Double-stranded RNA targeting angiotensinogen (AGT) and methods of use thereof

Abstract

The present disclosure relates to isolated oligonucleotides comprising duplex regions targeting angiogenin-like 3 (AGT), and delivery systems, kits, and compositions comprising the same, and methods of using the same for inhibiting or down-regulating AGT.

Description

[0001] Related applications

[0002] This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 395,445, filed on August 5, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] Incorporation by Reference into the Sequence Listing

[0004] The sequence listing XML associated with this application is provided electronically in XML file format and is hereby incorporated by reference in its entirety into the specification. The name of the XML file containing the sequence listing XML is "SANB_009_001WO_SeqList_ST26.xml". The XML file is 655,027 bytes in size and was created on August 7, 2023.

[0005] background

[0006] Angiotensinogen (mRNA) is the α2-globulin precursor of angiotensin and is a hormone produced in the liver, kidneys, adrenal glands, brain, heart and blood vessels, as well as in adipose tissue, that causes vasoconstriction and regulates blood pressure. Angiotensinogen is part of the renin-angiotensin-aldosterone system (RAAS) and plays a vital role in blood pressure regulation. Active renin in plasma cleaves angiotensinogen (produced by the liver) into angiotensin I, which is then converted to angiotensin II by circulating and locally expressed angiotensin-converting enzyme (ACE). Angiotensin II exerts its effects on the RAAS by binding to the angiotensin II type 1 receptor (AT1R), resulting in arterial vasoconstriction, tubular and glomerular effects, such as enhanced Na + Regulation of reabsorption or glomerular filtration rate. In addition, with other stimuli such as corticotropin, antidiuretic hormone, catecholamines, endothelin, 5-hydroxytryptamine and Mg 2+ and K + Together with the levels of AT1R, angiotensin II stimulation leads to the release of aldosterone, which in turn promotes Na + and K + excretion.

[0007] Due to dysregulation of RAAS and / or AT1R stimulation, excess angiotensin II production leads to hypertension. Hypertension is a major risk factor for a variety of diseases, disorders, and conditions, such as shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms (e.g., aortic aneurysms), peripheral arterial disease, cardiac damage (e.g., cardiac enlargement or hypertrophy), and other cardiovascular-related diseases, disorders, and / or conditions. Therefore, there is a need in the art for alternative and combination therapies for subjects suffering from angiotensinogen-related diseases.

[0008] Overview

[0009] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0010] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0011] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

[0012] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1.

[0013] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1.

[0014] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1.

[0015] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894.

[0016] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894.

[0017] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894.

[0018] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0019] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0020] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0021] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of AGT mRNA.

[0022] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0023] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang comprising at least one nucleotide. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang comprising two nucleotides.

[0024] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the antisense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises two nucleotides.

[0025] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG), or uracil-uracil (UU).

[0026] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence of at least 20 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence of 20 nucleotides in length.

[0027] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence of at least 22 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence of 22 nucleotides in length.

[0028] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region is between 19 and 21 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region is 20 nucleotides in length.

[0029] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense strand and sense strand sequence pairs in Tables 1-4, as described in the detailed description.

[0030] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-56.

[0031] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 57-111.

[0032] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-56; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57-111, wherein the antisense strand sequence and the sense strand sequence have sufficient complementarity to allow formation of a double-stranded region between the antisense strand and the sense strand.

[0033] In some embodiments, the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0034] In some embodiments, the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the isolated oligonucleotide inhibits AGT at a dose of 0.02 nM. The expression of the mRNA is reduced by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0035] In some embodiments, the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.1 nM.

[0036] In some embodiments, the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the isolated oligonucleotide catalyzes AGT at a dose of 0.1 nM. The expression of the mRNA is reduced by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0037] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153 ; p) 1189 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0038] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1191; 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotides are cleaved at a dose of 0.1 nM to induce AGT. Expression of the mRNA is reduced by 20% to 50% (eg, 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0039] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1191; 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotides are cleaved at a dose of 0.1 nM to induce AGT. The expression of an mRNA is reduced by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%).

[0040] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises the same oligonucleotide as that comprising a sequence selected from the group consisting of sequences according to SEQ ID 19-25 nucleotides from the 5' end of the angiotensinogen (AGT) mRNA sequence of NO:1, wherein the nucleotide sequence is substantially identical to that of the region of 19-25 nucleotides between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence of NO:1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1310 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotides attenuate the expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.02 nM.

[0041] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 5 03 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465 u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand , such that the sense and antisense strands together form a double-stranded region, the isolated oligonucleotides attenuate the expression of AGT mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%) at a dose of 0.02 nM.

[0042] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55.

[0043] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110.

[0044] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110, wherein the antisense strand sequence and the sense strand sequence have sufficient complementarity to allow formation of a double-stranded region between the antisense strand and the sense strand.

[0045] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3').

[0046] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA 3').

[0047] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3').

[0048] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3').

[0049] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA 3').

[0050] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3').

[0051] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA 3').

[0052] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA 3').

[0053] In some embodiments of the isolated oligonucleotide of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3').

[0054] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA 3').

[0055] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand, or both, comprises one or more modified nucleotides.

[0056] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a monomethyl-protected phosphate mimetic (5'-MeEP).

[0057] In some embodiments of the isolated oligonucleotides of the present disclosure, a terminal or internal nucleotide is linked to a targeting ligand in the sense strand or the antisense strand, or both.

[0058] In some embodiments of the isolated oligonucleotides of the present disclosure, the targeting ligand comprises at least one GalNAc G1b moiety.

[0059] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

[0060] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0061] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises any one of the following: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO:447 (5' [MeEPmUs][fCs][fA][mA][fA][mA][mA][fA][mU][mG][mC][fU][mG][fU][mU][mC][mA][mGs][mCs][mA] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:448 (5' [MeEPmUs][fCs][fA][mC][fU][mU][fU][mU][mU][fU][mG][mU][mU][fU][mC][fA][mC][mA][mA][mAs][mCs][mA] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:449 (5' [MeEPmUs][fCs][fA][mC][fU][mU][fU][mU][mU][fU][mG][mU][mC][fA][mC][mA][mA][mAs][mCs][mA] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:450 (5'[MeEPmUs][fUs][fU][mG][fA][mA][fA][mA][mG][fG][mA][mA][fC][mA][fC][mU][mU][mU][mUs][mUs][mU]3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO:451 (5'[MeEPmUs][fUs][fU][mG][fA][mA][fA][mA][mG][fG][mA][mA][fC][mA][fC][mU][mU][mU][mUs][mUs][mU]3'); NO:451 (5'[MeEPmUs][fCs][fA][mA][fU][mU][fU][mU][mU][fG][mU][mU][mC][fU][mC][fA][mA][mC][mU][mUs][mGs][mA]3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:452 (5'[MeEPmUs][fAs][fA][mA][fA][mC][fC][mC][mA][fA][mU][mU][mU][fU][mU][fG][mU][mU][mC][mUs][mCs][mA]3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:453 (5'[MeEPmUs][fAs][fA][mA][fA][mC][fC][mC][mA][fA][mU][mU][mU][fU][mU][fG][mU][mU][mC][mUs][mCs][mA]3'); The antisense strand of the nucleic acid sequence of NO:453 (5'[MeEPmUs][fAs][fU][mU][fU][mU][fA][mA][mA][fA][mC][mC][mC][fA][mA][fU][mU][mU][mUs][mGs][mU]3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:454 (5'[MeEPmUs][fAs][fU][mA][fC][mU][fU][mU][mA][fA][mU][mU][mU][fU][mA][fA][mA][mC][mCs][mCs][mA]3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:455 (5'[MeEPmUs][fUs][fA][mU][fA][mC][fU][mU][mU][fA][mA][mU][mU][fU][mA][mA][mCs][mCs][mC]3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO:456 (5'[MeEPmUs][fUs][fA][mU][fA][mC][fU][mU][mU][fA][mA][mA][mCs][mCs][mC]3'); NO:456 (5'[mUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:457 (5'[EPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'); or xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:458 (5'[EPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'); The antisense strand of the nucleic acid sequence of NO:458 (5'[MeEPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl-protected phosphate mimic.;

[0062] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises any one of the following: i) the sense strand of the nucleic acid sequence according to SEQ ID NO:460 (5' [mCs][mUs][mG][mA][mA][fC][mA][fG][fC][fA][fU][mU][mU][mU][mU][mU][mU][mUs][mGs][mA][G1b][G1b][G1b] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO:461 (5' [mUs][mUs][mU][mG][mU][fG][mA][fA][fC][fA][mA][mA][mA][mA][mG][mUs][mGs][mA][G1b][G1b][G1b] 3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO:463 (5'[mAs][mAs][mA][mA][mG][fU][mG][fU][fU][fC][fC][mC][mU][mU][mU][mC][mAs][mA][mA][G1b][G1b][G1b]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO:464 (5'[mAs][mAs][mA][mA][mG][fU][mG][fU][fU][fC][fC][mC][mU][mU][mU][mC][mAs][mA][mA][G1b][G1b][G1b]3'); NO:464 (5'[mAs][mAs][mG][mU][mU][fG][mA][fG][fA][fC][mA][mA][mA][mA][mA][mU][mUs][mGs][mA][G1b][G1b][G1b]3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO:465 (5'[mAs][mGs][mA][mA][mC][fA][mA][fA][fA][fA][fU][mU][mG][mG][mU][mU][mUs][mA][G1b][G1b][G1b]3'); vii) the sense strand of the nucleic acid sequence according to SEQ ID NO:466 (5'[mAs][mGs][mA][mA][mC][fA][mA][fA][fA][fU][mU][mG][mG][mU][mU][mUs][mA][G1b][G1b][G1b]3'); The sense strand of the nucleic acid sequence of NO:466 (5'[mAs][mAs][mA][mA][mA][fU][mU][fG][fG][fG][fU][mU][mU][mU][mA][mA][mA][mAs][mUs][mA][G1b][G1b][G1b]3');viii) the sense strand of the nucleic acid sequence according to SEQ ID NO:467 (5' [mGs][mGs][mU][mU][mU][fU][mA][fA][fA][fU][mU][mA][mA][mG][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'); ix) the sense strand of the nucleic acid sequence according to SEQ ID NO:468 (5' [mGs][mUs][mU][mU][mU][fA][mA][fA][fU][fU][mA][mA][mG][mU][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); or x) the sense strand of the nucleic acid sequence according to SEQ ID NO:469 (5' [mGs][mGs][mUs][mU][mU][mU][fA][mA][fA][fU][fU][mA][mA][mG][mU][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); The sense strand of the nucleic acid sequence of NO:469 (5'[mUs][mCs][mA][mU][mC][fC][mA][fC][fA][fA][fU][mG][mA][mG][mA][mG][mU][mAs][mCs][mA][G1b][G1b][G1b]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "G1b" is a GalNAc G1b moiety.;

[0063] The present disclosure also provides vectors encoding the isolated oligonucleotides disclosed herein.

[0064] The present disclosure also provides a delivery system comprising the isolated oligonucleotide or vector disclosed herein.

[0065] The present disclosure also provides pharmaceutical compositions comprising an isolated oligonucleotide disclosed herein, a vector or delivery system, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0066] The present disclosure also provides kits comprising the isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein.

[0067] The present disclosure also provides a method of inhibiting or downregulating the expression or level of AGT in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide, vector, delivery system or pharmaceutical composition disclosed herein.

[0068] The present disclosure also provides a method of inhibiting or downregulating the expression or level of AGT in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a first oligonucleotide and at least a second oligonucleotide disclosed herein, wherein the first oligonucleotide and at least the second oligonucleotide comprise different sequences.

[0069] The present disclosure also provides a method of treating or preventing a disease or disorder associated with abnormal or increased expression or activity of AGT, or a disease or disorder in which AGT plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide, vector, delivery system or pharmaceutical composition disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 Graph showing the efficacy of the siRNA compounds listed in Table 2 at 0.02 nM in silencing human AGT in cultured Huh-7 cells. Compounds were transfected into cells at a concentration of 0.02 nM. Data are presented as the % of human AGT mRNA remaining relative to mock transfection when normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0072] Figure 2 Graph showing the efficacy of the siRNA compounds listed in Table 2 at 0.1 nM in silencing human AGT in cultured Huh-7 cells. Compounds were transfected into cells at a concentration of 0.1 nM. Data are presented as the % of human AGT mRNA remaining relative to mock transfection when normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0073] Figure 3 is a graph showing the in vivo efficacy of the compounds listed in Table 3 in mouse HDI livers at day 4 after dosing at 1 mg / kg. Data are presented as % of human AGT mRNA remaining relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0074] Figure 4 Graph showing the in vivo dose response in mouse HDI livers at day 4 following dosing of the compounds listed in Table 3 at 0.3 mg / kg, 1 mg / kg, or 3 mg / kg. Data are presented as % of human AGT mRNA remaining relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0075] Figure 5A-5B TABLE 4 is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 4 in cynomolgus monkeys (Macaca fascicularis) after a single subcutaneous (sc) dose of 3 mg / kg. The remaining cynomolgus monkey AGT mRNA ( Figure 5A ) and the remaining serum AGT protein ( Figure 5B ). Data were normalized to the pre-dose mRNA or protein levels of each animal.

[0076] Detailed description

[0077] The present disclosure provides isolated oligonucleotides (oligonucleotides / oligonucleotide(s)), preferably small interfering RNA (siRNA), that form double-stranded regions that can reduce AGT mRNA expression, which in turn leads to a reduction in the extent of AGT protein expression in target cells. The oligonucleotides disclosed herein may have therapeutic applications for modulating AGT expression for the treatment of diseases including, but not limited to, cardiovascular disease (CVD), hypertension, atherosclerosis, and the like.

[0078] The present disclosure has identified specific regions within AGT mRNA that provide targets for binding of double-stranded oligonucleotides (eg, siRNA), resulting in decreased expression levels of AGT mRNA.

[0079] The AGT mRNA sequence described herein is based on the AGT mRNA sequence of accession number NM_001384479.1:

[0080]

[0081]

[0082] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0083] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

[0084] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

[0085] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1.

[0086] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1.

[0087] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1.

[0088] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: (a) 1829 to 1849 and (b) 1837 to 1857.

[0089] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: (a) 1829 to 1849 and (b) 1837 to 1857.

[0090] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: (a) 1829 to 1849 and (b) 1837 to 1857.

[0091] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894.

[0092] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894.

[0093] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894.

[0094] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an AGT selected from the group consisting of AGT according to SEQ ID NO: 1. The nucleotide sequence is essentially the same in the region between any one of the following nucleotide positions from the 5' end of the mRNA sequence: a) 166 to 186; b) 176 to 196; c) 493 to 414; d) 460 to 480; e) 744 to 764; f) 778 to 798; g) 929 to 949; h) 948 to 968; i) 1110 to 1130; j) 1134 to 1154; k) 1306 to 1326; l) 1311 to 1331; m) 1410 to 1430; n) 1605 to 1629; o) 1643 to 1676; p) 1726 to 1752; q) 1785 to 1805; r) 1816 to 1894.

[0095] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an AGT selected from the group consisting of AGT according to SEQ ID NO: 1. 176 to 196; c) 493 to 414; d) 460 to 480; e) 744 to 764; f) 778 to 798; g) 929 to 949; h) 948 to 968; i) 1110 to 1130; j) 1134 to 1154; k) 1306 to 1326; l) 1311 to 1331; m) 1410 to 1430; n) 1605 to 1629; o) 1643 to 1676; p) 1726 to 1752; q) 1785 to 1805; r) 1816 to 1894.

[0096] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an AGT selected from the group consisting of AGT according to SEQ ID NO: 1. 1311 to 1331; m) 1410 to 1430; n) 1605 to 1629; o) 1643 to 1676; p) 1726 to 1752; q) 1785 to 1805; r) 1816 to 1894.

[0097] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0098] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0099] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882.

[0100] The AGT mRNA sequence according to SEQ ID NO: 1 as described herein is any heterologous mRNA sequence having sufficient identity to AGT according to accession number NM_001384479.1 as described herein to allow binding to the antisense strand of the oligonucleotides of the present disclosure.

[0101] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of AGT mRNA.

[0102] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0103] In some embodiments, the isolated oligonucleotides of the present disclosure are small interfering RNAs (siRNAs). Accordingly, the present disclosure provides siRNAs, wherein the siRNA comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and wherein the sense region comprises a sequence that is at least 70% to 100% identical to an AGT mRNA sequence.

[0104] definition

[0105] "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). Duplex RNA siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA, DNA-directed RNA), piRNA (Piwi interacting RNA) or rasiRNA (repeat-associated siRNA) and modified forms thereof can mediate RNA interference. These dsRNA molecules can be commercially available, or can be designed and prepared based on known sequence information. The antisense strand of these molecules can include RNA, DNA, PNA or a combination thereof. These DNA / RNA chimera polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit target gene expression. These dsRNA molecules can also include one or more modified nucleotides as described herein that can be incorporated into any chain.

[0106] In the RNAi gene silencing or knockdown process, a dsRNA comprising a first (antisense) strand complementary to a portion of a target gene and a second (sense) strand fully or partially complementary to the first antisense strand is introduced into an organism. After introduction into the organism, the target gene-specific dsRNA is processed into relatively small fragments (siRNA) and can subsequently become distributed throughout the organism, reducing the messenger RNA of the target gene, resulting in a phenotype that may be close to that caused by a complete or partial deletion of the target gene.

[0107] Some dsRNAs in cells can undergo the action of the Dicer enzyme (ribonuclease III enzyme). Dicer can process dsRNA into shorter dsRNA fragments, i.e., siRNAs. RNAi also involves a nuclease endonuclease complex called the RNA-induced silencing complex (RISC). After being cleaved by Dicer, the siRNA enters the RISC complex and guides the cleavage of a single-stranded RNA target having a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. The cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex. Therefore, siRNA can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0108] As used herein, "target gene" or "target sequence" refers to a gene or gene sequence whose corresponding RNA is targeted for degradation via the RNAi pathway using dsRNA or siRNA as described herein. To target a gene, for example, using siRNA to target a gene, the siRNA comprises an antisense region that is complementary or substantially complementary to at least a portion of the target gene or sequence and a sense strand that is complementary to the antisense strand. Once introduced into a cell, the siRNA directs the RISC complex to cleave RNA containing the target sequence, thereby degrading the RNA.

