A tomato SlMET1L gene and its application in regulating fruit ripening and preservation quality.
By regulating the expression of the tomato SlMET1L gene, the problem of imprecise regulation of the tomato fruit ripening process was solved, thereby improving fruit quality and controlling post-harvest preservation quality, and supporting breeding and variety improvement.
Patent Information
- Application Number
- CN202510090324.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-21
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2045-01-21
AI Technical Summary
Current technologies have not fully utilized DNA methylation mechanisms to regulate the ripening process of tomato fruits, resulting in imprecise fruit quality control and difficulty in meeting market demands and the needs of climate-adaptive breeding.
By regulating the expression of the SlMET1L gene in tomatoes or the activity of its encoded protein, the DNA methylation level, ripening process, color accumulation, firmness, and soluble solids content of tomato fruits can be controlled precisely, thus achieving precise control over fruit ripening.
It enables precise control of the tomato fruit ripening process, improves fruit quality, provides a theoretical basis for the breeding of high-quality and resistant-to-storage tomato varieties, and supports post-harvest preservation quality control.
Smart Images

Figure CN120005901B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural bioengineering technology, specifically relating to a tomato SlMET1L gene and its application in regulating tomato fruit ripening and preservation quality. Background Technology
[0002] As one of the world's most important economic crops, the ripening process of tomato (Solanum lycopersicum L.) directly affects the quality, nutritional value, and market competitiveness of its fruit. Fruit ripening involves complex physiological processes, including color changes, sugar accumulation, and fruit softening. The gene networks and molecular mechanisms regulating this process are still under investigation. In recent years, DNA methylation, as an important mechanism in epigenetics, has gradually been recognized as a key factor regulating plant development, stress resistance, and fruit ripening, playing a particularly important role in the regulation of fruit ripening.
[0003] The SlMET1L gene, a core gene in the tomato DNA methylation maintenance pathway, encodes a protein that plays a crucial role in this pathway. This invention reveals that this gene not only regulates the epigenetic state of the plant genome but also participates in regulating fruit ripening, thereby influencing tomato fruit quality. Based on this, this invention proposes its application in fruit ripening regulation.
[0004] The SlMET1L gene has enormous application potential, especially in genetic engineering breeding and tomato variety improvement. By regulating the expression of the SlMET1L gene, the fruit ripening process can be precisely controlled in the transgenic improvement of tomatoes, thus providing a theoretical basis and technical support for the breeding of high-quality, storage- and transport-resistant tomato varieties and the control of post-harvest preservation quality. Furthermore, the crucial role of the SlMET1L gene in tomato ripening regulation has significant breeding value, providing agricultural breeders with new targets for developing new tomato varieties adapted to different climatic conditions and market demands. Summary of the Invention
[0005] To address the problems existing in the prior art, the purpose of this invention is to design and provide a technical solution for the tomato SlMET1L gene and its application in regulating tomato fruit ripening and preservation quality.
[0006] The present invention is implemented using the following technical solutions:
[0007] The first aspect of this invention provides a tomato SlMET1L gene, which contains the nucleotide sequence (A1), (A2), (A3), or (A4):
[0008] (A1) The nucleotide sequence shown in SEQ ID NO.1;
[0009] (A2) A nucleotide sequence as shown in SEQ ID NO.1 with one or more base substitutions and / or deletions and / or additions, but with the same function;
[0010] (A3) A nucleotide sequence that is more than 70% identical to the nucleotide sequence shown in SEQ ID NO.1 and has the same function;
[0011] (A4) The nucleotide sequence obtained by attaching a tag coding sequence to the 5' end and / or 3' end of any of the defined sequences in (A1) to (A3).
[0012] A second aspect of the present invention provides a protein encoded by the tomato SlMET1L gene, the protein containing the amino acid sequence (B1), (B2), (B3), or (B4):
[0013] (B1) The amino acid sequence as shown in SEQ ID NO.2;
[0014] (B2) Proteins with the same function but with one or more amino acid residues substituted and / or deleted and / or added, as shown in SEQ ID NO.2;
[0015] (B3) An amino acid sequence that is more than 70% identical to the amino acid sequence shown in SEQ ID NO.2 and has the same function;
[0016] (B4) The amino acid sequence obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (B1) to (B3).
