Method for realizing fixed-point activation of plant genome by directionally inserting enhancer

Abstract

The invention provides a method for realizing fixed-point activation of a plant genome by directionally inserting an enhancer, and particularly, by inserting a short enhancer (STE) in a specific region of a target gene promoter, a target gene can be efficiently activated, the expression level of the target gene can be enhanced by about 2000 times, and the enhancement multiple can be flexibly adjusted as required. The site-specific activation method for the plant genome has high efficiency, wide applicability and stable heredity, and has outstanding application value in plant research and breeding.

Description

Technical Field

[0001] The invention relates to the technical fields of biotechnology and plant genetic engineering, and in particular to a method for realizing site-specific activation of plant genomes by directional insertion of enhancers. Background Art

[0002] Gene overexpression is one of the most important and widely used technologies in plant research and breeding, which usually relies on transgenic technology. However, this method is severely limited by the size of the open reading frame (ORF) sequence inserted into the expression vector. And because it uses an exogenous strong promoter and causes T-DNA insertion, it faces many problems and limitations. In addition, it is difficult to accurately activate the expression of specific genes using this method. Genome editing technology has opened up new avenues for genetic research and plant breeding, but it is mainly used for gene knockout; recently, dCas9-based gene overexpression has also been verified and used in various plants. However, the in vivo application of dCas9-based activation has not been fully explored because the activation efficiency varies greatly between different targets. There are also studies that mainly activate target genes by widely randomly editing promoters. However, there is specific editing between different gene promoters, which limits the versatility of this technology.

[0003] Therefore, there is an urgent need in the art to develop a universal and efficient method for enhancing plant gene expression. Summary of the invention

[0004] The purpose of the present invention is to provide a universal and efficient method for enhancing plant gene expression.

[0005] In a first aspect of the present invention, a method for increasing the transcription level of a target gene is provided, the method comprising:

[0006] (i) for a target gene whose expression is to be increased, determining a promoter operably linked to the target gene and a transcription start site of the target gene; and

[0007] (ii) inserting a short enhancer (STE) element into the transcription enhancing effector region of the target gene, thereby increasing the transcription level of the target gene in a predetermined cell or plant;

[0008] The transcription enhancement effector region is a region from -1 to -1500 bp upstream of the transcription start site of the target gene.

[0009] In another preferred example, the insertion position of the short enhancer (STE) element is the region from -1 to -800 bp upstream of the transcription start site of the target gene.

[0010] In another preferred example, the insertion position of the short enhancer (STE) element is the region from -1 to -500 bp upstream of the transcription start site of the target gene.

[0011] In another preferred embodiment, the insertion of short enhancer (STE) elements is performed by gene editing.

[0012] In another preferred embodiment, the gene editing uses Cas enzyme.

[0013] In another preferred embodiment, in step (ii), the insertion of the short enhancer (STE) element is performed by gene editing of plant cells in vitro, or gene editing of plant lines.

[0014] In another preferred embodiment, the inserted short enhancer (STE) element is used to perform gene editing on the plant during the flowering period.

[0015] In another preferred embodiment, the plant is selected from the following group: rice, soybean, tomato, corn, tobacco, wheat, sorghum, salvia miltiorrhiza, and alfalfa.

[0016] In another preferred embodiment, the plant is rice.

[0017] In another preferred embodiment, the short enhancer (STE) element is a short nucleotide sequence having a non-palindromic structure and having a promoter activation function.

[0018] In another preferred embodiment, the length of the short enhancer (STE) element is 30-800 bp.

[0019] In another preferred embodiment, the length of the short enhancer (STE) is 40-600 bp.

[0020] In another preferred embodiment, the length of the short enhancer (STE) is 60-200 bp.

[0021] In another preferred embodiment, the short enhancer (STE) is an endogenous short enhancer in plants.

[0022] In another preferred embodiment, the short enhancer (STE) is an endogenous short enhancer of rice.

[0023] In another preferred embodiment, the short enhancer (STE) is derived from a virus.

[0024] In another preferred embodiment, the sequence of the short enhancer (STE) is selected from the following group:

[0025] (Z1) a polynucleotide as shown in any one of SEQ ID NOs: 1-4;

[0026] (Z2) a polynucleotide having a homology of ≥95% (preferably ≥98%) with the nucleotide sequence of any one of SEQ ID NOs: 1-4 and having promoter activation function;

[0027] (Z3) A polynucleotide having promoter activation function, wherein the 5' end and / or 3' end of the polynucleotide as shown in any one of SEQ ID NOs: 1-4 is shortened by 1-30 (preferably 1-20, more preferably 1-10) nucleotides.