[0109] As used herein, "oligonucleotide," "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides, regardless of the length of the chain. Nucleic acids can be double-stranded or single-stranded. Wherein single-stranded nucleic acids can be sense strands or antisense strands. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base pairing abilities or increased resistance to nucleases. The present disclosure also provides nucleic acids that are complements (which can be complete complements or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the present disclosure. When synthesizing dsRNA, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and other bases can also be used for antisense, dsRNA, and ribozyme pairing. Other modifications can also be made, such as modifications to the phosphodiester backbone or 2'-fluoro, 2'-hydroxy, or 2'O-methyl in the ribose group of the RNA.

[0110] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemical substances (when chemically synthesized). Additionally, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that does not naturally occur as a fragment and would not be found in nature. "Isolated" does not mean that the preparation is technically pure (homogeneous), but rather that it is sufficiently pure to provide the polypeptide or nucleic acid in a form useful for its intended purpose.

[0111] The terms "region" or "fragment" are used interchangeably and apply to oligonucleotides.

[0112] Unless otherwise indicated, references to AGT mRNA sequences as described herein will be understood to mean full-length AGT mRNA nucleotide sequences. In some embodiments, the AGT mRNA sequence may be a nucleotide sequence comprising, consisting essentially of, and / or consisting of a nucleotide sequence of contiguous nucleotides identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98% or 99% identical) to a reference nucleic acid or nucleotide sequence of the AGT mRNA sequence, that is reduced in length relative to the reference nucleic acid or nucleotide sequence. Where appropriate, such nucleic acid fragments according to the present disclosure may be included in larger polynucleotides of which they are components. In some embodiments, such fragments may comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more contiguous nucleotides of a nucleic acid or nucleotide sequence according to the present disclosure.

[0113] As used herein, "complementary" polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form combinations of guanine and cytosine (G:C) pairing and adenine and thymine (A:T) pairing (in the case of DNA) or adenine and uracil (A:U) pairing (in the case of RNA). For example, the sequence "AGT" binds to the complementary sequence "TCA". It will be understood that two polynucleotides can hybridize to each other even if they are not completely complementary to each other, provided that they each have at least one region that is substantially complementary to the other.

[0114] As used herein, the term "substantially complementary" is at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) complementary to the sense strand, i.e., substantially identical to the nucleotide sequence within the region defined in SEQ ID NO: 1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary at at least about 90%, 95% or 99% of their nucleotides.

[0115] In some embodiments, two nucleic acid sequences can be complementary at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be complementary at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be complementary at least 90%, 70% to 100%, 95% and 96%, 90% and 100%, 96% to 97%, 60% to 80%, 97% and 98%, 70% and 90%, 98% and 99%, 80% and 100% or 99% and 100%.

[0116] The term "substantially complementary" can also mean that the two nucleic acid sequences of the sense strand and the antisense strand have sufficient complementarity to allow the sense strand and the antisense strand to bind to form a double-stranded region of 19-25 nucleotides in length. The term "substantially complementary" can also mean that the two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0117] As used herein, the terms "substantially identical" or "sufficient identity" are used interchangeably herein and refer to at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., between 70% and 80%, 85% and 90%, or 90% and 95%, or 95% and 99%, or 99% and 100%) identical to the nucleotide sequence within the defined region in SEQ ID NO: 1.

[0118] As used herein, the term "identity" means that sequences are compared to each other as follows. In order to determine the percent identity of two nucleic acid sequences, the sequences can first be aligned relative to each other so that the comparison of these sequences can be made possible subsequently. For this reason, for example, a room can be inserted into the sequence of the first nucleic acid sequence, and the corresponding positions of nucleotides and the second nucleic acid sequence can be compared. If the position in the first nucleic acid sequence is occupied by the same nucleotide as the position in the second sequence, the two sequences are identical at this position. The percent identity between the two sequences is a function of the number of the same positions divided by the number of all positions compared in the sequence under investigation.

[0119] For aligned segments of a test and reference sequence, "percent identity" or "% identity," as used interchangeably herein, is the percentage of identical components shared by the two aligned sequences divided by the total number of components in the segment of the reference sequence (i.e., the entire reference sequence or a smaller defined portion of the reference sequence).

[0120] Unless otherwise indicated, "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein.

[0121] The percent identity of two sequences can be determined by means of a mathematical algorithm. A preferred but non-limiting example of a mathematical algorithm that can be used for the comparison of two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is integrated into the NBLAST program, which can be used to identify sequences with the desired identity to the sequences of the present disclosure. In order to obtain a gapped alignment, as described herein, a "Gapped BLAST" program can be used, such as described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. If BLAST and Gapped BLAST programs are used, the preset parameters of a specific program (e.g., NBLAST) can be used. Sequences can be further aligned using version 9 of the GAP (Global Alignment Program) of the "Genetic Computing Group" using a preset (BLOSUM62) matrix (values ​​-4 to +11) with a gap open penalty of -12 (for the first zero in a gap) and a gap extension penalty of -4 (for each additional consecutive zero in a gap). After alignment, percent identity is calculated by expressing the identity number as the percentage content of the nucleic acid in the claimed sequence. If necessary, the method described for determining the percent identity of two nucleic acid sequences can also be used correspondingly for the encoded amino acid sequence.

[0122] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and in Carillo, H. and Lipton, D., (Applied Math 48: 1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from the National Center for Biotechnology Information (NCBI) at the U.S. National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)); BLAST programs, version 2.0 or later, allow for the introduction of gaps (deletions and insertions) in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; and, for polynucleotide sequences, BLASTN can be used to determine sequence identity. The percent identity can be 70% identity or greater, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0123] As used herein, "heterologous" refers to a nucleic acid sequence that is derived from another species or from the same species or organism but modified from its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence derived from an organism or species different from the cell into which the nucleotide sequence is introduced is heterologous with respect to that cell and the progeny of that cell. Additionally, heterologous nucleotide sequences include nucleotide sequences derived from and inserted into the same native original cell type, but which exist in a non-native state, e.g., a different copy number, and / or under the control of regulatory sequences different from those found in nature.

[0124] Double-stranded RNA targeting AGT

[0125] The present disclosure provides isolated oligonucleotides comprising a double-stranded RNA (dsRNA) duplex region targeting an AGT mRNA sequence for degradation. The double-stranded RNA molecules of the present disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate that is processed in a cell to produce siRNA. In other embodiments, the double-stranded RNA molecule is a part of a microRNA precursor molecule.

[0126] In some embodiments, the dsRNA is a small interfering RNA (siRNA) that targets an AGT mRNA sequence for degradation. In some embodiments, the siRNA targeting AGT is packaged in a delivery system (e.g., nanoparticle) described herein.

[0127] The isolated oligonucleotides targeted to AGT for degradation of the present disclosure may comprise a sense strand that is at least 70% identical to any fragment of AGT mRNA (e.g., the AGT mRNA of SEQ ID NO: 1). In some embodiments, the sense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO: 1. The siRNA targeted to AGT for degradation may comprise an antisense strand that is at least 70% identical to a sequence that is complementary to any fragment of AGT mRNA (e.g., the AGT mRNA of SEQ ID NO: 1). In some embodiments, the antisense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence that is complementary to any fragment of SEQ ID NO: 1. In some embodiments, the sense and antisense regions are complementary and base-paired to form an RNA duplex structure. The segment of AGT mRNA that has a percent identity with the sense region of the siRNA and is complementary to the antisense region of the siRNA can be the protein coding sequence of the mRNA, the untranslated region (UTR) of the mRNA (5'UTR or 3'UTR), or both.

[0128] In some embodiments, the isolated oligonucleotides of the present disclosure comprise a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and the sense region comprises a sequence at least 70% identical to an AGT mRNA sequence. In some embodiments, the sense region is identical to an AGT mRNA sequence.

[0129] As used herein, the term "sense strand" or "sense region" refers to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of an siRNA molecule. The sense strand of an isolated oligonucleotide of the present disclosure can include a nucleic acid sequence that has a certain percentage of identity with a target nucleic acid sequence, such as an AGT mRNA sequence. In some cases, the sense region can have 100% identity, i.e., complete identity or homology, to the target nucleic acid sequence. In other cases, one or more mismatches can exist between the sense region and the target nucleic acid sequence. For example, there can be 1, 2, 3, 4, 5, 6, or 7 mismatches between the sense region and the target nucleic acid sequence.

[0130] As used herein, the term "antisense strand" or "antisense region" refers to a nucleotide sequence in an isolated oligonucleotide of the present disclosure that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of a molecule of the present disclosure may include a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0131] In some embodiments, the sense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region comprises a sequence that is identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein.

[0132] In some embodiments, the sense region of the isolated oligonucleotide targeting AGT of the present disclosure has one or more mismatches between the sequence of the isolated oligonucleotide and the AGT sequence. For example, the sequence of the sense region can have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the AGT sequence. In some embodiments, the AGT sequence is an AGT 3' untranslated region sequence (3'UTR). Without wishing to be bound by theory, it is believed that siRNAs targeting the 3'UTR have increased mismatch tolerance when compared to mismatches in isolated oligonucleotides targeting the coding region of a gene. In addition, isolated oligonucleotide RNAs can tolerate mismatches outside the seed region. As used herein, the "seed region" of an isolated oligonucleotide refers to base pairs 2-8 of the antisense region of the isolated oligonucleotide, that is, the strand of the isolated oligonucleotide that is complementary to and hybridizes with the target mRNA.

[0133] In some embodiments, the antisense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1 as disclosed herein. In some embodiments, the antisense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1. In some embodiments, the antisense region comprises a sequence that is identical to a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1. In some embodiments, the sense region consists essentially of a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1.

[0134] The antisense region of the isolated oligonucleotides targeting AGT of the present disclosure is complementary to the sense region. In some embodiments, the sense region and the antisense region are fully complementary (no mismatches). In some embodiments, the antisense region is partially complementary to the sense region, i.e., there are 1, 2, 3, 4, or 5 mismatches between the sense region and the antisense region.

[0135] Typically, the isolated oligonucleotides of the present disclosure comprise RNA duplexes of about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplexes are between about 17 and about 24 nucleotides in length, between about 18 and about 23 nucleotides in length, or between about 19 and about 22 nucleotides in length. In some embodiments, the RNA duplexes are 19 nucleotides in length. In some embodiments, the RNA duplexes are 20 nucleotides in length.

[0136] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules. In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide is an siRNA targeting AGT, which comprises two different single-stranded RNAs, the first comprising a sense region and the second comprising an antisense region, which hybridize to form an RNA duplex.

[0137] In some embodiments, the isolated oligonucleotides of the present disclosure may have one or more overhangs from the duplex region. An overhang is a non-base-paired single-stranded region that can be from 1 to 8 nucleotides or longer. An overhang can be a 3' overhang, wherein the 3' end of the chain has a single-stranded region of from 1 to 8 nucleotides. An overhang can be a 5' overhang, wherein the 5' end of the chain has a single-stranded region of from 1 to 8 nucleotides.

[0138] The overhangs of the isolated oligonucleotides of the present disclosure can be the same length, or can be different lengths.

[0139] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang comprising at least one nucleotide. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang comprising two nucleotides.

[0140] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the antisense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises two nucleotides.

[0141] In other embodiments, the isolated oligonucleotides of the present disclosure have overhangs at both ends, for example, 3' dinucleotide overhangs at each end. The overhangs at the 5' and 3' ends can be different lengths or the same length.

[0142] The overhangs of the isolated oligonucleotides of the present disclosure may comprise one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both overhang nucleotides of the siRNA may be 2'-deoxyribonucleotides.

[0143] In some embodiments, the first single-stranded RNA molecule comprises a first 3' overhang. In some embodiments, the second single-stranded RNA molecule comprises a second 3' overhang. In some embodiments, the first 3' overhang and the second 3' overhang comprise dinucleotides.

[0144] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments, the isolated oligonucleotides of the present disclosure, the 3' overhang comprises thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises uracil-uracil (UU) overhang. Without wishing to be bound by theory, it is believed that the 3' overhang (such as a dinucleotide overhang) enhances siRNA-mediated mRNA degradation by enhancing siRNA-RISC complex formation and / or enhancing the rate at which the target mRNA is cleaved by the siRNA-RISC complex.

[0145] In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more blunt ends, wherein the duplex region end does not have an overhang, and the chain is base-paired with the duplex region end. In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhangs. For example, the 5' end of the siRNA can be blunt, and the 3' end of the same isolated oligonucleotide can include an overhang, or vice versa.

[0146] In some embodiments, the isolated oligonucleotides of the present disclosure have blunt ends at both ends.

[0147] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense strand and sense strand sequence pairs in Tables 1-4, as described below.

[0148]

[0149]

[0150]

[0151] In some embodiments, the sense region comprises a sequence selected from any one of the groups of sense / passenger strand sequences listed in Tables 1-4. In some embodiments, the antisense region comprises a sequence selected from any one of the groups of antisense / guide strand sequences listed in Tables 1-4. In some embodiments, the sense region and the antisense region comprise complementary sequences selected from the group listed in Tables 1-4.

[0152] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-56.

[0153] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 57-111.

[0154] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-56; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57-111, wherein the antisense strand sequence and the sense strand sequence have sufficient complementarity to allow formation of a double-stranded region between the antisense strand and the sense strand.

[0155] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: 1829 to 1857, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3').

[0156] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f) 1726 to 1894, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: NO:60 (5'CAAUGAGAGUACCUGUGAGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:6 (5'UCAUAGCUCACUGUGCAUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5'GCAUGCACAGUGAGCUAUGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5'UUAGAGAGAGGCCAGGGUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:62 (5'GCACCCUGGCCUCUCUAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO:8 (5'UUGAAGUCCAGAGAGCGUGGGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:63 (5'CCACGCUCUCUGGACUUCAA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO:9 (5'UCUGUCAAUCUUCUCAGCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:64 (5'CUGCUGAGAAGAUUGACAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:10 (5'UGUCCACCCAGAACUCCUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:65 (5'CCAGGAGUUCUGGGUGGACA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAGCACCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'AGGUGCUGAACAGCAUUUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUGA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: NO:72 (5'CGCCCAUUCCUGUUUGCUGA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA 3');xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCCUUGGUCUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UGUUUCACAAACAAGCUGGUCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5'ACCAGCUUGUUUGUGAAACA 3');xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5'UUUUUUUGUUUCACAAACAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:84 (5'UUGUUUGUGAAACAAAAAAA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:85 (5'UUUGUGAAACAAAAAAGUGA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5'UCUUGAAAAGGGAACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:86 (5'AAAGUGUUCCCUUUUCAAGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO:32 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'CCUUUUCAAGUUGAGAACAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:90 (5'AAGUUGAGAACAAAAAUUGA 3'); and xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:36 (5'UUUUUAAAACCCAAUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:91 (5'CAAAAAUUGGGUUUUAAAAA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:37 (5'UAUUUUAAAACCCAAUUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:92 (5'AAAAAUUGGGUUUUAAAAUA 3');xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UUUAAUUUUAAAACCCAAUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'AAUUGGGUUUUAAAAUUAAA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3'); or xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO:51 (5'UCUCAUUAGAAGAAAAGGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:106 (5'CACCUUUUCUUCUAAUGAGA 3');

[0157] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; f) 1814 to 1835; and g) 1843 to 1882, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: NO:98 (5'GUCAUCCACAAUGAGAGUAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:45 (5'UAUGAACCUGUCAAUCUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:100 (5'AGAAGAUUGACAGGUUCAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO:46 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:101 (5'GAUUGACAGGUUCAUGCAGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAGGUUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UGAACCUGCAAAAAUUGAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'UUUUCACAAACAAGCUGGUCGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'GACCAGCUUGUUUGUGAAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA 3'); or xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID The sense strand of the nucleic acid sequence of NO:110 (5'AGAACAAAAAUUGGGUUUUA 3').

[0158] In some embodiments, the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0159] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM. The double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA3'); iii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUAA 3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'GCACCCUGGCCUCUCUAA 3'); NO:8 (5'UUGAAGUCCAGAGAGCGUGGGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:63 (5'CCACGCUCUCUGGACUUCAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO:9 (5'UCUGUCAAUCUUCUCAGCAGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:64 (5'CUGCUGAGAAGAUUGACAGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:10 (5'UGUCCACCCAGAACUCCUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:65 (5'CCAGGAGUUCUGGGUGGACA3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:76 (5'UGGAAAGCAGCCGUUUCUCA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:22 (5'UUUAGACCAAGGAGAAACGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:77 (5'CCGUUUCUCCUUGGUCUAAA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:23 (5'UCUUAGACCAAGGAGAAACGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:78 (5'CGUUUCUCCUUGGUCUAAGA 3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 32 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'CCUUUUCAAGUUGAGAACAA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUGGGUUUUAAAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UUUAAUUUUAAAACCCAAUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'AAUUGGGUUUUAAAAUUAAA3');xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:42 (5'UGUAGUACCCAGAACAACGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:97 (5'CCGUUGUUCUGGGUACUACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:47 (5'UCUCAAUUUUUGCAGGUUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:102 (5'UGAACCUGCAAAAAUUGAGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:42 (5'UGUAGUACCCAGAACAACGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:97 (5'CCGUUGUUCUGGGUACUACA 3'); 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA 3'); or xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA 3').

[0160] In some embodiments, the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the isolated oligonucleotide inhibits AGT at a dose of 0.02 nM. The expression of the mRNA is reduced by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0161] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from the group consisting of: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and attenuates expression of AGT mRNA by attenuating expression of AGT mRNA by at least 50% at a dose of 0.02 nM, the double-stranded region comprising: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3'), and ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3'. NO:57 (5'UGAAACAAAAAAGUGUUCCA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:58 (5'AAAAGUGUUCCCUUUUCAAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:4 (5'UCUCUCAUUGUGGAUGACGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:59 (5'UCGUCAUCCACAAUGAGAGA3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:70 (5'UGCUGAACAGCAUUUUUUUA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UUGUUUGUGAAACAAAAAAA3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UCUUGAAAAGGGAACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'AAAGUGUUCCCUUUUCAAGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:46 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:101 (5'GAUUGACAGGUUCAUGCAGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:49 (5'UUAGAAGAAAAGGUGGGAGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:104 (5'UCUCCCACCUUUUCUUCUAA 3');xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA 3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA3'); or the antisense strand of the nucleic acid sequence according to SEQ ID NO: 1 The antisense strand of the nucleic acid sequence of SEQ ID NO:45 (5'UAUGAACCUGUCAAUCUUCUCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:100 (5'AGAAGAUUGACAGGUUCAUA 3');

[0162] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the isolated oligonucleotide attenuates expression of AGT mRNA, and expression of AGT mRNA is attenuated by the isolated oligonucleotides of the present disclosure at a dose of 0.1 nM by 50% to 75% (e.g., between 50% to 55%, between 55% to 60%, between 60% to 65%, between 65% to 70%, or between 70% to 75%).