[0017] The third aspect of this invention provides the application of the above-mentioned tomato SlMET1L gene in regulating tomato fruit ripening and preservation quality.
[0018] Furthermore, the regulation of tomato fruit ripening and preservation quality described in this application specifically includes at least one of the following:
[0019] (1) Regulating the methylation level of tomato fruit genomic DNA;
[0020] (2) Regulating the ripening process of tomato fruits;
[0021] (3) Regulate the accumulation of color in tomato fruits;
[0022] (4) Regulate the firmness of tomato fruits;
[0023] (5) Regulate the soluble solids content of tomato fruit.
[0024] The fourth aspect of this invention provides the application of the above-mentioned tomato SlMET1L gene as a target in the breeding process related to tomato fruit ripening and preservation quality.
[0025] The fifth aspect of this invention provides a method for promoting tomato fruit ripening, increasing tomato fruit color accumulation, or increasing the soluble solids content of tomato fruit, comprising:
[0026] Increase the expression level of the SlMET1L gene in tomatoes; or
[0027] To increase the activity of the protein encoded by the SlMET1L gene in tomatoes; or
[0028] Increase the content of the protein encoded by the SlMET1L gene in tomatoes.
[0029] The sixth aspect of this invention provides a method for delaying the ripening of tomato fruit, reducing the accumulation of color in tomato fruit, or reducing the soluble solids content of tomato fruit, comprising:
[0030] Knock out the SlMET1L gene in tomatoes; or
[0031] Silent SlMET1L gene in tomatoes; or
[0032] Reduce the activity of the protein encoded by the SlMET1L gene in tomatoes; or
[0033] Reduce the content of the protein encoded by the SlMET1L gene in tomatoes.
[0034] The beneficial effects of this invention are:
[0035] This invention is the first to discover that SlMET1L can positively regulate the ripening rate of tomato fruits, including quality characteristics such as color accumulation, firmness, and soluble solids content. Inhibiting SlMET1L expression suppresses the ripening process of tomatoes, while promoting SlMET1L expression accelerates it. By rationally utilizing this gene, the ripening process and preservation quality of tomato fruits can be regulated, providing important theoretical basis and technical means for tomato quality regulation and molecular breeding, and possessing significant application value. Attached Figure Description
[0036] Figure 1 Agarose gel electrophoresis image of the PCR amplification product of the CDS of the SlMET1L gene;
[0037] Figure 2 Subcellular localization results for SlMET1L;
[0038] Figure 3 Illustration of the sgRNA design for SlMET1L based on the CRISPR / Cas9 knockout mutant;
[0039] Figure 4 Phenotypic images of the SlMET1L knockout mutant (a); SlMET1L expression level in the SlMET1L knockout mutant (b); DNA methylation level in the SlMET1L knockout mutant (c).
[0040] Figure 5 Soluble solids content of the SlMET1L knockout mutant (a); hardness of the SlMET1L knockout mutant (b);
[0041] Figure 6 SlMET1L expression level in SlMET1L overexpressed fruits (a); soluble solids content in SlMET1L overexpressed fruits (b); firmness of SlMET1L overexpressed fruits (c). Detailed Implementation
[0042] The present invention will be further illustrated below with reference to specific embodiments, but these are not intended to limit the scope of the invention. Unless otherwise specified, the reagents, consumables, etc., used in the embodiments are all commercially available, and the embodiments are all conducted according to conventional experimental methods or the manufacturer's instructions. In the quantitative experiments in the following embodiments, three replicate experiments were performed, and the results were averaged.
