.

[0689] Table 2

[0690] Table 3

[0691] Table 4

[0692] The results show that compared to the negative control group, the experimental group showed an increased fluorescence shift, indicating that cells took up more fluorescently labeled RNA, meaning that the lipids delivered more RNA into the cells, reflecting a higher delivery efficiency. As shown in Tables 2-4, the fluorescence values ​​of the sphingosine lipids in the experimental group at a concentration of 1.25 μg / mL after delivering 0.1 nmol of nucleic acid were significantly shifted compared to the free uptake group, demonstrating that different sphingosine monomers can effectively deliver sRNA into cells. Sphingosine lipid monomers are effective for nucleic acid delivery, particularly those with carbon chain lengths of 21 or more.

Claims

1. Use of a lipid composition in the preparation of a product for delivering nucleic acids, the lipid composition comprising one or more compounds of the following formula (I): in, A is selected from the linear C 10-34 Alkyl and linear C 10-34 Alkenyl, preferably a straight chain C 10-32 Alkyl and linear C 10-32 alkenyl; Q is -OH. Preferably, the lipid composition comprises one or more compounds shown in Table 1.

2. The method according to claim 1, wherein the lipid composition comprises two or more compounds of formula (I), and optionally, the lipid composition further comprises other lipids in addition to the compounds of formula (I).

3. The use according to claim 1 or 2, wherein the product is used to deliver a nucleic acid to a subject, preferably, the agent is used to deliver a nucleic acid to a subject via oral, intramuscular, intravenous, subcutaneous, transcutaneous, intraarterial, intraperitoneal, intrapulmonary, intracerebrospinal, intraarticular, intrasynovial, intrathecal, intraventricular, and / or inhalation routes.

4. The use according to claim 1 or 2, wherein the product is used to deliver nucleic acids to cells in vitro, preferably, to deliver nucleic acids to cells in vitro by direct contact, preferably, the cells are tumor cells.

5. The method according to any one of claims 1 to 4, wherein the nucleic acid is an RNA molecule or a DNA molecule, preferably, The RNA molecule is a small RNA molecule, preferably, the RNA molecule is a small RNA molecule with a length of 14-32 nucleotides, preferably, the nucleic acid molecule is a small RNA molecule with a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides.

6. A pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein: The lipid composition comprises one or more compounds having formula (I): in, A is selected from the linear C 10-34 Alkyl or linear C 10-34 Alkenyl, preferably a straight chain C 10-32 Alkyl and linear C 10-32 alkenyl; Q is -OH, Preferably, the lipid composition comprises one or more compounds shown in Table 1.

7. The pharmaceutical composition according to claim 6, wherein the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably, The nucleic acid molecule is a small RNA molecule, preferably, the nucleic acid molecule is a small RNA molecule with a length of 14-32 nucleotides, preferably, the nucleic acid molecule is a small RNA molecule with a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides.

8. The pharmaceutical composition according to any one of claims 6-7, wherein the mass ratio of the lipid composition to the nucleic acid molecule is 1:100 to 100:

1.

9. The pharmaceutical composition of claim 8, wherein the mass ratio of the lipid composition to the nucleic acid molecule is 1:100, 1:30, 1:10, 1:3, 1:1, 3:1, 10:1, 30:1, 100:1, or a range between any of the above ratios.

10. The pharmaceutical composition according to any one of claims 6 to 9, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

11. The pharmaceutical composition according to any one of claims 6 to 10, wherein the nucleic acid molecule is an RNA molecule or a DNA molecule for treatment; preferably, the nucleic acid molecule is used to treat a disease by targeting a specific target.

12. A method for preparing the pharmaceutical composition according to any one of claims 6 to 11, comprising the following steps: 1) mixing the lipid composition with the nucleic acid molecule; The lipid composition is as defined in any one of claims 6 and 8; the nucleic acid molecule is as defined in any one of claims 7, 8 and 9.

13. The method according to claim 12, wherein the method further comprises the following steps: 2) At 25°C to 150°C, Preferably, at 25°C, 30°C, 35°C, 36°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 110°C, 120°C, 130°C, 140°C or 150°C, or a temperature in any range between these points, heating the mixture obtained in step 1) of claim 12 for at least 5 minutes, Preferably, heating is for 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 minutes.

14. A pharmaceutical composition according to any one of claims 6 to 11, or a pharmaceutical composition prepared by the method according to any one of claims 12 to 13, for use in preparing a medicament for treating a disease in a subject, preferably, the medicament is administered to the subject orally, intramuscularly, intravenously, subcutaneously, transdermally, intraarterially, intraperitoneally, intrapulmonaryly, intracerebrospinal, intraarticularly, intrasynovially, intrathecally, intraventricularly, and / or by inhalation.

15. The use according to claim 14, wherein the disease is selected from cancer, inflammation, fibrotic diseases, autoimmune diseases, infections, congenital and hereditary diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases and blood system diseases.

16. The use according to claim 15, wherein the cancer is selected from lung cancer, prostate cancer, breast cancer, head and neck cancer, esophageal cancer, stomach cancer, colon cancer, rectal cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, liver cancer, melanoma, kidney cancer, squamous cell carcinoma or hematological cancer.

17. A composition for in vitro transfection of cells, comprising a lipid composition and a nucleic acid molecule, wherein: The lipid composition comprises one or more compounds having formula (I): in, A is selected from the linear C 10-34 Alkyl or linear C 10-34 Alkenyl, preferably a straight chain C 10-32 Alkyl and linear C 10-32 alkenyl; Q is -OH; The nucleic acid molecule is a small RNA molecule.

18. A compound represented by the following formula (I): in, The A is selected from the group consisting of linear C 10-34 Alkyl and linear C 10-34 Alkenyl, preferably a straight chain C 10-32 Alkyl and linear C 10-32 alkenyl; Q is -OH, Preferably, the compound is a compound shown in Table 1.

19. A method for preparing the compound of formula (I) as claimed in claim 18, wherein the method is selected from any one of the following methods a to c: Method a. It includes: Step a1. reacting the compound represented by Formula 1 with an olefin to produce the compound represented by Formula 2; Step a2. converting the compound represented by formula 2 into a compound represented by formula (I) wherein A is a linear alkenyl group; and Optional step a3. reducing the compound represented by formula (I) wherein A is a linear alkenyl group to obtain the compound represented by formula (I) wherein A is a linear alkyl group; wherein n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32; Method b. It includes: Step b1. reacting the compound represented by Formula 1 with an olefin to produce a compound represented by Formula 2; and Step b2-1. The compound represented by Formula 2 is reduced to obtain a compound represented by Formula 3; Step b3. converting the compound represented by formula 3 into a compound represented by formula (I) wherein A is a linear alkyl group; or Step b2-2. The compound represented by Formula 2 is converted into a compound represented by Formula (I) wherein A is a linear alkenyl group; wherein n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32; Method c.

Images