[0163] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence selected from the group consisting of: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and attenuates expression of AGT mRNA by at least 50% at a dose of 0.1 nM, the double-stranded region comprising: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCA 3'), and i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO:6 (5'UCAUAGCUCACUGUGCAUGCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:61 (5'GCAUGCACAGUGAGCUAUGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:7 (5'UUAGAGAGAGGCCAGGGUGCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:62 (5'GCACCCUGGCCUCUCUCUAA3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:8 (5'UUGAAGUCCAGAGAGCGUGGGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:63 (5'CCACGCUCUCUGGACUUCAA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUGAGAAGAUUGACAGA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO:55 (5'UAAAACCCAAUUUUUGUUCUCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAGCACCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'AGGUGCUGAACAGCAUUUUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA 3');xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA 3');xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UGUUUCACAAACAAGCUGGUCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5'ACCAGCUUGUUUGUGAAACA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'AAAGUGUUCCCUUUUCAAGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'UUGUUUGUGAAACAAAAAAA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UUGUGUGAAACAAAAAAGUGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA 3');xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUGGGUUUUAAAAA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUUAAAAUA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAUUUUAAAACCCAAUUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA 3') (63.2); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA 3');xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:45 (5'UAUGAACCUGUCAAUCUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:100 (5'AGAAGAUUGACAGGUUCAUA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:46 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:101 (5'GAUUGACAGGUUCAUGCAGA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:47 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:102 (5'GAUUGACAGGUUCAUGCAGA 3'); 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UCUCAUUAGAAGAAAAGGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'CACCUUUUCUUCUAAUGAGA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA 3');Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'UUUUCACAAACAAGCUGGUCGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'GACCAGCUUGUUUGUGAAAA3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA3'); or Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA 3');

[0164] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 115 3; p) 1189 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.

[0165] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises the same oligonucleotide as that comprising a sequence selected from the group consisting of sequences according to SEQ ID 19-25 nucleotides from the 5' end of the angiotensinogen (AGT) mRNA sequence of NO:1, wherein the nucleotide sequence is substantially identical to that of the region of 19-25 nucleotides between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence of NO:1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1310 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotides attenuate the expression of AGT mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45% or 45% to 50%) at a dose of 0.02 nM.

[0166] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1209 ; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and wherein the isolated oligonucleotides catalyze AGT at a dose of 0.02 nM. Expression of the mRNA is reduced by 20% to 50% (eg, 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%). The double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UCUGUAGUACCCAGAACAACGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'GUUGUUCUGGGUACUACAGA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UAUACCCUUCUGCUGUAGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5'UACUACAGCAGAAGGGUAUA3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UCACAGGUACUCUCAUUGUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'CACAAUGAGAGUACCUGUGA3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UCAUUGGCCUUUGCCAGCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5'CAGCUGGCAAAGGCCAAUGA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UCUCAACUUGUCUUCGGUGUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'ACACCGAAGACAAGUUGAGA3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UAGAAGUUGGCCAGCAUCCCGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5'GGGAUGCUGGCCAACUUCUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5'UCAAGAAGUUGGCCAGCAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5'GAUGCUGGCCAACUUCUUGA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UGGAAGCCCAAGAAGUUGGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5'GCCAACUUCUUGGGCUUCCA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUAUAUACGGAAGCCCAAGAAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'UCUUGGGCUUCCGUAUAUAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUGCCAUAUAUACGGAAGCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5'GCUUCCGUAUAUAUGGCAUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGUGCCAAAGACAGCCGUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CAACGGCUGUCUUUGGCACA 3');xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'UAUAGAGAGAGGCCAGGGUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CACCCUGGCCUCUCUCUAUA3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UGAUUGCCUGUAGCCUGUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'UGACAGGCUACAGGCAAUCA3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCAGUUCUUGUCCUUCCAAGGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 409 (5'CUUGGAAGGACAAGAACUGA3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UUAUAGAGAGCCAGGCCCUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5'CCUGGCUUUCAACACCUACA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UCAGAACUCCUGGGGCUCGGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCAGAACUCCUGGGGCUCGGCC 3'). NO:413 (5'CCGAGCCCCAGGAGUUCUGA3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UGACACUGAGGUGCUGUUGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5'ACAACAGCACCUCAGUGUCA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCUCUCAGUGAAGGGCACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 414 (5'AAGUGCCCUUCACUGAGAGA 3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAAGUGAGACCCUCCACCUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'AAGGUGGAGGGUCUCACUUA3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGGAAAGUGAGACCCUCCACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5'GUGGAGGGUCUCACUUUCCA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UCUGGAAAGUGAGACCCUCCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5'GGAGGGUCUCACUUUCCAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UCUGGAAAGUGAGACCCUCCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'GGAGGGUCUCACUUUCCAGA 3'); NO: 169 (5'UGUUUUGCUGGAAAGUGAGACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5'UCUCACUUUCCAGCAAAACA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGAGUUUUGCUGGAAAGUGAGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'UCACUUUCCAGCAAAACUCA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAGUUGAGGGAGUUUUGCUGGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'CAGCAAAACUCCCUCAACUA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UGAGUUUUGCUGGAAAGUGAGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5'UCACUUUCCAGCAAAACUCA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UUUUCUUCAUCCAGUUGAGGGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'CCUCAACUGGAUGAAGAAAA3');xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'UUAAGAUCCUUGCAGCACCAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 415 (5'UGGUGCUGCAAGGAUCUUAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGAAUGGCGGGCAGCUCAGCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5'GCUGAGCUGCCCGCCAUUCA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'CCGAGCUGAACCUGCAAAAA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5'CCGAGCUGAACCUGCAAAAA 3'); 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGA 3'). 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGAGAGAGCCCACAGAGUCA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UUAGACUCUGUGGGCUCUCUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'AGAGAGCCCACAGAGUCUAA 3');xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UCAAACAGGAAUGGGCGGUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AACCGCCCAUUCCUGUUUGA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UAUCAUACACAGCAAACAGGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'CCUGUUUGCUGUGUAUGAUA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUCAUACACAGCAAACAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5'CUGUUUGCUGUGUAUGAUCA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'UAGAAAAGGUGGGAGACUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UAAGAAAAGGUGGGAGACUGGG 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UAAGAAAAGGUGGGAGACUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5'UAAGAAAAGGUGGGAGACUGGG 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5'CAGUCUCCCACCUUUUCUUA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'UCUAAAAUAAACCCAGCAAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5'UUUGCUGGGUUUAUUUUAGA 3');xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UAUUCUCUAAAAUAAACCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5'UGGGUUUAUUUUAGAGAAUA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UUUUGGAACAGUAGUCCCGCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GCGGGACUACUGUUCCAAAA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UUUUUGGAACAGUAGUCCCGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 440 (5'CGGGACUACUGUUCCAAAAA 3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UUUUUGGAACAGUAGUCCCGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCAAACAAGCUGGUCGGUUGGA 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'CAACCGACCAGCUUGUUUGA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'UUUUUUGUUUCACAAACAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUUGUUUGUGAAACAAAAAA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UAAAAGGGAACACUUUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'CAAAAAAGUGUUCCCUUUUUA 3');Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUUAAAACCCAAUUUUUGUUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'ACAAAAAUUGGGUUUUAAAA3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UCUUUAAUUUUAAAACCCAAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'UUGGGUUUUAAAAUUAAAGA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UAUACAAACCGAAGGCAAUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAUUGCCUUCGGUUUGUAUA3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 221 (5'UAAUACAAACCGAAGGCAAUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'AUUGCCUUCGGUUUGUAUUA3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'UCUAAAUACAAACCGAAGGCAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5'GCCUUCGGUUUGUAUUUAGA3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'UCACUAAAUACAAACCGAAGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CUUCGGUUUGUAUUUAGUGA3'); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UAAGACACUAAAUACAAACCGAAGGCAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 396 (5'GCCUUCGGUUUGUAUUUAGA3'). 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 392 (5'GGUUUGUAUUUAGUGUCUUA 3'); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UCAAGACACUAAAUACAAACCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 393 (5'GUUUGUAUUUAGUGUCUUGA 3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'UGAGAAAUAACCAGCUAUGGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5'CCAUAGCUGGUUAUUUCUCA 3');or Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UAAGACGUUUAUUACUAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403 (5'UGUUAGUAAUAAACGUCUUA 3');

[0167] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 5 03 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465 u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand , such that the sense and antisense strands together form a double-stranded region, the isolated oligonucleotides attenuate the expression of AGT mRNA by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%) at a dose of 0.02 nM.

[0168] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 118 9 to 1209; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and wherein the isolated oligonucleotides are at 0.3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU 3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA 3'). 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UUAAACACUGGUUCUUGCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'AGGCAAGAACCAGUGUUUAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UCAACUUGAAAAGGGAACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'GUGUUCCCUUUUCAAGUUGA 3'); or v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'UUUUAAUUUUAAAACCCAAUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'AUUGGGUUUUAAAAUUAAAA3').

[0169] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1191; 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotides are cleaved at a dose of 0.1 nM to induce AGT. Expression of the mRNA is reduced by 20% to 50% (eg, 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0170] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1209 ; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and wherein the isolated oligonucleotide, at a dose of 0.1 nM, causes AGT Expression of the mRNA is reduced by 20% to 50% (eg, 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%). The double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UCUGUAGUACCCAGAACAACGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'GUUGUUCUGGGUACUACAGA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UCAUUGGCCUUUGCCAGCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5'CAGCUGGCAAAGGCCAAUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGUGCCAAAGACAGCCGUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CAACGGCUGUCUUUGGCACA 3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'UAUAGAGAGAGGCCAGGGUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CACCCUGGCCUCUCUCUAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UGAUUGCCUGUAGCCUGUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'UGACAGGCUACAGGCAAUCA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCAGUUCUUGUCCUUCCAAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 409 (5'CUUGGAAGGACAAGAACUGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UUAUAGAGAGCCAGGCCCUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410 (5'CAGGGCCUGGCUCUCUAUAA3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'UGUAGGUGUUGAAAGCCAGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5'CCUGGCUUUCAACACCUACA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UCAGAACUCCUGGGGCUCGGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 413 (5'CCGAGCCCCAGGAGUUCUGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGUCCACCCAGAACUCCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: NO: 324 (5'AGGAGUUCUGGGUGGACAAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UGACACUGAGGUGCUGUUGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5'ACAACAGCACCUCAGUGUCA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCUCUCAGUGAAGGGCACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 414 (5'AAGUGCCCUUCACUGAGAGA3');xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAAGUGAGACCCUCCACCUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'AAGGUGGAGGGUCUCACUUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGGAAAGUGAGACCCUCCACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5'GUGGAGGGUCUCACUUUCCA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UCUGGAAAGUGAGACCCUCCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5'GGAGGGUCUCACUUUCCAGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 171 (5'UAGUUGAGGGAGUUUUGCUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'CAGCAAAACUCCCUCAACUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGAAUGGCGGGCAGCUCAGCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5'GCUGAGCUGCCCGCCAUUCA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'UAAUUUUUGCAGGUUCAGCUCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5'AGCUGAACCUGCAAAAAUUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UAUGCUGUUCAGCACCUCCCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 418 (5'GGGAGGUGCUGAACAGCAUA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UUAGACUCUGUGGGCUCUCUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'AGAGAGCCCACAGAGUCUAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UCAAACAGGAAUGGGCGGUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AACCGCCCAUUCCUGUUUGA 3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UAUCAUACACAGCAAACAGGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'CCUGUUUGCUGUGUAUGAUA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UAAGAAAAGGUGGGAGACUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5'CAGUCUCCCACCUUUUCUUA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'UCUAAAAUAAACCCAGCAAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5'UUUGCUGGGUUUAUUUUAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5'UGUCGGUUGGAAUUCUUUUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'AAAAAGAAUUCCAACCGACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCAAACAAGCUGGUCGGUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'CAACCGACCAGCUUGUUUGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UCUUUAAUUUUAAAACCCAAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'UUGGGUUUUAAAAUUAAAGA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UAUACAAACCGAAGGCAAUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAUUGCCUUCGGUUUGUAUA 3');xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'UAAUACAAACCGAAGGCAAUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'AUUGCCUUCGGUUUGUAUUA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'UCACUAAAUACAAACCGAAGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CUUCGGUUUGUAUUUAGUGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UAAGACACUAAAUACAAACCGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 392 (5'GGUUUGUAUUUAGUGUCUUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UAAGACACUAAAUACAAACCGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 397 (5'GGUUUGUAUUUAGUGUCUUA 3'); 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UAAGACGUUUAUUACUAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403 (5'UGUUAGUAAUAAACGUCUUA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UGGAUGACGAGGUGGAAGGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'CCCUUCCACCUCGUCAUCCA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCUCAUUGUGGAUGACGAGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5'CCUCGUCAUCCACAAUGAGA 3');xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UACAAGCUGGUCGGUUGGAAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 443 (5'UUCCAACCGACCAGCUUGUA3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UCUUUGCCAGCUGCUCACAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5'CUGUGAGCAGCUGGCAAAGA3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'UUUUCAUCCACAGGGGAUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 406 (5'ACAUCCCCUGUGGAUGAAAA 3'); xLI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UAUAUAUACGGAAGCCCAAGAA 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5'CUUGGGCUUCCGUAUAUAUA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5'UCAUAUAUACGGAAGCCCAAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5'UUGGGCUUCCGUAUAUAUGA 3');xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUGCCAUAUAUACGGAAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5'CUUCCGUAUAUAUGGCAUGA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCUGUGCAUGCCAUAUAUACGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5'GUAUAUAUGGCAUGCACAGA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5'UCAAAGACAGCCGUUGGGGAGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5'UCCCCAACGGCUGUCUUUGA3'); xLx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 277 (5'UUUCCAAGGAACACCCAGGAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5'UCCUGGGUGUUCCUUGGAAA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UGACCUUGUGCGCAUCCAGCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5'GCUGGAUGCGCACAAGGUCA3'); L1) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5'UCAAACGGCUGCUUCAGGUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5'CACCUGAAGCAGCCGUUUGA3'); LII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5'UCACAAACGGCUGCUUCAGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5'CCUGAAGCAGCCGUUUGUGA 3'); LIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UUAGAGAGCCAGGCCCUGCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5'UGCAGGGCCUGGCUCUCUAA 3'); LIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UAAGUCCAGAGAGCGUGGGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5'UCCCACGCUCUCUGGACUUA 3');LV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UGUGAAGUCCAGAGAGCGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5'CACGCUCUCUGGACUUCACA 3'); LVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'UUUCUGUGAAGUCCAGAGAGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 411 (5'CUCUCUGGACUUCACAGAAA3'); LVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'UUCUCAGCAGCAACAUCCAGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 445 (5'CUGGAUGUUGCUGCUGAGAA 3'); LVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UCUGUUGUCCACCCAGAACUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5'AGUUCUGGGUGGACAACAGA 3'); LIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UGUGAGACCCUCCACCUUGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5'ACAAGGUGGAGGGUCUCACA3'); LX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UGAAAGUGAGACCCUCCACCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 333 (5'GGUGGAGGGUCUCACUUUCA3'); LXI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UAUCCAGUUGAGGGAGUUUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: NO:340 (5'AAAACUCCCUCAACUGGAUA 3'); LXII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UCAGAAUGGCGGGCAGCUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5'UGAGCUGCCCGCCAUUCUGA 3'); LXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UCUGUUCAGCACCUCCCCCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 417 (5'UGGGGGAGGUGCUGAACAGA 3');LXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5'UAAAAAAUGCUGUUCAGCACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5'GUGCUGAACAGCAUUUUUUA3'); LXV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'UAAAAAAAAUGCUGUUCAGCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5'GCUGAACAGCAUUUUUUUUA3'); LXVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGAGA 3'); LXVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 252 (5'UCAGGAAUGGGCGGUUCAGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 419 (5'CCUGAACCGCCCAUUCCUGA 3'); LXVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'UCACAGCAAACAGGAAUGGGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5'CCCAUUCCUGUUUGCUGUGA3'); LXIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UAUACACAGCAAACAGGAAUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5'AUUCCUGUUUGCUGUGUAUA3'); LXX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'UUUGAUCAUACACAGCAAACAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5'GUUUGCUGUGUAUGAUCAAA 3'); LXXI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5'UUUUGAUCAUACACAGCAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5'UUUGCUGUGUAUGAUCAAAA 3');LXXII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UGAAGUGCAGGGCAGUGGCGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 422 (5'CGCCACUGCCCUGCACUUCA3'); LXXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'UCAGGAAGUGCAGGGCAGUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5'CACUGCCCUGCACUUCCUGA 3'); LXXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5'UCUCAUGCUGUGCUCAGCGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 423 (5'CCGCUGAGCACAGCAUGAGA 3'); LXXV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 195 (5'UCUGGGGCCCUGGCCUCAUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5'CAUGAGGCCAGGGCCCCAGA 3'); LXXVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'UAAAAGGUGGGAGACUGGGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5'CCCCAGUCUCCCACCUUUUA 3'); LXXVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'UGAAAAGGUGGGAGACUGGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5'CCCAGUCUCCCACCUUUUCA 3'); LXXVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'UGAAAAGGUGGGAGACUGGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5'CCCAGUCUCCCACCUUUUCA 3'); NO: 271 (5'UCUUUCCAGCUCAAAGUCGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5'UCGACUUUGAGCUGGAAAGA 3'); LXXIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5'UUAAACCCAGCAAACUGGGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 424 (5'UCCCAGUUUGCUGGGUUUAA 3');LXXX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'UCUGGUUCUUGCCUCCCCACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'GUGGGGAGGCAAGAACCAGA3'); LXXXI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'UAAACACUGGUUCUUGCCUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5'GAGGCAAGAACCAGUGUUUA 3'); LXXXII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'UGUUGGAAUUCUUUUUGGAACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 427 (5'UUCCAAAAAGAAUUCCAACA3'); LXXXIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UAAACACUGGUUCUUGCCUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'GAGGCAAGAACCAGUGUUUA 3'); NO: 209 (5'UUUGUUUCACAAACAAGCUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5'CAGCUUGUUUGUGAAACAAA3'); LXXXIV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5'UUUUUGUUUCACAAACAAGCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'GCUUGUUUGUGAAACAAAAA 3'); LXXXV) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5'UCUUACAUUCAAGACACUAAAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5'UUAGUGUCUUGAAUGUAAGA 3'); LXXXVI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5'UUUUUGUUUCACAAACAAGCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'GCUUGUUUGUGAAACAAAAA 3'); NO: 229 (5'UGUCAUGUUCUUACAUUCAAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 396 (5'UUGAAUGUAAGAACAUGACA 3'); LXXXVII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'UGAAAUUCAGGUGCUUGCAUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 429 (5'AUGCAAGCACCUGAAUUUCA 3');LXXXVIII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'UAACAGAAAUUCAGGUGCUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 430 (5'AAGCACCUGAAUUUCUGUUA 3'); LXXXIX) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5'UCAUUCAAACAGAAAUUCAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 432 (5'CUGAAUUUCUGUUUGAAUGA 3'); XC) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5'UGAAAUAACCAGCUAUGGUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 433 (5'AACCAUAGCUGGUUAUUUCA 3'); XCI) the antisense strand of the nucleic acid sequence according to SEQ ID NO: NO: 196 (5'UGUGUUCUGGGGCCCUGGCCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5'GGCCAGGGCCCCAGAACACA 3'); or XCII) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCUUCUGCUGUAGUACCCAGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'CUGGGUACUACAGCAGAAGA 3');

[0171] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 1191; 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotides are cleaved at a dose of 0.1 nM to induce AGT. The expression of an mRNA is reduced by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%).