[0043] Example 1: Cloning of the SlMET1L gene CDS
[0044] Total RNA was extracted from tomato fruit (Solanum lycopersicum cv M82). The quality-tested RNA solution was reverse transcribed into cDNA using a one-step reverse transcription method, simultaneously removing genomic gDNA and synthesizing first-strand cDNA. The full-length CDS of SlMET1L was cloned using primers (upstream primer 5'-3'ATGTCGAGCAAACGGAAAGCTT; downstream primer 5'-3'TTAAACCTTATCTAGAGATTCGTCATTGG). High-fidelity PCR amplification was performed using this CDS as a template. The amplification products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 The band length is approximately 2000–3000 bp, and the band is clear, bright, and free of extraneous bands. Sequencing revealed the nucleotide sequence of the SlMET1L gene as shown in SEQ ID NO.1, and the amino acid sequence of its encoded protein as shown in SEQ ID NO.2.
[0045] Example 2: SlMET1L subcellular localization experiment
[0046] To verify the function of SlMET1L, a subcellular localization experiment of SlMET1L was conducted.
[0047] Vector construction: The pAEnTopo vector linked with SlMET1L-CDS was replaced with the pNC-Cam1304-SubC-eGFP vector (incubated at 50℃ for 1 h) to obtain the pNC-Cam1304-SlMET1L-eGFP recombinant plasmid, which was transformed into DH5α Escherichia coli competent cells. Single colonies were picked from LB medium containing 50 mg / mL kanamycin for colony PCR screening. Positive clones were then sequenced for verification (colony PCR and sequencing primers: upstream primer 5'-3'ggagcacgacacacttgtctact; downstream primer 5'-3'gcaagaccggcaacaggattca). After successful alignment, the recombinant plasmid was extracted.
[0048] Recombinant plasmid transformation: The successfully ligated pNC-Cam1304-SlMET1L-eGFP plasmid (along with the non-fluorescent protein pNC-Cam1304-SlMET1L plasmid) was transformed into GV3101 Agrobacterium competent cells. The transformed bacterial culture was plated on LB agar containing 50 μg / mL kanamycin and 25 μg / mL rifampin antibiotics and incubated upside down at 28°C for 2–3 days. Single colonies were picked and positive clones were screened using colony PCR (colony PCR and sequencing primers: upstream primer 5'-3'ggagcacgacacacttgtctact; downstream primer 5'-3'gcaagaccggcaacaggattca) for sequencing verification. After successful sequencing, a portion of the corresponding bacterial culture was mixed with 50% glycerol at a 1:1 ratio and stored at -80°C.
[0049] Infecting tobacco leaves: Resuspend the recombinant plasmid Agrobacterium incubated for 2 days in a shaker (220 rpm) at 28°C in a pre-prepared infection solution (1% sucrose, 10 mM MES, 10 mM MgCl2, 150 μM acetylsyringone, pH = 5.6) to OD. 600 =0.8~1.0. After standing at room temperature for 2 hours, use a 1mL sterile syringe without a needle to inject the infection solution (recombinant plasmid and empty vector) into the leaves of 3-4 week old tobacco plants until the infection solution wets the entire leaf. Incubate at 25℃ in a culture room with 16h light / 8h dark cycle for 2 days.
[0050] Laser scanning confocal microscopy observation: Tobacco leaf slices were placed on a glass slide and observed and recorded using a laser scanning confocal upright microscope. At an excitation wavelength of 488 nm, green fluorescence signals could be observed at a collection wavelength of 490–530 nm, and chloroplast autofluorescence signals could be observed at a collection wavelength of 650–750 nm.
[0051] The results are as follows Figure 2The green fluorescent signal of eGFP, generated by the expression of the SlMET1L-eGFP fusion protein in tobacco cells, is located within the nucleus, demonstrating the subnuclear localization of strawberry SlMET1L, which is consistent with its function of maintaining DNA methylation in the nucleus.