[0172] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 215; c) 264 to 284; d) 303 to 323; e) 325 to 345; f) 355 to 405; g) 441 to 481; h) 503 to 552; i) 560 to 580; j) 690 to 731; k) 742 to 802; l) 863 to 883; m) 922 to 966; n) 1036 to 1056; o) 1099 to 1153; p) 1189 to 120 9; q) 1233 to 1255; r) 1258 to 1282; s) 1300 to 1367; t) 1403 to 1465; u) 1479 to 1517; v) 1601 to 1624; w) 1631 to 1651; x) 1722 to 1753; y) 1756 to 1861; z) 1863 to 1890; aa) 1901 to 1948; ab) 2017 to 2047; ac) 2049 to 2071; and ad) 2075 to 2095, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and wherein the isolated oligonucleotides at a dose of 0.1 nM catalyze the activation of AGT. 3'); and ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UCACAGGUACUCUCAUUGUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'CACAAUGAGAGUACCUGUGA 3'). 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UCUCAACUUGUCUUCGGUGUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'ACACCGAAGACAAGUUGAGA3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UAGAAGUUGGCCAGCAUCCCGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5'GGGAUGCUGGCCAACUUCUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UGGAAGCCCAAGAAGUUGGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5'GCCAACUUCUUGGGCUUCCA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUAUAUACGGAAGCCCAAGAAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'UCUUGGGCUUCCGUAUAUAA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUGCCAUAUAUACGGAAGCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5'GCUUCCGUAUAUAUGGCAUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAACCUGUCAAUCUUCUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5'UGAGAAGAUUGACAGGUUCA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UGUUUUGCUGGAAAGUGAGACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5'UCUCACUUUCCAGCAAAACA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGAGUUUUGCUGGAAAGUGAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'UCACUUUCCAGCAAAACUCA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UUUUCUUCAUCCAGUUGAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'CCUCAACUGGAUGAAGAAAA3');xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'UUAAGAUCCUUGCAGCACCAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 415 (5'UGGUGCUGCAAGGAUCUUAA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'CCGAGCUGAACCUGCAAAAA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UUUUUUGCAGGUUCAGCUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5'CGAGCUGAACCUGCAAAAAA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'UUUUUUGCAGGUUCAGCUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5'UGGUGCUGCAAGGAUCUUAA 3'); 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'UCAAUUUUUGCAGGUUCAGCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 350 (5'GCUGAACCUGCAAAAAUUGA3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UCUCUCAUCCGCUUCAAGCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 436 (5'AGCUUGAAGCGGAUGAGAGA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGACUCUGUGGGCUCUCUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGAGAGAGCCCACAGAGUCA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'UAACAGGAAUGGGCGGUUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5'UGAACCGCCCAUUCCUGUUA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUCAUACACAGCAAACAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5'CUGUUUGCUGUGUAUGAUCA 3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'UAGAAAAGGUGGGAGACUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5'CCAGUCUCCCACCUUUUCUA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUUAAAACCCAAUUUUUGUUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'ACAAAAAUUGGGUUUUAAAA3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'UAAUAAACCCAGCAAACUGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 425 (5'CCAGUUUGCUGGGUUUAUUA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UUAAACACUGGUUCUUGCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'AGGCAAGAACCAGUGUUUAA3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UUUUGGAACAGUAGUCCCGCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GCGGGACUACUGUUCCAAAA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UCUUUUUGGAACAGUAGUCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 441 (5'GGACUACUGUUCCAAAAAGA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'UUUCUUUUUGGAACAGUAGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 442 (5'ACUACUGUUCCAAAAAGAAA 3');xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'UUUUUUGUUUCACAAACAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUUGUUUGUGAAACAAAAAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UAAAAGGGAACACUUUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'CAAAAAAGUGUUCCCUUUUUA3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UCAACUUGAAAAGGGAACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'GUGUUCCCUUUUCAAGUUGA3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5'UCAACUUGAAAAGGGAACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5'GUGUUCCCUUUUCAAGUUGA3'); The antisense strand of the nucleic acid sequence of SEQ ID NO: 218 (5'UUUUAAUUUUAAAACCCAAUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'AUUGGGUUUUAAAAUUAAAA 3');

[0173] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55.

[0174] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110.

[0175] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2, 3, 16, 30, 35, 37, 40, 41, 44, or 55; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110, wherein the antisense strand sequence and the sense strand sequence have sufficient complementarity to allow formation of a double-stranded region between the antisense strand and the sense strand.

[0176] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide comprises: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13-36, wherein the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18-31, wherein the third modification and the fourth modification are different.

[0177] In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 18-21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 20-23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 20 or 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 22 or 23. In some embodiments, the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is equal to the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure plus 2 nucleotides. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 20, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 22.

[0178] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide comprises: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first modification and the second modification are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third modification and the fourth modification are the same or different.

[0179] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, in the sense strand or antisense strand of the isolated oligonucleotide of the present disclosure, or in both the sense strand and the antisense strand, the modified phosphate backbone comprises a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by replacing one or more oxygen atoms with a portion, wherein the portion is bonded to the phosphorus atom in the phosphodiester bond with a carbon, nitrogen or sulfur atom in the portion, or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate diester, methylsulfonylphosphoramidate or phosphonoacetate.

[0180] In some embodiments, the isolated oligonucleotides of the present disclosure comprise one or more nucleotides containing non-natural bases, locked nucleotides, or abasic nucleotides. In some embodiments, the isolated oligonucleotides of the present disclosure have a terminal nucleotide at the 5' end comprising a phosphate mimic. In some embodiments, the 5'-phosphate mimic is ethylphosphonate, vinylphosphonate, or an analog thereof.

[0181] In some embodiments, the antisense strand of an isolated oligonucleotide of the present disclosure comprises at least two single-stranded nucleotides at the 3' terminus. In some embodiments, the antisense strand of an isolated oligonucleotide of the present disclosure comprises two single-stranded nucleotides at the 3' terminus.

[0182] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1311 to 1331 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3').

[0183] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1825 to 1845 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3').

[0184] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1829 to 1849 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3').

[0185] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1837 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3').

[0186] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1854 to 1874 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3').

[0187] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1860 to 1880 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3').

[0188] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1865 to 1885 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3').

[0189] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1873 to 1893 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3').

[0190] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1874 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3').

[0191] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region between nucleotide positions 169 to 189 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises an antisense strand of a nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and a sense strand of a nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA3').

[0192] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the isolated oligonucleotide attenuates expression of AGT mRNA by 20% to 50% (e.g., between 20% to 25%, between 25% to 30%, between 30% to 35%, between 35% to 40%, between 40% to 45%, or between 45% to 50%) at a dose of 0.02 nM.

[0193] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and attenuates expression of AGT mRNA by 20% to 50% at a dose of 0.02 nM, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UGAAACAAAAAAGUGUUCCA 3'). NO:90 (5'AAGUUGAGAACAAAAAUUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:37 (5'UAUUUUAAAACCCAAUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:92 (5'AAAAAUUGGGUUUUAAAAUA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO:44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA 3');

[0194] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the isolated oligonucleotide attenuates expression of AGT mRNA by at least 50% (e.g., between 50% to 55%, between 55% to 60%, between 60% to 65%, between 65% to 70%, between 70% to 75%, between 75% to 80%, between 80% to 85%, between 85% to 90%, between 90% to 95%, or between 95% to 100%) at a dose of 0.1 nM.

[0195] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region that attenuates expression of AGT mRNA by at least 50% at a dose of 0.1 nM, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO:44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA 3');

[0196] In some embodiments, the isolated oligonucleotides of the present disclosure may include a linker, sometimes referred to as a loop. siRNAs comprising a linker or loop are sometimes referred to as short hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of the siRNA are encoded by a single-stranded RNA. In these embodiments, the antisense and sense regions hybridize to form a duplex region. The sense and antisense regions are connected by a linker sequence to form a "hairpin" or "stem-loop" structure. The siRNA may have complementary sense and antisense regions at the opposite ends of the single-stranded molecule, such that the molecule can form a duplex region with complementary sequence portions, and the chains are connected by a linker at one end of the duplex region. The linker may be a nucleotide linker or a non-nucleotide linker or a combination thereof. The linker may interact with the first chain and optionally the second chain by covalent bonds or non-covalent interactions.

[0197] Any suitable nucleotide linker sequence is contemplated to be within the scope of the present disclosure. The siRNA of the present disclosure may include nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linkers that connect the sense region of the nucleic acid to the antisense region of the nucleic acid. The nucleotide linker may be a linker of ≥2 nucleotides in length, for example, about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides in length.

[0198] Examples of non-nucleotidic linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, sugars, lipids, polyhydrocarbons or other polymerizing agents, for example polyethylene glycol, such as those having from 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910, and Ferentz et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 4000-4002.

[0199] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.

[0200] In some embodiments, the isolated oligonucleotide of the present disclosure is an siRNA, which may be a dsRNA of a length suitable as a Dicer substrate, which may be processed to produce a RISC-active siRNA molecule. See, e.g., Rossi et al., US 2005 / 0244858.

[0201] Dicer substrate double-stranded RNA (dsRNA) can be of sufficient length to be processed by Dicer to produce an active siRNA, and can further include one or more of the following properties: (i) the Dicer substrate dsRNA can be asymmetric, e.g., having a 3' overhang on the antisense strand, (ii) the Dicer substrate dsRNA can have a modified 3' end on the sense strand to direct the orientation of Dicer binding and processing of the dsRNA into an active siRNA, e.g., having incorporation of one or more DNA nucleotides, and (iii) the length of the first and second strands of the Dicer substrate dsRNA can range from 19 bp to 30 bp.

[0202] In some embodiments, the isolated oligonucleotides of the present disclosure comprise at least one modified nucleotide. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise one or more modified nucleotides. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand comprise one or more modified nucleotides. In some embodiments, the isolated oligonucleotides are partially chemically modified. In some embodiments, the isolated oligonucleotides are completely chemically modified.

[0203] In some embodiments, the isolated oligonucleotide comprises at least two modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least three modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least four modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least five modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least seventeen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least eighteen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least nineteen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least twenty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises more than twenty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises between twenty and thirty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises between thirty and forty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises between forty and fifty modified nucleotides.

[0204] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified nucleotide. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least ten modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eleven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least twelve modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least thirteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least fourteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least fifteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least sixteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seventeen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eighteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nineteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least twenty modified nucleotides.

[0205] In some embodiments, wherein the oligonucleotide of separation comprises more than one modified nucleotide, at least the first nucleotide comprises the first modification, and at least the second nucleotide comprises the second modification. In some embodiments, the first modification and the second modification are different. In some embodiments, at least the first nucleotide and at least the second nucleotide are positioned on the different chains of the oligonucleotide of separation. In some embodiments, at least the first nucleotide and at least the second nucleotide are positioned on the same chain of the oligonucleotide of separation.

[0206] In some embodiments of the isolated oligonucleotide, wherein the isolated oligonucleotide comprises more than one modified nucleotide, at least the first modified nucleotide comprises the first modification, and at least the second modified nucleotide comprises the second modification, and at least the third nucleotide comprises the third modification. In some embodiments, the isolated oligonucleotide comprises the first modification, the second modification, the third modification, and the fourth modification. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all modifications are on the sense strand. In some embodiments, all modifications are on the antisense strand. Any combination of the positions of the modifications between the sense strand and the antisense strand is envisioned within the isolated oligonucleotide of the present disclosure.

[0207] In some embodiments, the modified nucleotides are located continuously on the sense strand or the antisense strand, or both. In some embodiments, some but not all of the modified nucleotides are located continuously on the sense strand or the antisense strand, or both. In some embodiments, the modified nucleotides are located discontinuously on the sense strand or the antisense strand, or both.

[0208] Contemplated within the present disclosure are isolated oligonucleotides in which any nucleotide on the sense or antisense strand can be modified. In some embodiments, any nucleotide on the sense strand can be modified. In some embodiments, any nucleotide on the antisense strand can be modified.

[0209] In some embodiments, the oligonucleotide of the separation of the present disclosure comprises at least one modified nucleotide.In some embodiments, the nucleotide of one or more modifications increases the stability or effectiveness or both of the oligonucleotide of separation.In some embodiments, the nucleotide of one or more modifications increases the stability of RNA duplexes and siRNA.

[0210] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term "locked nucleic acid" or "LNA" includes, but is not limited to, modified RNA nucleotides in which the ribose moiety comprises a methylene bridge connecting the 2' oxygen and the 4' carbon. The methylene bridge locks the ribose in a 3'-endo conformation, also known as the northern conformation, a conformation found in A-type RNA duplexes. The term inaccessible RNA can be used interchangeably with LNA. LNAs with 2'-4' loop connections are described in International Patent Applications WO 99 / 14226, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604, the contents of which are incorporated herein by reference.

[0211] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, wherein the isolated oligonucleotides of the present disclosure comprise a modified phosphate backbone, the modified phosphate backbone comprises a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by replacing one or more oxygen atoms with a moiety, wherein the moiety is bonded to a phosphorus atom in the phosphodiester bond with a carbon, nitrogen, or sulfur atom in the moiety, or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises a phosphorothioate, a phosphorodithioate, a methylphosphonate, a phosphoramidate diester, a methylsulfonylphosphoramidate, or a phosphonoacetate.

[0212] In some embodiments, the isolated oligonucleotides of the present disclosure comprise one or more nucleotides containing non-natural bases, locked nucleotides or abasic nucleotides. In some embodiments, the nucleotides of one or more modifications comprise nucleotides substituted with thiophosphate derivatives or acridines. In some embodiments, the isolated oligonucleotides of the present disclosure comprise phosphate mimics at the 5' end of the antisense strand, including but not limited to vinylphosphonate or other phosphate analogs. In some embodiments, the 5'-phosphate mimics are ethylphosphonate, vinylphosphonate or its analogs.

[0213] In some embodiments, the modified nucleotides include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, uracil, 5-methyl-aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl quercetin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentenyl adenine, uracil-5-hydroxyacetic acid (v), wybutoxosine, pseudouracil, Q-side, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w or 2,6-diaminopurine.

[0214] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise a terminal or internal nucleotide connected to one or more targeting ligands. In some embodiments, the terminal or internal nucleotide is directly connected to one or more targeting ligands. In some embodiments, the terminal or internal nucleotide is indirectly connected to one or more targeting ligands via a linker. In some embodiments, one or more targeting ligands directly or indirectly connected to the terminal or internal nucleotide may further comprise a PK modulator. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or a fragment thereof, an aptamer, an albumin, a fibrinogen, and folic acid.

[0215] Nucleotide modification

[0216] Provided herein are isolated oligonucleotides comprising: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13-36, wherein the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18-31, wherein the third modification and the fourth modification are different.

[0217] In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 18-21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 20-23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 20 or 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 22 or 23. In some embodiments, the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is equal to the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure plus 2. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 20, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 22.

[0218] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide comprises: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first modification and the second modification are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third modification and the fourth modification are the same or different.

[0219] In some embodiments, the first modification is a modification selected from the group consisting of a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof, at the 2'-position of the sugar moiety of at least one nucleotide. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof.

[0220] In some embodiments, the second modification is a modification selected from 2'-C1-C6 alkyl, 2'-OR modification, 2'-amino and morpholino substitution, and equivalents and combinations thereof at the 2'-position of the sugar portion of one or more remaining nucleotides, wherein R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamide, phenyl, or a heteroaryl group comprising a 5-membered ring or a 6-membered ring and 1 or 2 heteroatoms selected from N, O, and S. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.

[0221] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification.

[0222] In some embodiments, the third modification is a modification at the 2'-position of the sugar portion of at least one nucleotide selected from the group consisting of a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof.

[0223] In some embodiments, the fourth modification is a modification of the 2'-position of the sugar portion of one or more remaining nucleotides selected from 2'-C1-C6 alkyl, 2'-OR modification, 2'-amino and morpholino substitutions, and equivalents and combinations thereof, wherein R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamide, phenyl, or a heteroaryl group comprising a 5-membered ring or a 6-membered ring and 1 or 2 heteroatoms selected from N, O, and S. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.

[0224] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification.

[0225] sense strand

[0226] In some embodiments of the isolated oligonucleotides of the present disclosure comprising a sense strand and an antisense strand, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three nucleotides are modified with a first modification. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least two of the at least three nucleotides modified with the first modification are positioned contiguously. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three of the at least three nucleotides modified with the first modification are positioned contiguously.

[0227] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least four nucleotides in the sense strand are modified with a first modification. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three of the at least four nucleotides modified with the first modification are positioned contiguously. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least four of the at least four nucleotides modified with the first modification are positioned contiguously.

[0228] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least five nucleotides in the sense strand are modified with the first modification. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three of the at least five nucleotides modified with the first modification are positioned contiguously. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least four of the at least five nucleotides modified with the first modification are positioned contiguously.

[0229] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with the first modification are located from position 10 to position 15 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0230] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, two of the at least three nucleotides modified with the first modification are located at positions selected from 10, 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions selected from 10, 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least three nucleotides modified with the first modification is located at position 11 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand.

[0231] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 12, 13, and 14 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, and 12 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand.

[0232] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 10 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 11 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 12 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 14 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 15 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0233] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least four nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0234] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0235] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified with a first modification, wherein the five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 of the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0236] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, the at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with a first modification are not all positioned contiguously. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, the at least three nucleotides, the at least four nucleotides, or the at least five nucleotides are modified with a 2'-F modification.

[0237] In some embodiments, the sense strand of an isolated oligonucleotide of the present disclosure comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

[0238] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.

[0239] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to any one of SEQ ID NO: 57, 58, 71, 85, 90, 92, 95, 96, 99, or 110.

[0240] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:71.

[0241] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:71, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:16.

[0242] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:85.

[0243] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:85, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:30.

[0244] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:57.

[0245] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:57, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:2.

[0246] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:58.

[0247] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f(M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:58, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:3.

[0248] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:90.

[0249] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:90, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:35.

[0250] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 110.

[0251] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 110, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 55.

[0252] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:92.

[0253] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:92, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:37.

[0254] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:95.

[0255] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f(M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:95, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:40.

[0256] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:96.

[0257] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:96, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:41.

[0258] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', the sense strand comprises the nucleotide sequence according to SEQ ID NO:99.

[0259] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises the nucleotide sequence according to SEQ ID NO:99, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:44.

[0260] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1311 to 1331 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3').

[0261] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1825 to 1845 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3').

[0262] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1829 to 1849 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3').

[0263] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1837 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3').

[0264] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1854 to 1874 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3').

[0265] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1860 to 1880 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3').

[0266] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1865 to 1885 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA3').

[0267] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1873 to 1893 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'GGUUUUAAAAUUAAAGUAUA3').

[0268] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1874 to 1894 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5'GUUUUAAAAUUAAAGUAUAA3').

[0269] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 169 to 189 from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA 3').

[0270] Antisense strand

[0271] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, up to seven nucleotides are modified with the third modification.

[0272] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, up to four of the up to seven nucleotides modified with the third modification are located at position 2 to position 8 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at least one of the up to seven nucleotides modified with the third modification is located at position 2 from the first nucleotide at the 5' terminus of the antisense strand.

[0273] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at most two of the up to seven nucleotides modified with the third modification are positioned contiguously. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at most two of the up to seven nucleotides modified with the third modification are positioned contiguously at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0274] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at least one of the up to seven nucleotides modified with the third modification is located at position 14 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two or three of the up to seven nucleotides modified with the third modification are located at positions selected from 2, 3, 5, and 6 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with the third modification are located at positions selected from 2, 3, 5, and 6 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 2 and 5 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0275] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with the third modification are located at positions 2, 3, and 5 from the first nucleotide at the 5' end of the antisense strand.

[0276] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one or two of the up to seven nucleotides modified with the third modification are located at positions selected from 14 and 16 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 14 and 16 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, the up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 14 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 14 and 16 from the first nucleotide at the 5' terminus of the antisense strand.

[0277] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand comprises up to seven nucleotides modified with the third modification, the up to seven nucleotides modified with the 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 7 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 10 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 14 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 16 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, the up to seven nucleotides modified with the third modification are located at positions 2, 3, 5, 7, 10, 14, and 16 from the first nucleotide at the 5' terminus of the antisense strand.

[0278] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, the antisense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M)o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

[0279] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NO: 2, 3, 16, 30, 35, 37, 40, 41, 44 or 55.

[0280] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j(M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 16.

[0281] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 16, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 71.

[0282] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F)d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:30.

[0283] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:30, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:85.

[0284] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"): 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:2.

[0285] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:2, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:57.

[0286] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:3.

[0287] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i(F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:3, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:58.

[0288] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:35.

[0289] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M)c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:35, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:90.

[0290] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:55.

[0291] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:55, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:110.

[0292] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:37.

[0293] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:37, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:92.

[0294] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M)i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:40.

[0295] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:40, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:95.

[0296] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b(M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:41.

[0297] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:41, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:96.

[0298] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:44.

[0299] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO:44, and the sense strand comprises the nucleotide sequence according to SEQ ID NO:99.

[0300] Targeting ligands

[0301] In some embodiments, in the sense strand or antisense strand of the isolated oligonucleotide of the present disclosure, or both, a terminal or internal nucleotide is connected to a targeting ligand. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 5' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 3' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 5' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides of at least two single-stranded nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure.

[0302] In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folic acid. In some embodiments, the targeting ligand binds to a surface protein on a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand mediates entry of the isolated oligonucleotide of the present disclosure into a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure.

[0303] In some embodiments, the targeting ligand is a therapeutic ligand. In some embodiments, the targeting ligand is a therapeutic antibody.

[0304] In some embodiments, the targeting ligand is attached to the isolated oligonucleotide of the present disclosure via a linker. In some embodiments, the linker is any one of a protein, DNA, RNA, or a chemical compound. In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a scaffold. As used herein, the term "scaffold" refers to a compound or complex comprising a linker of the present disclosure, wherein the linker is covalently attached to the ligand or the isolated oligonucleotide or both.

[0305] In some embodiments, the isolated oligonucleotide of the present disclosure, a linker, and a targeting ligand form a conjugate. As used herein, the term "conjugate" refers to a compound or complex comprising an isolated oligonucleotide covalently attached to a ligand via a linker of the present disclosure.

[0306] As used herein, the term "targeting ligand" or "ligand" refers to a moiety that, when covalently attached to a GalNAc oligonucleotide, is capable of mediating its entry into, promoting, or allowing its delivery to a target site (e.g., a target cell or tissue). In some embodiments, the targeting ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can direct the uptake of the oligonucleotide into the liver.

[0307] In some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR).In some embodiments, the targeting ligand binds (e.g., via the ASGPR) to the liver, such as a parenchymal cell of the liver.

[0308] Suitable targeting ligands include, but are not limited to, those disclosed in Winkler (Ther. Deliv., 2013, 4(7):791-809), PCT Patent Application Publication Nos. WO / 2016 / 100401, WO / 2012 / 089352, and WO / 2009 / 082607, and U.S. Patent Application Publication Nos. 2009 / 0239814, 2012 / 0136042, 2013 / 0158824, and 2009 / 0247608, each of which is incorporated by reference.

[0309] In some embodiments, the targeting ligand comprises a carbohydrate moiety.

[0310] As used herein, "carbohydrate moiety" refers to a moiety comprising one or more monosaccharide units, each monosaccharide unit having at least six carbon atoms (which may be linear, branched, or cyclic), wherein an oxygen atom, a nitrogen atom, or a sulfur atom is bonded to each carbon atom. In some embodiments, the carbohydrate moiety comprises a monosaccharide, a disaccharide, a trisaccharide, or a tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide containing from about 4 to 9 monosaccharide units. In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0311] In some embodiments, the carbohydrate moiety comprises a monosaccharide, a disaccharide, a trisaccharide, or a tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide (e.g., containing from about 4 to about 9 monosaccharide units). In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0312] In some embodiments, the ligand is capable of binding to a human asialoglycoprotein receptor (ASGPR), eg, human asialoglycoprotein receptor 2 (ASGPR2).

[0313] In some embodiments, the carbohydrate moiety comprises a sugar (e.g., one, two, or three sugars). In some embodiments, the carbohydrate moiety comprises galactose or a derivative thereof (e.g., one, two, or three galactoses or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine or a derivative thereof (e.g., one, two, or three N-acetylgalactosamines or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosamine or a derivative thereof (e.g., one, two, or three N-acetyl-D-galactosamines or a derivative thereof).

[0314] In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine (e.g., one, two, or three N-acetylgalactosamines). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosamine (e.g., one, two, or three N-acetyl-D-galactosamines).

[0315] In some embodiments, the carbohydrate moiety comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the carbohydrate moiety further comprises a linking moiety that connects one or more sugars (e.g., N-acetyl-D-galactosamine) to the linker.

[0316] In some embodiments, the linker comprises a thioether (e.g., thiosuccinimide or a hydrolyzed analog thereof), a disulfide, a triazole, a thiophosphate, a phosphodiester, an ester, an amide, or any combination thereof. In some embodiments, the linker is a three-branched connecting portion. Suitable targeting ligands include, but are not limited to, those disclosed in PCT Application Publication Nos. WO / 2015 / 006740, WO / 2016 / 100401, WO / 2017 / 214112, WO / 2018 / 039364, and WO / 2018 / 045317, each of which is incorporated herein by reference.

[0317] In some embodiments, the targeting ligand comprises a lipid or lipid moiety (e.g., one, two, or three lipid moieties). In some embodiments, the lipid moiety comprises (e.g., one, two, or three) C8-C24 fatty acids, cholesterol, vitamins, sterols, phospholipids, or any combination thereof.

[0318] In some embodiments, the targeting ligand comprises a peptide or peptide portion (e.g., one, two, or three peptide portions). In some embodiments, the peptide portion comprises (e.g., one, two, or three) integrins, insulin, glucagon-like peptides, or any combination thereof. In some embodiments, the targeting ligand comprises an antibody or antibody portion (e.g., transferrin). In some embodiments, the targeting ligand comprises one, two, or three antibody portions (e.g., transferrin).

[0319] In some embodiments, the targeting ligand comprises an oligonucleotide (e.g., an aptamer or a CpG). In some embodiments, the targeting ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or a CpG).

[0320] In some embodiments, the ligand comprises: one, two, or three sugars (e.g., N-acetyl-D-galactosamine); one, two, or three lipid moieties; one, two, or three peptide moieties; one, two, or three antibody moieties; one, two, or three oligonucleotides; or any combination thereof.

[0321] In some embodiments, a linker is attached to an isolated oligonucleotide of the disclosure via a phosphate group or an analog of a phosphate group in the isolated oligonucleotide.

[0322] In some embodiments, the ligand comprises a sugar ligand moiety (eg, N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide into the liver.

[0323] In some embodiments, the ligand comprises GalNAc or a derivative thereof. In some embodiments, the ligand comprises the GalNAc G1b structure shown below.

[0324]

[0325] In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, wherein the ligand comprises three GalNAc G1b moieties, the GalNAc G1b moieties are positioned consecutively. In some embodiments, the consecutively positioned GalNAc G1b moieties are located at the 3' end of the sense strand. In some embodiments, wherein the ligand comprises three consecutively positioned GalNAc G1b ("G1b") moieties, the first G1b moiety is connected to the second G1b moiety, and the second G1b is connected to the third G1b moiety. In some embodiments, the first GalNAc G1b moiety is connected to the sense strand of the isolated oligonucleotide of the present disclosure.

[0326] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the ligand comprises three GalNAcG1b ("G1b") moieties, wherein a first GalNAc G1b moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAcG1b moiety is further linked to a second GalNAc G1b moiety, and the second G1b is linked to a third G1b moiety. In some embodiments, wherein the ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties are located consecutively on the 3' end of the sense strand.

[0327] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal or terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker. In some embodiments, the

[0328] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the isolated oligonucleotide comprises a sense strand and an antisense strand, and wherein the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are consecutively located at the 3' end of the sense strand, the ligand is linked to the terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is linked to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a divalent linker. In some embodiments, the ligand linker is a trivalent linker.

[0329] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from the group consisting of: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, the targeting ligand is attached to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.

[0330] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the targeting ligand comprises three GalNAc G1b moieties attached to the 3' end of the sense strand, the sense strand comprises a nucleotide sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA3'); SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA3'); SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA3'); SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA3'); SEQ ID NO:90 (5'AAGUUGAGAACAAAAAUUGA3'); SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA3'); SEQ ID NO:92 (5'AAAAAUUGGGUUUUAAAAUA 3'); SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA3'); SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUA3'); or SEQ ID NO:99 (5'UCAUCCACAAUGAGAGUACA 3').

[0331] The connection at the 3' end of the isolated oligonucleotide of the present disclosure can be directly via a 5', 3' or 2' hydroxyl group, or indirectly via a non-nucleotide linker or nucleoside (utilizing the 2' or 3' hydroxyl position of the nucleoside). The connection can also utilize a functionalized sugar or core base of the 3' terminal nucleotide. In some embodiments, the ligands described herein can be attached to the isolated oligonucleotide of the present disclosure by various ligand linkers, which can be cleavable or non-cleavable.

[0332] Modification of phosphate groups

[0333] Modified terminal phosphate group

[0334] The present disclosure also provides oligonucleotides and conjugates containing modified phosphate groups (also referred to as phosphate mimetics or phosphate derivatives) for nucleic acid delivery. The present disclosure also relates to oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or the treatment or prevention of disease.

[0335] In some embodiments, the present disclosure provides phosphate mimetics of the 5' terminal nucleotide. Without wishing to be bound by theory, it is understood that when incorporated into an oligonucleotide (e.g., at the 5' end of the antisense strand), the phosphate mimetics can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, thereby enhancing the potency and duration of the isolated oligonucleotide (e.g., dsRNA or siRNA).

[0336] In some embodiments of the isolated oligonucleotides of the present disclosure, the oligonucleotides include 5' terminal nucleotide modifications. In some embodiments, the 5' terminal modifications provide a functional effect of a phosphate group, but are more stable in the environmental conditions to which the oligonucleotides are exposed when administered to a subject. In some embodiments, the isolated oligonucleotides include phosphate mimics that are more resistant to phosphatases and other enzymes while minimizing the negative effects on the function of the oligonucleotides (e.g., when used as RNAi inhibitor molecules, minimizing any reduction in gene target knockdown).

[0337] In some embodiments, the 5' end modification is a chemical modification.In some embodiments, the chemical modification enhances stability against nucleases or other enzymes that degrade or interfere with the structure or activity of the isolated oligonucleotide.

[0338] In some embodiments, the sense strand or antisense strand of the isolated oligonucleotide of the present disclosure comprises a 5' terminal phosphate group. In some embodiments, the 5' terminal phosphate group comprises an unmodified phosphate having the formula: -OP(=O)(OH)OH. In some embodiments, the 5' terminal phosphate group comprises a modified phosphate. In some embodiments, the 5' terminal phosphate group comprises a modified phosphate having the formula: -CH2-P(=X)(OR1 )OR 2 A modified phosphate, wherein X is O or S, R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl. In some embodiments, the modified phosphate is referred to as a "phosphate mimetic."

[0339] As used herein, the term "halo" or "halogen" refers to fluorine, chlorine, bromine, and iodine.

[0340] As used herein, the term "aryl" includes groups having aromaticity (including "conjugated") or polycyclic ring systems having one or more aromatic rings and not containing any heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, and the like. Conveniently, aryl is phenyl.

[0341] As used herein, the term "alkyl" or "C1-C6 alkyl" is intended to include C1, C2, C3, C4, C5 or C6 straight (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5 or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5 and C6 alkyl groups. Examples of alkyl groups include moieties having 1 to 6 carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, isopentyl or n-hexyl. In some embodiments, straight or branched chain alkyl groups have six or fewer carbon atoms (e.g., C1-C6 for straight chain and C3-C6 for branched chain), and in another embodiment, straight or branched chain alkyl groups have four or fewer carbon atoms. In some embodiments, straight chain alkyl groups have one carbon atom. In some embodiments, straight chain alkyl groups have two carbon atoms.

[0342] In some embodiments, a phosphate mimetic is attached to the 5' end of an isolated oligonucleotide (eg, siRNA) as shown in the following formula:

[0343]

[0344] in:

[0345] B is H or a nucleobase moiety;

[0346] X is O or S;

[0347] R 1 is H or C1-C6 alkyl;

[0348] R 2 is H or C1-C6 alkyl;

[0349] Y 1 is O or S;

[0350] Y 2 is O or S;

[0351] Z is H, halogen or -OR Z ;

[0352] R Z is H, C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 aryl), wherein C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 aryl) is optionally substituted by one or more R Za replace;

[0353] Each R Za are independently halogen, C1-C6 alkyl, or -O-(C1-C6 alkyl), wherein C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogen; and

[0354] Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0355] In some embodiments, a phosphate mimetic is attached to the 5' end of an isolated oligonucleotide (eg, siRNA) as shown in the following formula:

[0356]

[0357] in:

[0358] B is H or a nucleobase moiety;

[0359] X is O or S;

[0360] R 1 is H or C1-C6 alkyl;

[0361] R 2 is H or C1-C6 alkyl;

[0362] Y 1 is O or S;

[0363] Y 2 is O or S; and

[0364] Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0365] In some embodiments, a phosphate mimetic is attached to the 5' end of an isolated oligonucleotide (eg, siRNA) as shown in the following formula:

[0366]

[0367] in:

[0368] B is H or a nucleobase moiety;

[0369] X is O or S;

[0370] R 1 is H or C1-C6 alkyl;

[0371] R 2 is H or C1-C6 alkyl; and

[0372] Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0373] In some embodiments, X is O.

[0374] In some embodiments, X is S.

[0375] In some embodiments, R 1 It’s H.

[0376] In some embodiments, R 1 is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0377] In some embodiments, R 1 It's methyl.

[0378] In some embodiments, R 2 It’s H.

[0379] In some embodiments, R 2 is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0380] In some embodiments, R 2 It's methyl.

[0381] In some embodiments, Y 1 It's O.

[0382] In some embodiments, Y 1 It’s S.

[0383] In some embodiments, Y 2 It's O.

[0384] In some embodiments, Y 2 It’s S.

[0385] In some embodiments, Z is H.

[0386] In some embodiments, Z is not H.

[0387] In some embodiments, Z is halogen (eg, F, Cl, Br, or I).

[0388] In some embodiments, Z is F or Cl.

[0389] In some embodiments, Z is F.

[0390] In some embodiments, Z is -OR Z .

[0391] In some embodiments, Z is -OH.

[0392] In some embodiments, Z is not -OH.

[0393] In some embodiments, Z is -O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0394] In some embodiments, Z is -OCH3.

[0395] In some embodiments, Z is -O-(C1-C6 alkyl)-O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0396] In some embodiments, Z is -OCH2CH2OCH3.

[0397] In some embodiments, Z is optionally replaced by one or more R Za Substituted-O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0398] In some embodiments, Z is -O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0399] In some embodiments, Z is

[0400] In some embodiments, Z is optionally replaced by one or more R Za Replaced

[0401] In some embodiments, Z is optionally substituted with one or more halogens.

[0402] In some embodiments, Z is optionally substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl) wherein the C1-C6 alkyl group or -O-(C1-C6 alkyl group) is optionally substituted with one or more halogen groups.