[0052] Example 3: Obtaining and validating the Slmet1l knockout mutant
[0053] 1. Preparation of Slmet1l knockout mutant
[0054] The mutant was constructed using the CRISPR / Cas9 system. Using pICH86966:AtU6p:sgRNA_PDS as a template, a pair of sgRNAs targeting SlMET1L were designed and amplified. Figure 3 The PCR products containing each sgRNA, along with pICSL01009:AtU6p providing the Arabidopsis U6 promoter, were cloned into the primary constructs pICH47751 and pICH47761, respectively, using BsaI and T4 DNA ligase. Together with other primary sgRNA constructs (pICH47732:NOSp:NPTII, pICH47742:35S:Cas9) and ligand pICH41766, the primary sgRNA constructs were assembled into the secondary vector pAGM4723 using BpiI and T4 DNA ligase. Tomato was transformed using Agrobacterium AGL1 containing the CRISPR / Cas9 construct. Regenerated plants with shoots and roots were transferred to soil for genotyping and identification. Primers and sequences for positive plants are as follows:
[0055] CRISPR vector construction ( Figure 3 ):
[0056] MET1La_sg1
[0057] TGTGGTCTCAATTGATGTTGATGTTGTATGCGGGTTTTAGAGCTAGAAA TAGCAAG
[0058] MET1La_sg2
[0059] TGTGGTCTCAATTGATGAACTACCAAGCACGGAGTTTTAGAGCTAGAA ATAGCAAG.
[0060] Mutant genotyping identification:
[0061] MET1La_WT_F
[0062] TAGGGTGATGTTGATGTTGTATG
[0063] MET1La_MU_F
[0064] TAGGGTGATGTTGATGCGGT
[0065] MET1La_R
[0066] ATCGCCCAAGGAAACCATTG.
[0067] 2. Detection of SLMET1L expression level by real-time quantitative PCR (qRT-PCR)
[0068] Total RNA was extracted from wild-type and mutant fruits. The quality-tested RNA solution was then reverse transcribed into cDNA using a one-step process, simultaneously removing genomic gDNA and synthesizing first-strand cDNA. Based on the experimental design and calculations, a 15 μL reaction mixture was prepared in a 200 μL 96-well PCR plate, including SYBR qPCR Master Mix, ultrapure water, the cDNA obtained in the previous step, and upstream and downstream primer pairs. qRT-PCR experiments were performed using the standard three-step ROX dye qRT-PCR method. SlMET1L primers: upstream primer 5'-3'CATCAATGTCGAGCAAACGGAA; downstream primer 5'-3'AAACTCATCGTCGTCCCGAAA. Internal control SlActin primers: upstream primer 5'-3'TGTCCCTATTTACGAGGGTTATGC; downstream primer 5'-3'CAGTTAAATCACGACCAGCAAGAT.
[0069] 3. Detection of DNA methylation levels in fruits of SlMET1L knockout mutants
[0070] Frozen tomatoes were pulverized in liquid nitrogen, and after pre-purification, the final precipitate was used for genomic DNA extraction. DNA extraction was performed using a silica membrane centrifuge column method. The methylated DNA was then appropriately diluted and its methylation level was determined using the MethylFlash methylation DNA quantification method. The final genomic methylation level was measured via OD0.05. 450 The reading was obtained from nm.
[0071] Figure 4 The results showed that the ripening speed of tomato fruit was significantly slowed down after SlMET1L knockout. Wild-type fruit was completely red 30 days after flowering, but mutant fruit was still completely green, indicating that SlMET1L can regulate the color accumulation of tomato fruit. Figure 4 The results showed that the Slmet1l mutant fruit exhibited a significant SlMET1L knockout effect, with expression levels 20% lower than the wild type. Figure 4The results showed that the DNA methylation level of tomato fruit was significantly reduced after SlMET1L knockout, which is consistent with the function of SlMET1L in maintaining and regulating DNA methylation level.
[0072] Example 4: Detection of changes in fruit quality indicators of Slmet1l knockout mutant
[0073] Hardness was tested using a TA-XT2i texture analyzer with a 5 mm diameter flat probe. Each fruit was tested four times around its central area at a speed of 0.5 mm / s and a distance of 6 mm, with the maximum force recorded. Soluble solids content was determined using a PAL-BX portable saccharimeter according to its instructions.
[0074] Figure 5 The results showed that the soluble solids content of the Slmet1l knockout mutant fruit was significantly lower than that of the wild-type fruit. Figure 5 The results showed that the Slmet1l knockout mutant fruit was significantly firmer than the wild-type fruit. These results further indicate that the significant decrease in expression caused by SlMET1L knockout significantly slowed down the ripening process of tomato fruit.