[0403] In some embodiments, R Z It’s H.

[0404] In some embodiments, R Z Not H.

[0405] In some embodiments, R Z is optionally replaced by one or more R Za Substituted C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0406] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I), or -O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl) optionally substituted with one or more halogens.

[0407] In some embodiments, R Z is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0408] In some embodiments, R Z is methyl, ethyl or propyl.

[0409] In some embodiments, R Z It's methyl.

[0410] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted by one or more halogen (e.g., F, Cl, Br or I).

[0411] In some embodiments, R Zis C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted with one or more -O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl), wherein -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0412] In some embodiments, R Z is optionally replaced by one or more R Za Substituted-(C1-C6 alkyl)-(C6-C 10 aryl).

[0413] In some embodiments, R Z is a -(C1-C6 alkyl)-(C6-C 10 -C6 alkyl) is optionally substituted with one or more halogens.

[0414] In some embodiments, R Z It is -(C1-C6 alkyl)-(C6-C 10 aryl).

[0415] In some embodiments, at least one R Za is a halogen (eg, F, Cl, Br, or I).

[0416] In some embodiments, at least one R Za It is F or Cl.

[0417] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) optionally substituted with one or more halogen (e.g., F, Cl, Br or I).

[0418] In some embodiments, at least one R Za is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0419] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted by one or more halogen (e.g., F, Cl, Br or I).

[0420] In some embodiments, at least one R Za is -O-(C1-C6 alkyl) optionally substituted with one or more halogens (eg, F, Cl, Br, or I).

[0421] In some embodiments, at least one R Za It is -O-(C1-C6 alkyl).

[0422] In some embodiments, at least one R Za is -O-(C1-C6 alkyl) substituted by one or more halogens (eg, F, Cl, Br, or I).

[0423] In some embodiments, B is H.

[0424] In some embodiments, B is a nucleobase moiety.

[0425] As used herein, the term "nucleobase moiety" refers to a nucleobase that is attached, eg, via an atom of the nucleobase or a functional group thereof, to the remainder of an isolated oligonucleotide (eg, dsRNA or siRNA) of the disclosure.

[0426] In some embodiments, the nucleobase moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).

[0427] In some embodiments, the nucleobase moiety is uracil (U).

[0428] In some embodiments, a phosphate mimetic is attached to the 5' end of the isolated oligonucleotide as shown in the following formula:

[0429]

[0430] in:

[0431] B is a nucleobase moiety, wherein the nucleobase moiety is uracil (U), wherein the uracil is at position 1 from the 5' end of the sense strand or at position 1 from the 5' end of the antisense strand;

[0432] X is O;

[0433] R 1 is a C1 alkyl group;

[0434] R2 is H; and

[0435] Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0436] In some embodiments of the isolated oligonucleotides of the disclosure, a phosphate mimetic is attached to the 5' end of the antisense strand of the isolated oligonucleotide.

[0437] In some embodiments, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of the isolated oligonucleotide, having the following structure (5'-MeEPmU).

[0438]

[0439] where "mU" is a 2'-O-methyl modified uridine nucleotide and "MeEP" is a monomethyl protected phosphate mimetic.

[0440] In some embodiments, a phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure (5'-MeEPmUs).

[0441]

[0442] where "mU" is a 2'-O-methyl modified uridine nucleotide, "MeEP" is a monomethyl protected phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.

[0443] In some embodiments, a phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure (5'-EPmUs).

[0444]

[0445] where "mU" is a 2'-O-methyl modified uridine nucleotide, "EP" is a phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.

[0446] The terms "5'-MeEP," "5'-MeEP," and "5'MeEP" are used interchangeably herein.

[0447] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, the antisense strand comprises a monomethyl-protected phosphate mimetic (MeEP). In some embodiments, the MeEP is linked to the 5' end of the antisense strand (5'-MeEP).

[0448] In some embodiments, wherein MeEP is linked to the 5' end of the antisense strand, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand.

[0449] In some embodiments, the 5' terminal uridine is a 2'-O-methyl modified nucleotide.

[0450] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, wherein the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA3'); SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA3'); SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA3'); SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'); SEQ ID 3'); SEQ ID NO: 35 (5'UCAAUUUUUUGUUCUCAACUUGA3'); SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA3'); SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUUGU3'); SEQ ID NO: 40 (5'UAUACUUUAAUUUUAAAACCCA3'); SEQ ID NO: 41 (5'UUAUACUUUAAUUUUAAAACCC 3'); or SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3').

[0451] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from the group consisting of: a) 169 to 189; b) 1311 to 1331; and c) 1825 to 1894, from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the sense strand comprises a targeting ligand comprising three GalNAc G1b moieties attached to the 3' end of the sense strand.

[0452] Modified backbone phosphate / phosphodiester bonds

[0453] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand, or both, comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, wherein the isolated oligonucleotides of the present disclosure comprise a modified phosphate backbone, the modified phosphate backbone comprises a modified phosphodiester bond. The phosphodiester bond comprises a linkage having the formula: in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure. In some embodiments, the phosphodiester bond is unmodified, wherein Z 1 It's O and Z 2 Is OH or O – In some embodiments, the phosphodiester bond is modified, wherein Z 1 is O, S, NH or N(C1-C6 alkyl) and Z 2 OH, SH, NH2, NH (C1-C6 alkyl), O – 、S – 、HN – or (C1-C6 alkyl)N – , and when Z 1 When it is O, Z 2 Not OH or O – .

[0454] In some embodiments, Z1 is O.

[0455] In some embodiments, Z1 is S.

[0456] In some embodiments, Z1 is NH.

[0457] In some embodiments, Z1 is N(C1-C6 alkyl).

[0458] In some embodiments, Z2 is OH.

[0459] In some embodiments, Z2 is SH.

[0460] In some embodiments, Z2 is NH2.

[0461] In some embodiments, Z2 is NH(C1-C6 alkyl).

[0462] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).

[0463] In some embodiments, Z2 is O – .

[0464] In some embodiments, Z2 is S – .

[0465] In some embodiments, Z2 is HN – .

[0466] In some embodiments, Z2 is (C1-C6 alkyl)N – .

[0467] In some embodiments, Z2 is S – 、HN – or (C1-C6 alkyl)N – .

[0468] In some embodiments, Z1 is O and Z2 is SH.

[0469] In some embodiments, Z1 is O and Z2 is NH2.

[0470] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).

[0471] In some embodiments, Z1 is S and Z2 is OH.

[0472] In some embodiments, Z1 is S and Z2 is SH.

[0473] In some embodiments, Z1 is S and Z2 is NH2.

[0474] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).

[0475] In some embodiments, Z1 is NH and Z2 is OH.

[0476] In some embodiments, Z1 is NH and Z2 is SH.

[0477] In some embodiments, Z1 is NH and Z2 is NH2.

[0478] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).

[0479] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.

[0480] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.

[0481] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.

[0482] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).

[0483] In some embodiments, Z1 is O and Z2 is S – .

[0484] In some embodiments, Z1 is O and Z2 is HN – .

[0485] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N – .

[0486] In some embodiments, Z1 is S and Z2 is O – .

[0487] In some embodiments, Z1 is S and Z2 is S – .

[0488] In some embodiments, Z1 is S and Z2 is HN – .

[0489] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N – .

[0490] In some embodiments, Z1 is NH and Z2 is O – .

[0491] In some embodiments, Z1 is NH and Z2 is S – .

[0492] In some embodiments, Z1 is NH and Z2 is HN – .

[0493] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N – .

[0494] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O – .

[0495] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S – .

[0496] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN – .

[0497] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N – .

[0498] In some embodiments, the modified phosphodiester bond comprises a phosphorothioate internucleotide linkage.

[0499] In some embodiments, the modified phosphodiester bond comprises in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure.

[0500] In some embodiments, the modified phosphodiester bond comprises in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure.

[0501] In some embodiments, the modified phosphodiester bond comprises in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure.

[0502] In some embodiments, the isolated oligonucleotides of the present disclosure comprise at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise one or more modified phosphodiester bonds. In some embodiments, only the sense strand comprises one or more modified phosphodiester bonds. In some embodiments, only the antisense strand comprises one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand comprise one or more modified phosphodiester bonds.

[0503] In some embodiments, the isolated oligonucleotide comprises at least two modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least three modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least five modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least six modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least seven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eight modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least nine modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least ten modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eleven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least twelve modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least seventeen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eighteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least nineteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least twenty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises more than twenty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between twenty and thirty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between thirty and forty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between forty and fifty modified phosphodiester bonds.

[0504] In some embodiments, the isolated oligonucleotide comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotid...

Claims

1. An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: The sense strand comprises a nucleotide sequence substantially identical to a region of 19 to 25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894, And the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

2. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 166 to 196; c) 394 to 480; d) 744 to 968; e) 1110 to 1331; f) 1410 to 1676; and g) 1726 to 1894.

3. The isolated oligonucleotide according to any one of claims 1-2, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions 1829 to 1857 from the 5' end of the AGT mRNA sequence according to SEQ ID NO:

1. 4 . The isolated oligonucleotide according to claim 3 , wherein the sense strand comprises a nucleotide sequence identical to a region between nucleotide positions 1829 to 1857 from the 5′ end of the AGT mRNA sequence according to SEQ ID NO:

1.

5. The isolated oligonucleotide according to any one of claims 1-2, wherein the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f)1726 to 1894.

6. The isolated oligonucleotide according to claim 5, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 166 to 196; b) 394 to 480; c) 744 to 968; d) 1110 to 1331; e) 1410 to 1676; and f)1726 to 1894.

7. The isolated oligonucleotide according to any one of claims 1-2, wherein the sense strand comprises a sequence substantially identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; and f)1814 to 1882.

8. The isolated oligonucleotide according to claim 7, wherein the sense strand comprises a sequence identical to a region comprising a sequence selected from between any one of the following nucleotide positions from the 5' end of the AGT mRNA sequence according to SEQ ID NO: 1: a) 9 to 29; b) 168 to 189; c) 784 to 808; d) 1264 to 1289; e) 1607 to 1630; and f)1814 to 1882.

9. The isolated oligonucleotide of any one of claims 1-8, wherein the antisense strand comprises a 3' overhang.

10. The isolated oligonucleotide of any one of claims 1-9, wherein the sense strand comprises an RNA sequence of at least 20 nucleotides in length.

11. The isolated oligonucleotide of any one of claims 1-10, wherein the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.

12. The isolated oligonucleotide according to any one of claims 1 to 11, wherein the double-stranded region is between 19 and 21 nucleotides in length.

13. The isolated oligonucleotide of claim 12, wherein the double-stranded region is 20 nucleotides in length.

14. The isolated oligonucleotide of any one of claims 1-13, wherein the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-56.

15. The isolated oligonucleotide of any one of claims 1-14, wherein the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 57-111.

16. The isolated oligonucleotide of claim 4, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3').

17. The isolated oligonucleotide of claim 6, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUCUAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUGAAGUCCAGAGAGCGUGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'CCACGCUCUCUGGACUUCAA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUGAGAAGAUUGACAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAGCACCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'AGGUGCUGAACAGCAUUUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCCUUGGUCUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UGUUUCACAAACAAGCUGGUCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5'ACCAGCUUGUUUGUGAAACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:29 (5'UUUUUUUGUUUCACAAACAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:84 (5'UUGUUUGUGAAACAAAAAAA3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:85 (5'UUUGUGAAACAAAAAAGUGA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5'UCUUGAAAAGGGAACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:86 (5'AAAGUGUUCCCUUUUCAAGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO:32 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:87 (5'CCUUUUCAAGUUGAGAACAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:34 (5'UAAUUUUUGUUCUCAACUUGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:89 (5'CAAGUUGAGAACAAAAAUUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA 3'); and xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:36 (5'UUUUUAAAACCCAAUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:91 (5'CAAAAAUUGGGUUUUAAAAA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:39 (5'UUUAAUUUUAAAACCCAAUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:94 (5'AAUUGGGUUUUAAAAUUAAA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3'); or xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UCUCAUUAGAAGAAAAGGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'CACCUUUUCUUCUAAUGAGA 3').

18. The isolated oligonucleotide of claim 8, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UAUGAACCUGUCAAUCUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'AGAAGAUUGACAGGUUCAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'GAUUGACAGGUUCAUGCAGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAGGUUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UGAACCUGCAAAAAUUGAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA 3'); or viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'UUUUCACAAACAAGCUGGUCGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'GACCAGCUUGUUUGUGAAAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3'); or xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA 3').

19. The isolated oligonucleotide of any one of claims 1-18, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by 20% to 50% at a dose of 0.02 nM.

20. The isolated oligonucleotide of claim 19, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA 3') (42.5); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUCUAA 3') (30.4); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUGAAGUCCAGAGAGCGUGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'CCACGCUCUCUGGACUUCAA 3') (37.9); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUGAGAAGAUUGACAGA 3') (41.3); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA 3') (49.7); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA 3') (35.4); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA 3') (40.8); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA 3') (39.7); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA 3') (39.3); xi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA 3') (39); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA 3') (48.5); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA 3') (49.5); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCCUUGGUCUAAA 3') (43.6); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA 3') (26.7); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA 3') (38.4); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA 3') (47.9); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'CCUUUUCAAGUUGAGAACAA 3'); xx) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA 3') (34); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA 3') (38.7); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUGUU 3'), and the sense strand (36.5) of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUGGGUUUUAAAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA 3') (27.4); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UUUAAUUUUAAAACCCAAUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'AAUUGGGUUUUAAAAUUAAA 3') (36.1); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAGGUUCAGC 3'), and the sense strand (45.4) of the nucleic acid sequence according to SEQ ID NO: 102 (5'UGAACCUGCAAAAAUUGAGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA 3') (42.9); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:51 (5'UCUCAUUAGAAGAAAAGGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:106 (5'CACCUUUUCUUCUAAUGAGA 3') (39.06); or xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA 3') (27.8); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA 3') (49.0); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:110 (5'AGAACAAAAAUUGGGUUUUA 3') (44.8); or xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA 3') (35.8).

21. The isolated oligonucleotide of any one of claims 1-20, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by at least 50% at a dose of 0.02 nM.

22. The isolated oligonucleotide of claim 21, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA 3'), and the sense strand (56.3) of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand (54.5) of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA 3') (63.3); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAGCACCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'AGGUGCUGAACAGCAUUUUA 3') (55.8); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA 3') (52.6); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3') (50.3); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA 3'), and the sense strand (76.8) of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UUGUUUGUGAAACAAAAAAA 3') (52); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5'UCUUGAAAAGGGAACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:86 (5'AAAGUGUUCCCUUUUCAAGA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA 3') (70.2); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UAUGAACCUGUCAAUCUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'AGAAGAUUGACAGGUUCAUA 3') (74.3); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'GAUUGACAGGUUCAUGCAGA 3') (62.6); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA 3') (64.3); or xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UCUCAACUUGAAAAGGGAACAC 3'), and the sense strand (50.4) of the nucleic acid sequence according to SEQ ID NO: 109 (5'GUUCCCUUUUCAAGUUGAGA 3').

23. The isolated oligonucleotide of any one of claims 1-18, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by at least 50% at a dose of 0.1 nM.

24. The isolated oligonucleotide of claim 23, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UGGAACACUUUUUUGUUUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UGAAACAAAAAAGUGUUCCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UUUGAAAAGGGAACACUUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAAAGUGUUCCCUUUUCAAA 3') (72.3); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UCUCUCAUUGUGGAUGACGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'UCGUCAUCCACAAUGAGAGA 3') (78); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UCUCACAGGUACUCUCAUUGUG 3'), and the sense strand (62.4) of the nucleic acid sequence according to SEQ ID NO: 60 (5'CAAUGAGAGUACCUGUGAGA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UCAUAGCUCACUGUGCAUGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'GCAUGCACAGUGAGCUAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUAGAGAGAGGCCAGGGUGCCA 3'), and the sense strand (64.9) of the nucleic acid sequence according to SEQ ID NO: 62 (5'GCACCCUGGCCUCUCUCUAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUGAAGUCCAGAGAGCGUGGGA 3'), and the sense strand (65.7) of the nucleic acid sequence according to SEQ ID NO: 63 (5'CCACGCUCUCUGGACUUCAA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UCUGUCAAUCUUCUCAGCAGCA 3'), and the sense strand (65.2) of the nucleic acid sequence according to SEQ ID NO: 64 (5'CUGCUGAGAAGAUUGACAGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UGUCCACCCAGAACUCCUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'CCAGGAGUUCUGGGUGGACA 3') (61.7); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGACACUGAGGUGCUGUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AACAGCACCUCAGUGUCUGA 3') (66); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUUUGCUGGAAAGUGAGACCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'GGUCUCACUUUCCAGCAAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UGUUUCUUCAUCCAGUUGAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'CUCAACUGGAUGAAGAAACA 3') (74.4); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAAUGCUGUUCAGCACCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'AGGUGCUGAACAGCAUUUUA 3') (67); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAAAAAAAUGCUGUUCAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UGCUGAACAGCAUUUUUUUA 3') (68.3); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UCAAAAAAAAUGCUGUUCAGCA 3'), and the sense strand (73.6) of the nucleic acid sequence according to SEQ ID NO: 71 (5'CUGAACAGCAUUUUUUUUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UCAGCAAACAGGAAUGGGCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'CGCCCAUUCCUGUUUGCUGA 3') (67.3); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAAGAAAAGGUGGGAGACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'AGUCUCCCACCUUUUCUUCA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UUUAGAAGAAAAGGUGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'CUCCCACCUUUUCUUCUAAA 3') (66.6); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUAGAAGAAAAGGUGGGAGA 3'), and the sense strand (74.3) of the nucleic acid sequence according to SEQ ID NO: 75 (5'UCCCACCUUUUCUUCUAAUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UGAGAAACGGCUGCUUUCCAGC 3'), and the sense strand (77.8) of the nucleic acid sequence according to SEQ ID NO: 76 (5'UGGAAAGCAGCCGUUUCUCA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUUAGACCAAGGAGAAACGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'CCGUUUCUCCUUGGUCUAAA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UCUUAGACCAAGGAGAAACGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'CGUUUCUCCUUGGUCUAAGA 3') (76); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UAAAAUAAACCCAGCAAACUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'AGUUUGCUGGGUUUAUUUUA 3') (67.2); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUUUUGGAACAGUAGUCCCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'GGGACUACUGUUCCAAAAAA 3') (65.4); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UCACUUAGACCAAGGAGAAACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UUUCUCCUUGGUCUAAGUGA 3') (61.5); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUCUCUAAAAUAAACCCAGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'CUGGGUUUAUUUUAGAGAAA3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO:28 (5'UGUUUCACAAACAAGCUGGUCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:83 (5'ACCAGCUUGUUUGUGAAACA 3') (62); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUUUUUGUUUCACAAACAAGC 3'), and the sense strand (77.3) of the nucleic acid sequence according to SEQ ID NO: 84 (5'UUGUUUGUGAAACAAAAAAA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UCACUUUUUUGUUUCACAAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUGAAACAAAAAAGUGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:31 (5'UCUUGAAAAGGGAACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:86 (5'AAAGUGUUCCCUUUUCAAGA 3') (73.8); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UUGUUCUCAACUUGAAAAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'CCUUUUCAAGUUGAGAACAA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAUUUUUGUUCUCAACUUGAAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCAAGUUGAGAACAAAAAUA3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAUUUUUGUUCUCAACUUGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'CAAGUUGAGAACAAAAAUUA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAAUUUUUGUUCUCAACUUGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'AAGUUGAGAACAAAAAUUGA3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'UUUUUAAAACCCAAUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'CAAAAAUUGGGUUUUAAAAA 3') (68.3); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'UAUUUUAAAACCCAAUUUUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'AAAAAUUGGGUUUUAAAAUA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'UAAUUUUAAAACCCAAUUUUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'AAAAUUGGGUUUUAAAAUUA3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO:39 (5'UUUAAUUUUAAAACCCAAUUUU 3'), and the sense strand (64.9) of the nucleic acid sequence according to SEQ ID NO:94 (5'AAUUGGGUUUUAAAAUUAAA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:40 (5'UAUACUUUAAUUUUAAAACCCA3'), and the sense strand (69.6) of the nucleic acid sequence according to SEQ ID NO:95 (5'GGUUUUAAAAUUAAAGUAUA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO:41 (5'UUAUACUUUAAUUUUAAAACCC 3'), and the sense strand (77.6) of the nucleic acid sequence according to SEQ ID NO:96 (5'GUUUUAAAAUUAAAGUAUAA3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUAGUACCCAGAACAACGGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'CCGUUGUUCUGGGUACUACA3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UUACUCUCAUUGUGGAUGACGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'GUCAUCCACAAUGAGAGUAA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUACUCUCAUUGUGGAUGACG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UCAUCCACAAUGAGAGUACA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO:45 (5'UAUGAACCUGUCAAUCUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:100 (5'AGAAGAUUGACAGGUUCAUA 3') (73); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UCUGCAUGAACCUGUCAAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'GAUUGACAGGUUCAUGCAGA 3') (63.6); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UCUCAAUUUUUGCAGGUUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UGAACCUGCAAAAAUUGAGA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UCAUUGCUCAAUUUUUGCAGGU 3'), and the sense strand (62.6) of the nucleic acid sequence according to SEQ ID NO: 103 (5'CUGCAAAAAUUGAGCAAUGA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UUAGAAGAAAAGGUGGGAGACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUCCCACCUUUUCUUCUAA 3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UCAUUAGAAGAAAAGGUGGGAG 3'), and the sense strand (70.2) of the nucleic acid sequence according to SEQ ID NO: 105 (5'CCCACCUUUUCUUCUAAUGA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UCUCAUUAGAAGAAAAGGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'CACCUUUUCUUCUAAUGAGA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UUUCACAAACAAGCUGGUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'CGACCAGCUUGUUUGUGAAA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:53 (5'UUUUCACAAACAAGCUGGUCGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:108 (5'GACCAGCUUGUUUGUGAAAA 3') (62); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:54 (5'UCUCAACUUGAAAAGGGAACAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO:109 (5'GUUCCCUUUUCAAGUUGAGA 3'); LVi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'UUUAAAACCCAAUUUUUGUUCU 3'), and the sense strand (71.3) of the nucleic acid sequence according to SEQ ID NO: 111 (5'AACAAAAAUUGGGUUUUAAA 3'); or LVii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UAAAACCCAAUUUUUGUUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'AGAACAAAAAUUGGGUUUUA 3') (74.5).

25. An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: The sense strand comprises a nucleotide sequence substantially identical to a region of 19 to 25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the angiotensinogen (AGT) mRNA sequence according to SEQ ID NO: 1: a) 11 to 42; b) 144 to 284; c) 303 to 405; d) 441 to 580; e) 690 to 802; f) 863 to 883; g) 922 to 966; h) 1036 to 1056; i)1099 to 1153; j) 1189 to 1282; k) 1300 to 1367; 1) 1403 to 1517; m) 1601 to 1651; n) 1722 to 1890; o) 1901 to 1948; and p) 2017 to 2095, And the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

26. The isolated oligonucleotide of claim 25, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by 20% to 50% at a dose of 0.1 nM.

27. The isolated oligonucleotide of claim 26, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UCUGUAGUACCCAGAACAACGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'GUUGUUCUGGGUACUACAGA 3') (34.3); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UCAUUGGCCUUUGCCAGCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5'CAGCUGGCAAAGGCCAAUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGUGCCAAAGACAGCCGUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CAACGGCUGUCUUUGGCACA 3') (39); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'UAUAGAGAGAGGCCAGGGUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CACCCUGGCCUCUCUCUAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UGAUUGCCUGUAGCCUGUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'UGACAGGCUACAGGCAAUCA 3') (35.6); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCAGUUCUUGUCCUUCCAAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 409 (5'CUUGGAAGGACAAGAACUGA 3') (42.8); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UUAUAGAGAGCCAGGCCCUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410 (5'CAGGGCCUGGCUCUCUAUAA 3') (37.2); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'UGUAGGUGUUGAAAGCCAGGGU 3'), and the sense strand (40.5) of the nucleic acid sequence according to SEQ ID NO: 412 (5'CCUGGCUUUCAACACCUACA3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UCAGAACUCCUGGGGCUCGGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 413 (5'CCGAGCCCCAGGAGUUCUGA 3') (22.4); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGUCCACCCAGAACUCCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5'AGGAGUUCUGGGUGGACAAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UGACACUGAGGUGCUGUUGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5'ACAACAGCACCUCAGUGUCA 3') (34.1); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCUCUCAGUGAAGGGCACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 414 (5'AAGUGCCCUUCACUGAGAGA 3') (27.2); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAAGUGAGACCCUCCACCUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'AAGGUGGAGGGUCUCACUUA 3') (40); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGGAAAGUGAGACCCUCCACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5'GUGGAGGGUCUCACUUUCCA3') (41.8); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UCUGGAAAGUGAGACCCUCCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5'GGAGGGUCUCACUUUCCAGA 3') (40.8); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAGUUGAGGGAGUUUUGCUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'CAGCAAAACUCCCUCAACUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGAAUGGCGGGCAGCUCAGCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5'GCUGAGCUGCCCGCCAUUCA 3') (36.9); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'UAAUUUUUGCAGGUUCAGCUCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5'AGCUGAACCUGCAAAAAUUA 3') (41.2); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UAUGCUGUUCAGCACCUCCCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 418 (5'GGGAGGUGCUGAACAGCAUA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UUAGACUCUGUGGGCUCUCUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'AGAGAGCCCACAGAGUCUAA 3') (30.6); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UCAAACAGGAAUGGGCGGUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AACCGCCCAUUCCUGUUUGA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UAUCAUACACAGCAAACAGGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'CCUGUUUGCUGUGUAUGAUA 3') (48.8); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UAAGAAAAGGUGGGAGACUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5'CAGUCUCCCACCUUUUCUUA 3') (30.9); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'UCUAAAAUAAACCCAGCAAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5'UUUGCUGGGUUUAUUUUAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UUUUUGGAACAGUAGUCCCGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 440 (5'CGGGACUACUGUUCCAAAAA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'UGUCGGUUGGAAUUCUUUUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'AAAAAGAAUUCCAACCGACA3') (33.7); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCAAACAAGCUGGUCGGUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'CAACCGACCAGCUUGUUUGA 3') (47.5); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UCUUUAAUUUUAAAACCCAAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'UUGGGUUUUAAAAUUAAAGA 3') (46.8); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UAUACAAACCGAAGGCAAUGCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAUUGCCUUCGGUUUGUAUA 3') (39.6); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'UAAUACAAACCGAAGGCAAUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'AUUGCCUUCGGUUUGUAUUA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'UCACUAAAUACAAACCGAAGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CUUCGGUUUGUAUUUAGUGA 3') (30.2); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UAAGACACUAAAUACAAACCGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 392 (5'GGUUUGUAUUUAGUGUCUUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UCAAGACACUAAAUACAAACCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 393 (5'GUUUGUAUUUAGUGUCUUGA 3') (32); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGGAAGGGGUGUAUGUACACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GUGUACAUACACCCCUUCCA 3') (20.2); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UAAGACGUUUAUUACUAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403 (5'UGUUAGUAAUAAACGUCUUA 3'); or xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UGGAUGACGAGGUGGAAGGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'CCCUUCCACCUCGUCAUCCA 3') (25.7); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCUCAUUGUGGAUGACGAGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5'CCUCGUCAUCCACAAUGAGA 3') (22.4); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UACAAGCUGGUCGGUUGGAAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 443 (5'UUCCAACCGACCAGCUUGUA 3') (36.3); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UCUUUGCCAGCUGCUCACAGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5'CUGUGAGCAGCUGGCAAAGA 3') (35.8); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'UUUUCAUCCACAGGGGAUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 406 (5'ACAUCCCCUGUGGAUGAAAA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5'UGUUUUGCAGCGACUAGCACCA3'), and the sense strand (43.1) of the nucleic acid sequence according to SEQ ID NO: 434 (5'GUGCUAGUCGCUGCAAAACA3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UAAGUUGGCCAGCAUCCCGACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5'UCGGGAUGCUGGCCAACUUA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA 3') (50.0); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UAUAUAUACGGAAGCCCAAGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5'CUUGGGCUUCCGUAUAUAUA 3') (33.6); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5'UCAUAUAUACGGAAGCCCAAGA 3'), and the sense strand (39.2) of the nucleic acid sequence according to SEQ ID NO: 303 (5'UUGGGCUUCCGUAUAUAUGA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUGCCAUAUAUACGGAAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5'CUUCCGUAUAUAUGGCAUGA 3') (22.9); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCUGUGCAUGCCAUAUAUACGG 3'), and the sense strand (31.9) of the nucleic acid sequence according to SEQ ID NO: 306 (5'GUAUAUAUGGCAUGCACAGA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5'UCAAAGACAGCCGUUGGGGAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5'UCCCCAACGGCUGUCUUUGA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5'UUUCCAAGGAACACCCAGGAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5'UCCUGGGUGUUCCUUGGAAA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UGACCUUGUGCGCAUCCAGCCG 3'), and the sense strand (41.9) of the nucleic acid sequence according to SEQ ID NO: 316 (5'GCUGGAUGCGCACAAGGUCA 3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5'UCAAACGGCUGCUUCAGGUGCA3'), and the sense strand (34.7) of the nucleic acid sequence according to SEQ ID NO: 318 (5'CACCUGAAGCAGCCGUUUGA3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5'UCACAAACGGCUGCUUCAGGUG 3'), and the sense strand (32.6) of the nucleic acid sequence according to SEQ ID NO: 319 (5'CCUGAAGCAGCCGUUUGUGA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UUAGAGAGCCAGGCCCUGCACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5'UGCAGGGCCUGGCUCUCUAA3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UAAGUCCAGAGAGCGUGGGAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5'UCCCACGCUCUCUGGACUUA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UGUGAAGUCCAGAGAGCGUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5'CACGCUCUCUGGACUUCACA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'UUUCUGUGAAGUCCAGAGAGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 411 (5'CUCUCUGGACUUCACAGAAA3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'UUCUCAGCAGCAACAUCCAGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 445 (5'CUGGAUGUUGCUGCUGAGAA 3') (25.4); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UCUGUUGUCCACCCAGAACUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5'AGUUCUGGGUGGACAACAGA 3'); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UGUGAGACCCUCCACCUUGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5'ACAAGGUGGAGGGUCUCACA 3'); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UGAAAGUGAGACCCUCCACCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 333 (5'GGUGGAGGGUCUCACUUUCA3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UAUCCAGUUGAGGGAGUUUUGC 3'), and the sense strand (44.3) of the nucleic acid sequence according to SEQ ID NO: 340 (5'AAAACUCCCUCAACUGGAUA 3'); Lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UCAGAAUGGCGGGCAGCUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5'UGAGCUGCCCGCCAUUCUGA 3') (24.0); Lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UCUGUUCAGCACCUCCCCCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 417 (5'UGGGGGAGGUGCUGAACAGA 3'); Lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5'UAAAAAAUGCUGUUCAGCACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5'GUGCUGAACAGCAUUUUUUA3'); Lxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'UAAAAAAAAUGCUGUUCAGCAC 3'), and the sense strand (41.6) of the nucleic acid sequence according to SEQ ID NO: 352 (5'GCUGAACAGCAUUUUUUUUA3'); Lxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand (40.6) of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGAGA 3'); Lxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5'UCAGGAAUGGGCGGUUCAGGGU 3'), and the sense strand (44.6) of the nucleic acid sequence according to SEQ ID NO: 419 (5'CCUGAACCGCCCAUUCCUGA 3'); Lxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'UCACAGCAAACAGGAAUGGGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5'CCCAUUCCUGUUUGCUGUGA 3'); Lxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UAUACACAGCAAACAGGAAUGG 3'), and the sense strand (36.5) of the nucleic acid sequence according to SEQ ID NO: 356 (5'AUUCCUGUUUGCUGUGUAUA 3'); Lxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'UUUGAUCAUACACAGCAAACAG 3'), and the sense strand (42.9) of the nucleic acid sequence according to SEQ ID NO: 359 (5'GUUUGCUGUGUAUGAUCAAA3'); Lxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5'UUUUGAUCAUACACAGCAAACA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5'UUUGCUGUGUAUGAUCAAAA 3') (29.7); Lxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UGAAGUGCAGGGCAGUGGCGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 422 (5'CGCCACUGCCCUGCACUUCA 3'); Lxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'UCAGGAAGUGCAGGGCAGUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5'CACUGCCCUGCACUUCCUGA 3') (22.8); Lxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5'UCUCAUGCUGUGCUCAGCGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 423 (5'CCGCUGAGCACAGCAUGAGA 3'); Lxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'UCUGGGGCCCUGGCCUCAUGCU 3'), and the sense strand (37.9) of the nucleic acid sequence according to SEQ ID NO: 362 (5'CAUGAGGCCAGGGCCCCAGA 3'); Lxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'UAAAAGGUGGGAGACUGGGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5'CCCCAGUCUCCCACCUUUUA 3'); Lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'UGAAAAGGUGGGAGACUGGGGG 3'), and the sense strand (46.3) of the nucleic acid sequence according to SEQ ID NO: 366 (5'CCCAGUCUCCCACCUUUUCA3'); Lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'UCUUUCCAGCUCAAAGUCGACU 3'), and the sense strand (46.6) of the nucleic acid sequence according to SEQ ID NO: 438 (5'UCGACUUUGAGCUGGAAAGA 3'); Lxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5'UUAAACCCAGCAAACUGGGAGG 3'), and the sense strand (49.5) of the nucleic acid sequence according to SEQ ID NO: 424 (5'UCCCAGUUUGCUGGGUUUAA 3'); Lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'UCUGGUUCUUGCCUCCCCACCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'GUGGGGAGGCAAGAACCAGA3'); Lxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'UAAACACUGGUUCUUGCCUCCC 3'), and the sense strand (48.5) of the nucleic acid sequence according to SEQ ID NO: 372 (5'GAGGCAAGAACCAGUGUUUA3'); Lxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'UGUUGGAAUUCUUUUUGGAACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 427 (5'UUCCAAAAAGAAUUCCAACA 3'); Lxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5'UUUGUUUCACAAACAAGCUGGU 3'), and the sense strand (37.3) of the nucleic acid sequence according to SEQ ID NO: 376 (5'CAGCUUGUUUGUGAAACAAA 3'); Lxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5'UUUUUGUUUCACAAACAAGCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'GCUUGUUUGUGAAACAAAAA3'); Lxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5'UCUUACAUUCAAGACACUAAAU 3'), and the sense strand (44.3) of the nucleic acid sequence according to SEQ ID NO: 394 (5'UUAGUGUCUUGAAUGUAAGA 3'); Lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5'UGUCAUGUUCUUACAUUCAAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 396 (5'UUGAAUGUAAGAACAUGACA 3'); Lxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'UGAAAUUCAGGUGCUUGCAUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 429 (5'AUGCAAGCACCUGAAUUUCA 3'); Lxxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'UAACAGAAAUUCAGGUGCUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 430 (5'AAGCACCUGAAUUUCUGUUA 3') (24.8); Lxxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5'UCAUUCAAACAGAAAUUCAGGU 3'), and the sense strand (34.5) of the nucleic acid sequence according to SEQ ID NO: 432 (5'CUGAAUUUCUGUUUGAAUGA 3'); XC) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5'UGAAAUAACCAGCUAUGGUUCC 3'), and the sense strand (26.6) of the nucleic acid sequence according to SEQ ID NO: 433 (5'AACCAUAGCUGGUUAUUUCA 3'); XCi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'UGUGUUCUGGGGCCCUGGCCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5'GGCCAGGGCCCCAGAACACA 3'); or XCii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCUUCUGCUGUAGUACCCAGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'CUGGGUACUACAGCAGAAGA 3') (37.4).

28. The isolated oligonucleotide of claim 25, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by at least 50% at a dose of 0.1 nM.