[0075] Example 5: Construction of SlMET1L overexpression fruit and detection of changes in quality indicators
[0076] 1. Construction of a SlMET1L overexpression model for tomato fruits
[0077] Vector construction: The pAEnTopo vector linked with SlMET1L-CDS was subjected to a displacement reaction with the pCambia-35S vector containing kanamycin resistance (incubated at 50℃ for 1 h) to obtain the pCambia-35S-SlMET1L recombinant plasmid, which was transformed into DH5α Escherichia coli competent cells. Single colonies were picked from resistant solid LB medium containing 50 mg / mL kanamycin for colony PCR screening. Positive clones were then sequenced for verification (colony PCR and sequencing primers: upstream primer 5'-3'acagtctcagaagaccaaaggg; downstream primer 5'-3'gcaagaccggcaacaggattca). After successful alignment, the recombinant plasmid was extracted.
[0078] Recombinant plasmid transformation: The successfully ligated pCambia-35S-SlMET1L plasmid (and the pCambia-35S empty vector without SlMET1L-CDS) was transformed into GV3101 Agrobacterium competent cells. The transformed bacterial culture was plated on LB agar containing 50 μg / mL kanamycin and 25 μg / mL rifampin and incubated upside down at 28°C for 2–3 days. Single colonies were picked and positive clones were screened by colony PCR (colony PCR and sequencing primers: upstream primer 5'-3'acagtctcagaagaccaaaggg; downstream primer 5'-3'gcaagaccggcaacaggattca) for sequencing verification. After successful sequencing, a portion of the corresponding bacterial culture was mixed with 50% glycerol at a 1:1 ratio and stored at -80°C.
[0079] Infecting strawberry fruits: Resuspend the recombinant plasmid Agrobacterium incubated for 2 days in a shaker (220 rpm) at 28°C in a pre-prepared infection solution (1% sucrose, 10 mM MES, 10 mM MgCl2, 150 μM acetylsylphenone, pH = 5.6) to OD. 600 =0.8~1.0, then let stand at room temperature for 2 hours. Inject the infection solution (recombinant plasmid and empty vector) into the tomato fruit or the stem segment above the fruit using a 1mL sterile syringe with a needle, and take samples after 3 days.
[0080] 2. The qRT-PCR detection section is the same as in Example 3. The soluble solids and hardness detection sections are the same as in Example 4.
[0081] In the SlMET1L overexpression experiment Figure 6 The results showed that the expression level of SlMET1L in the SlMET1L overexpression fruit was more than 10 times higher than that in the wild-type fruit of the empty vector group, which was a significant effect. Figure 6 The results showed that, compared with wild-type fruits, the soluble solids content of SlMET1L overexpression fruits was significantly increased; Figure 6 The results showed that, compared with wild-type fruits, SlMET1L overexpression significantly reduced the firmness of the fruits, further indicating that SlMET1L overexpression significantly accelerated the ripening process of tomato fruits. In conclusion, SlMET1L can be applied to the regulation of tomato fruit ripening and quality, as well as related breeding work.