29. The isolated oligonucleotide of claim 28, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UAUACCCUUCUGCUGUAGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5'UACUACAGCAGAAGGGUAUA 3') (54.0); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UCACAGGUACUCUCAUUGUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'CACAAUGAGAGUACCUGUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UCUCAACUUGUCUUCGGUGUCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'ACACCGAAGACAAGUUGAGA3') (55.8); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UAGAAGUUGGCCAGCAUCCCGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5'GGGAUGCUGGCCAACUUCUA 3') (50.8); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UGGAAGCCCAAGAAGUUGGCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5'GCCAACUUCUUGGGCUUCCA3') (57.6); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA 3') (50.0); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUAUAUACGGAAGCCCAAGAAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'UCUUGGGCUUCCGUAUAUAA3') (58.8); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUGCCAUAUAUACGGAAGCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5'GCUUCCGUAUAUAUGGCAUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAACCUGUCAAUCUUCUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5'UGAGAAGAUUGACAGGUUCA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UGUUUUGCUGGAAAGUGAGACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5'UCUCACUUUCCAGCAAAACA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGAGUUUUGCUGGAAAGUGAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'UCACUUUCCAGCAAAACUCA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UUUUCUUCAUCCAGUUGAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'CCUCAACUGGAUGAAGAAAA3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'UUAAGAUCCUUGCAGCACCAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 415 (5'UGGUGCUGCAAGGAUCUUAA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'CCGAGCUGAACCUGCAAAAA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UUUUUUGCAGGUUCAGCUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5'CGAGCUGAACCUGCAAAAAA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'UAUUUUUGCAGGUUCAGCUCGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5'GAGCUGAACCUGCAAAAAUA 3') (55.8); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'UCAAUUUUUGCAGGUUCAGCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 350 (5'GCUGAACCUGCAAAAAUUGA 3') (53.8); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UCUCUCAUCCGCUUCAAGCUCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 436 (5'AGCUUGAAGCGGAUGAGAGA3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGACUCUGUGGGCUCUCUCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGAGAGAGCCCACAGAGUCA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'UAACAGGAAUGGGCGGUUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5'UGAACCGCCCAUUCCUGUUA3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUCAUACACAGCAAACAGGA 3'), and the sense strand (59.3) of the nucleic acid sequence according to SEQ ID NO: 358 (5'CUGUUUGCUGUGUAUGAUCA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'UAGAAAAGGUGGGAGACUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5'CCAGUCUCCCACCUUUUCUA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUUAAAACCCAAUUUUUGUUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'ACAAAAAUUGGGUUUUAAAA 3') (59.0); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'UAAUAAACCCAGCAAACUGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 425 (5'CCAGUUUGCUGGGUUUAUUA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UAUUCUCUAAAAUAAACCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5'UGGGUUUAUUUUAGAGAAUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UUAAACACUGGUUCUUGCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'AGGCAAGAACCAGUGUUUAA 3') (58.6); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UUUUGGAACAGUAGUCCCGCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GCGGGACUACUGUUCCAAAA 3') (54.8); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UCUUUUUGGAACAGUAGUCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 441 (5'GGACUACUGUUCCAAAAAGA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'UUUCUUUUUGGAACAGUAGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 442 (5'ACUACUGUUCCAAAAAGAAA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'UUUUUUGUUUCACAAACAAGCU 3'), and the sense strand (59.9) of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUUGUUUGUGAAACAAAAAA3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UAAAAGGGAACACUUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'CAAAAAAGUGUUCCCUUUUUA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UCAACUUGAAAAGGGAACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'GUGUUCCCUUUUCAAGUUGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'UUUUAAUUUUAAAACCCAAUUU 3'), and the sense strand (56.5) of the nucleic acid sequence according to SEQ ID NO: 385 (5'AUUGGGUUUUAAAAUUAAAA 3').

30. The isolated oligonucleotide of any one of claims 25-29, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by 20% to 50% at a dose of 0.02 nM.

31. The isolated oligonucleotide of claim 30, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UCUGUAGUACCCAGAACAACGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'GUUGUUCUGGGUACUACAGA 3') (29.7); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UAUACCCUUCUGCUGUAGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5'UACUACAGCAGAAGGGUAUA 3') (32.8); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UCACAGGUACUCUCAUUGUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'CACAAUGAGAGUACCUGUGA 3') (35.0); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UCAUUGGCCUUUGCCAGCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5'CAGCUGGCAAAGGCCAAUGA 3') (23.9); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UCUCAACUUGUCUUCGGUGUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'ACACCGAAGACAAGUUGAGA 3') (26.5); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UAGAAGUUGGCCAGCAUCCCGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5'GGGAUGCUGGCCAACUUCUA 3') (24.4); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5'UCAAGAAGUUGGCCAGCAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5'GAUGCUGGCCAACUUCUUGA 3') (22.0); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UGGAAGCCCAAGAAGUUGGCCA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5'GCCAACUUCUUGGGCUUCCA3') (34.0); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UAUAUACGGAAGCCCAAGAAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UUCUUGGGCUUCCGUAUAUA 3') (21.8); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUAUAUACGGAAGCCCAAGAAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'UCUUGGGCUUCCGUAUAUAA3') (35.0); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUGCCAUAUAUACGGAAGCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5'GCUUCCGUAUAUAUGGCAUA3') (25.8); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGUGCCAAAGACAGCCGUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CAACGGCUGUCUUUGGCACA 3') (25.2); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'UAUAGAGAGAGGCCAGGGUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CACCCUGGCCUCUCUCUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UGAUUGCCUGUAGCCUGUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'UGACAGGCUACAGGCAAUCA 3') (25.3); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCAGUUCUUGUCCUUCCAAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 409 (5'CUUGGAAGGACAAGAACUGA 3') (28.4); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UUAUAGAGAGCCAGGCCCUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410 (5'CAGGGCCUGGCUCUCUAUAA 3') (31.9); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAACCUGUCAAUCUUCUCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5'UGAGAAGAUUGACAGGUUCA 3') (31.2); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'UGUAGGUGUUGAAAGCCAGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5'CCUGGCUUUCAACACCUACA 3') (26.8); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UCAGAACUCCUGGGGCUCGGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 413 (5'CCGAGCCCCAGGAGUUCUGA 3') (20.8); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UGACACUGAGGUGCUGUUGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5'ACAACAGCACCUCAGUGUCA 3') (21.2); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UCUCUCAGUGAAGGGCACUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 414 (5'AAGUGCCCUUCACUGAGAGA 3') (20.5); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAAGUGAGACCCUCCACCUUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'AAGGUGGAGGGUCUCACUUA 3') (20.3); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGGAAAGUGAGACCCUCCACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5'GUGGAGGGUCUCACUUUCCA 3') (27.1); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UCUGGAAAGUGAGACCCUCCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5'GGAGGGUCUCACUUUCCAGA 3') (21.0); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UGUUUUGCUGGAAAGUGAGACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5'UCUCACUUUCCAGCAAAACA 3') (25.6); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGAGUUUUGCUGGAAAGUGAGA3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'UCACUUUCCAGCAAAACUCA3') (28.2); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAGUUGAGGGAGUUUUGCUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'CAGCAAAACUCCCUCAACUA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UCAGUUGAGGGAGUUUUGCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5'AGCAAAACUCCCUCAACUGA 3') (24.8); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UUUUCUUCAUCCAGUUGAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'CCUCAACUGGAUGAAGAAAA 3') (21.6); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'UUAAGAUCCUUGCAGCACCAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 415 (5'UGGUGCUGCAAGGAUCUUAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGAAUGGCGGGCAGCUCAGCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5'GCUGAGCUGCCCGCCAUUCA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UUUUUGCAGGUUCAGCUCGGUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'CCGAGCUGAACCUGCAAAAA 3') (26.9); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UUUUUUGCAGGUUCAGCUCGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5'CGAGCUGAACCUGCAAAAAA 3') (29.2); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UCUCUCUCAUCCGCUUCAAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'CUUGAAGCGGAUGAGAGAGA 3') (22.7); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UUAGACUCUGUGGGCUCUCUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'AGAGAGCCCACAGAGUCUAA 3') (25.9); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UCAAACAGGAAUGGGCGGUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AACCGCCCAUUCCUGUUUGA 3') (22.4); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UAUCAUACACAGCAAACAGGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'CCUGUUUGCUGUGUAUGAUA 3') (22.9); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUCAUACACAGCAAACAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5'CUGUUUGCUGUGUAUGAUCA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'UCUGGGGCCCUGGCCUCAUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5'CAUGAGGCCAGGGCCCCAGA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'UGUGUUCUGGGGCCCUGGCCUC 3'), and the sense strand (35.3) of the nucleic acid sequence according to SEQ ID NO: 363 (5'GGCCAGGGCCCCAGAACACA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5'UAGAAAAGGUGGGAGACUGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5'CCAGUCUCCCACCUUUUCUA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UAAGAAAAGGUGGGAGACUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5'CAGUCUCCCACCUUUUCUUA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'UCUAAAAUAAACCCAGCAAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5'UUUGCUGGGUUUAUUUUAGA 3') (20.0); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UAUUCUCUAAAAUAAACCCAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5'UGGGUUUAUUUUAGAGAAUA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'UUUUGGAACAGUAGUCCCGCGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GCGGGACUACUGUUCCAAAA 3') (23.2); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UUUUUGGAACAGUAGUCCCGCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 440 (5'CGGGACUACUGUUCCAAAAA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UCUUUUUGGAACAGUAGUCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 441 (5'GGACUACUGUUCCAAAAAGA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'UUUCUUUUUGGAACAGUAGUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 442 (5'ACUACUGUUCCAAAAAGAAA3') (22.6); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'UGUCGGUUGGAAUUCUUUUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'AAAAAGAAUUCCAACCGACA3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCAAACAAGCUGGUCGGUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'CAACCGACCAGCUUGUUUGA 3') (26.8); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5'UUUUUUGUUUCACAAACAAGCU 3'), and the sense strand (28.9) of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUUGUUUGUGAAACAAAAAA3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UAAAAGGGAACACUUUUUUGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'CAAAAAAGUGUUCCCUUUUUA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UUUUAAAACCCAAUUUUUGUUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5'ACAAAAAUUGGGUUUUAAAA 3') (32.3); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UCUUUAAUUUUAAAACCCAAUU 3'), and the sense strand (31.1) of the nucleic acid sequence according to SEQ ID NO: 386 (5'UUGGGUUUUAAAAUUAAAGA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UAUACAAACCGAAGGCAAUGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAUUGCCUUCGGUUUGUAUA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'UAAUACAAACCGAAGGCAAUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'AUUGCCUUCGGUUUGUAUUA 3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'UCUAAAUACAAACCGAAGGCAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5'GCCUUCGGUUUGUAUUUAGA 3') (26.6); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'UCACUAAAUACAAACCGAAGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CUUCGGUUUGUAUUUAGUGA 3') (28.4); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UAAGACACUAAAUACAAACCGA 3'), and the sense strand (44.1) of the nucleic acid sequence according to SEQ ID NO: 392 (5'GGUUUGUAUUUAGUGUCUUA 3'); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UCAAGACACUAAAUACAAACCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 393 (5'GUUUGUAUUUAGUGUCUUGA 3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'UGAGAAAUAACCAGCUAUGGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5'CCAUAGCUGGUUAUUUCUCA 3'); Lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UAAGACGUUUAUUACUAACACA3'), and the sense strand (34.5) of the nucleic acid sequence according to SEQ ID NO: 403 (5'UGUUAGUAAUAAACGUCUUA 3'); Lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UAUGCUGUUCAGCACCUCCCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 418 (5'GGGAGGUGCUGAACAGCAUA 3') (20.8); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UCUCUCAUCCGCUUCAAGCUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 436 (5'AGCUUGAAGCGGAUGAGAGA3'); or Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGACUCUGUGGGCUCUCUCUCA 3'), and the sense strand (35.1) of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGAGAGAGCCCACAGAGUCA 3').

32. The isolated oligonucleotide of any one of claims 25-29, wherein the isolated oligonucleotide attenuates the expression of the AGT mRNA by at least 50% at a dose of 0.02 nM.

33. The isolated oligonucleotide of claim 32, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UUUGUCCACCCAGAACUCCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5'AGGAGUUCUGGGUGGACAAA3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UUAAACACUGGUUCUUGCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'AGGCAAGAACCAGUGUUUAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UCAACUUGAAAAGGGAACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'GUGUUCCCUUUUCAAGUUGA 3'); or iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'UUUUAAUUUUAAAACCCAAUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'AUUGGGUUUUAAAAUUAAAA 3') (52.9).

34. The isolated oligonucleotide of any one of claims 1-33, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotides.

35. The isolated oligonucleotide of claim 34, wherein the antisense strand comprises a monomethyl protected phosphate mimetic (5'-MeEP).

36. The isolated oligonucleotide of any one of claims 1-35, wherein in the sense strand or the antisense strand or both, a terminal nucleotide or an internal nucleotide is linked to a targeting ligand.

37. The isolated oligonucleotide of claim 36, wherein the targeting ligand comprises at least one GalNAcG1b moiety.

38. The isolated oligonucleotide of any one of claims 1-37, wherein the antisense strand comprises nucleotides modified with a 2'-F modification and nucleotides modified with a 2'-O-methyl modification according to the following formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

39. The isolated oligonucleotide of any one of claims 1-38, wherein the sense strand comprises nucleotides modified with a 2'-F modification and nucleotides modified with a 2'-O-methyl modification according to the following formula: 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

40. The isolated oligonucleotide of any one of claims 1-39, wherein the antisense strand comprises any of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 447 (5' [MeEPmUs][fCs][fA][mA][fA][mA][mA][fA][mU][mG][mC][fU][mG][fU][mU][mC][m A][mGs][mCs][mA] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 448 (5' [MeEPmUs][fCs][fA][mC][fU][mU][fU][mU][mU][fU][mG][mU][mU][fU][mC][fA][mC][mA][m A][mAs][mCs][mA] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 449 (5' [MeEPmUs][fGs][fG][mA][fA][mC][fA][mC][mU][fU][mU][mU][mU][fU][mG][fU][mU][mU][mC][mAs][mCs][mA] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO:450 (5'[MeEPmUs][fUs][fU][mG][fA][mA][fA][mA][mG][fG][mG][mA][mA][fC][mA][fC][mU][mU][m U][mUs][mUs][mU]3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5' [MeEPmUs][fCs][fA][mA][fU][mU][fU][mU][mU][fG][mU][mU][mC][fU][mC][fA][mA][mC][m U][mUs][mGs][mA] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 452 (5' [MeEPmUs][fAs][fA][mA][fA][mC][fC][mC][mA][fA][mU][mU][mU][fU][mU][fG][mU][mU][m C][mUs][mCs][mA] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5' [MeEPmUs][fAs][fU][mU][fU][mU][fA][mA][mA][fA][mC][mC][mC][fA][mA][fU][mU][mU][m U][mUs][mGs][mU] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 454 (5' [MeEPmUs][fAs][fU][mA][fC][mU][fU][mU][mA][fA][mU][mU][mU][fU][mA][fA][mA][mC][mCs][mCs][mA] 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 455 (5' [MeEPmUs][fUs][fA][mU][fA][mC][fU][mU][mU][fA][mA][mU][mU][fU][mU][fA][mA][mA][mCs][mCs][mC] 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO:456 (5' [mUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][m As][mCs][mG] 3'); xi) the antisense strand of the nucleic acid sequence of SEQ ID NO:457 (5'[EPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][mG][mAs][mCs][mG]3'); or xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 458 (5' [MeEPmUs][fGs][fU][mA][fC][mU][fC][mU][mC][fA][mU][mU][mG][fU][mG][fG][mA][mU][m G][mAs][mCs][mG] 3'), where "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimetic.

41. The isolated oligonucleotide of any one of claims 1-40, wherein the sense strand comprises any of: i) the sense strand of the nucleic acid sequence of SEQ ID NO:460 (5'[mCs][mUs][mG][mA][mA][fC][mA][fG][fC][fA][fU][mU][mU][mU][mU][mU][mU][mUs][mGs][mA][G1b][G1b][G1b]3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO:461 (5'[mUs][mUs][mU][mG][mU][fG][mA][fA][fA][fC][fA][mA][mA][mA][mA][mG][mUs][mGs][mA][G1b][G1b][G1b]3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO:462 (5'[mUs][mGs][mA][mA][mA][fC][mA][fA][fA][fA][fA][mA][mG][mU][mG][mU][mU][mCs][mCs][mA][G1b][G1b][G1b]3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO:463 (5'[mAs][mAs][mA][mA][mG][fU][mG][fU][fU][fC][fC][mC][mU][mU][mU][mU][mC][mAs][mAs][mA][G1b][G1b][G1b]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 464 (5' [mAs][mAs][mG][mU][mU][fG][mA][fG][fA][fA][fC][mA][mA][mA][mA][mA][mU][mUs][mGs][mA][G1b][G1b][G1b] 3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO:465 (5'[mAs][mGs][mA][mA][mC][fA][mA][fA][fA][fA][fU][mU][mG][mG][mG][mU][mU][mUs][mUs][mA][G1b][G1b][G1b]3'); vii) the sense strand of the nucleic acid sequence according to SEQ ID NO:466 (5' [mAs][mAs][mA][mA][mA][fU][mU][fG][fG][fG][fU][mU][mU][mU][mA][mA][mA][mAs][mUs][mA][G1b][G1b][G1b]3'); viii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 467 (5' [mGs][mGs][mU][mU][mU][fU][mA][fA][fA][fU][mU][mA][mA][mG][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'); ix) the sense strand of the nucleic acid sequence of SEQ ID NO:468 (5' [mGs][mUs][mU][mU][mU][fA][mA][fA][fU][fU][mA][mA][mA][mG][mU][mA][mUs][mAs][mA][G1b][G1b][G1b] 3'); or x) the sense strand of the nucleic acid sequence of SEQ ID NO:469 (5'[mUs][mCs][mA][mU][mC][fC][mA][fC][fA][fA][fU][mG][mA][mG][mA][mG][mU][mAs][mCs][mA][G1b][G1b][G1b]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "G1b" is the GalNac G1b moiety.

42. A vector encoding the isolated oligonucleotide according to any one of claims 1-41.

43. A delivery system comprising the isolated oligonucleotide of any one of claims 1-41 or the vector of claim 42.

44. A pharmaceutical composition comprising the isolated oligonucleotide of any one of claims 1-41, the vector of claim 42, and a pharmaceutically acceptable carrier, diluent or excipient.

45. A kit comprising the isolated oligonucleotide of any one of claims 1-41, the vector of claim 42, or the pharmaceutical composition of claim 44.

46. ​​A method of inhibiting or downregulating the expression or level of AGT in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of the isolated oligonucleotide of any one of claims 1-41, the vector of claim 42, or the pharmaceutical composition of claim 44.

47. A method of inhibiting or downregulating the expression or level of AGT in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a first and at least a second isolated oligonucleotide according to any one of claims 1-41, wherein the first and at least the second oligonucleotides comprise different sequences.

48. A method for treating or preventing a disease or disorder associated with abnormal or increased expression or activity of AGT, or a disease or disorder in which AGT plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of an isolated oligonucleotide according to any one of claims 1-41, a vector according to claim 42, or a pharmaceutical composition according to claim 44.

Images