[0082] SlMET1L CDS sequence (shown in SEQ ID NO.1)
[0083]
[0084] SlMET1L amino acid sequence (shown in SEQ ID NO.2)
[0085] MSSKRKASPADSSSDSSKRHALEVVKTVDIASDEVAEGFRDDDEFVEDRDIVCDSSIGESSGQKEVRRVAVRANEEQEGEFYGEIVLDSEARKKWPHRYILKDNVNINSASMSLNCQHDSDELIQAKCHFAQALVDNVIYKLGDDAYVKAAEDEDDYICKIVEFFQGVDDMKYFTAQWFYRAKDTVIKAHDQFIDKKRVFLSDIKDHNPLDCLVKKIKIVPISSNVSLQFKESLRLECDYYYDMKYLVPFSSFISLPSDVLSPDSESNSTISSDGDVVEVKEQKQEKKLLDLYSGCGGMSTGLCLGADVCDVKLVTKPSNTPTHPLLKVGDANVEDDDEGADDDDGGSGDEDEGEIFEVEEILEVCYGDPKEIKKPGLYFKVRWKGYGPDEDTWEPIEGLDGCQNKIKDFVTDGFKRSVLPLPGQVDVVCGGPPCQGISGFNRFRNSANPLQDPKNKQLEVFMSIVEFLKPRFVLMENVVDLLRFAHGYLGRYALSRLVGMNYQARMGMMVAGAYGLPQFRMRVFMWGALPSEKLPQYPLPTHNVIVRGGIPTEFELNAVDFEEGLKVKLKRELLLEDALSDLPPVENNEPRDEMPYIDEPKSVFQRFIRSRRDGTLGTVLYDHRPLQLNEDDYQRVTQIPKQKGANFRDLPGVRVRADNVVEWDPDMERVKLPSGKPLVPDYAMTFVRGTSQKPFGRLWWDEIVSTVVTRAEPHNQAILHPVQDRVLTIRENARLQGFPDYYKLTGPIKERYIQVGNAVAVPVARALGYSLALALKGLSRDQPLLTLPPNFPCLEELVSNDESLDKV*。
[0086] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.
Claims
1. A tomato SlMET1L gene, characterized in that, The tomato SlMET1L gene contains (A1) or (A2) the nucleotide sequence: (A1) the nucleotide sequence as shown in SEQ ID NO. 1; (A2) the nucleotide sequence obtained after connecting a tag coding sequence to the 5' segment and / or 3' end of the sequence defined in (A1).
2. The protein encoded by the tomato SlMET1L gene according to claim 1, characterized in that, The protein contains (B1) or (B2) the amino acid sequence: (B1) the amino acid sequence as shown in SEQ ID NO. 2; (B2) the amino acid sequence obtained after connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1).
3. The tomato SlMET1L gene for use in regulating tomato fruit ripening and fresh-keeping quality according to claim 1, wherein the regulation of tomato fruit ripening and fresh-keeping quality comprises at least one of the following: (1) regulating tomato fruit ripening process; (2) regulating tomato fruit firmness; (3) regulating tomato fruit soluble solid content.
4. The tomato SlMET1L gene for use as a target in the breeding process related to tomato fruit ripening and fresh-keeping quality according to claim 1, wherein the tomato fruit ripening and fresh-keeping quality comprises at least one of the following: (1) tomato fruit ripening process; (2) tomato fruit firmness; (3) tomato fruit soluble solid content.
5. A method of promoting ripening or increasing soluble solids content of tomato fruits, characterized in that, including: increasing the expression level of SlMET1L gene in tomato; or increasing the activity of SlMET1L gene encoded protein in tomato; or increasing the content of SlMET1L gene encoded protein in tomato; The tomato SlMET1L gene contains (A1) or (A2) the nucleotide sequence: (A1) the nucleotide sequence as shown in SEQ ID NO. 1; (A2) the nucleotide sequence obtained after connecting a tag coding sequence to the 5' segment and / or 3' end of the sequence defined in (A1).
6. A method of delaying ripening or reducing soluble solids content of tomato fruits, characterized in that, including: knocking out SlMET1L gene in tomato; or silencing SlMET1L gene in tomato; or decreasing the activity of SlMET1L gene encoded protein in tomato; or decreasing the content of SlMET1L gene encoded protein in tomato; The tomato SlMET1L gene contains (A1) or (A2) the nucleotide sequence: (A1) the nucleotide sequence as shown in SEQ ID NO. 1; (A2) the nucleotide sequence obtained after connecting a tag coding sequence to the 5' segment and / or 3' end of the sequence defined in (A1).
Citation Information
Patent Citations
FaCP5L1 and FaCP5L3 genes and application of FaCP5L1 and FaCP5L3 genes in regulation and control of fruit ripening and postharvest fresh-keeping quality
CN120005900A
Strawberry FaCMT3.1 gene and application thereof in regulation and control of fruit color quality and postharvest preservation quality
CN120005917A