[0028] In another preferred embodiment, the method comprises the steps of:

[0029] (a) providing a short enhancer (STE) element;

[0030] (b) selecting an insertion site in the transcription enhancement effector region of the target gene, and performing site-directed cutting of the insertion site using a site-directed cutting nuclease;

[0031] (c) inserting the short enhancer (STE) element of step (a) into the insertion site after cutting in step (b) in a recipient plant cell.

[0032] In another preferred embodiment, the site-specific cleavage is carried out by transforming a DNA fragment encoding a site-specific cleavage nuclease into a plant receptor, causing the receptor cell to express the nuclease, thereby site-specifically cleaving the insertion site.

[0033] In another preferred embodiment, the DNA fragment encoding the site-directed cutting nuclease is a DNA fragment expressing the CRISPR / Cas9 element.

[0034] In another preferred embodiment, the DNA fragment encoding the site-directed cutting nuclease is introduced into the recipient plant by gene gun or by Agrobacterium transformation, thereby performing site-directed cutting.

[0035] In another preferred embodiment, the short enhancer (STE) element can be inserted into the insertion site in a forward or reverse direction.

[0036] In another preferred example, the short enhancer (STE) element is introduced into the recipient plant by gene gun or by Agrobacterium transformation and integrated into the insertion site.

[0037] In another preferred embodiment, the short enhancer (STE) element is integrated into the insertion site via a non-terminal ligation mechanism.

[0038] In another preferred example, when a higher multiple of transcriptional activation effect is required, the insertion position of the short enhancer (STE) element is the region -1 to -100 bp upstream of the transcription start site of the target gene; when a lower multiple of transcriptional activation effect is required, the insertion position of the short enhancer (STE) element is the region -500 to -1500 bp upstream of the transcription start site of the target gene.

[0039] In the second aspect of the present invention, a short enhancer (STE) element for enhancing gene transcription is provided, wherein the short enhancer (STE) element is a short nucleotide sequence having a non-palindromic structure and a promoter activation function; and the length of the short enhancer (STE) element is 30-800bp.

[0040] In another preferred embodiment, the STE element is a STE derived from a virus.

[0041] In another preferred embodiment, the STE element is STE derived from rice.

[0042] In the third aspect of the present invention, a genetically engineered promoter is provided, wherein the short enhancer (STE) element described in the second aspect of the present invention is inserted into the transcription enhancement effector region corresponding to the upstream of the transcription start site in the original promoter.

[0043] In the fourth aspect of the present invention, a recombinant expression cassette is provided, wherein the expression cassette comprises the genetically engineered promoter described in the third aspect of the present invention and a target gene operably linked to the promoter.

[0044] In another preferred embodiment, the expression cassette is a linear nucleic acid construct.

[0045] In the fifth aspect of the present invention, a vector is provided, wherein the vector contains the short enhancer (STE) element described in the second aspect of the present invention, the genetically engineered promoter described in the third aspect of the present invention, or the recombinant expression cassette described in the fourth aspect of the present invention.

[0046] In another preferred embodiment, the vector is an expression vector.

[0047] In another preferred embodiment, the vector comprises a plasmid.

[0048] In a sixth aspect of the present invention, a genetically engineered host cell is provided, wherein the host cell contains the vector according to the fifth aspect of the present invention;

[0049] Or the short enhancer (STE) element described in the second aspect of the present invention, the genetically engineered promoter described in the third aspect of the present invention, or the recombinant expression cassette described in the fourth aspect of the present invention is integrated into the genome of the host cell.

[0050] In another preferred embodiment, the host cell includes a plant cell.

[0051] In another preferred embodiment, the host cell is a somatic cell.

[0052] In another preferred embodiment, the host cell includes a prokaryotic organism or a eukaryotic cell.

[0053] In another preferred embodiment, the host cell includes Agrobacterium.

[0054] In a seventh aspect of the present invention, there is provided a method for preparing a transgenic plant, comprising the steps of:

[0055] (a) providing a transgenic plant cell or plant callus, wherein the plant cell or the cell in the plant callus contains the vector of the fifth aspect of the present invention; or the short enhancer (STE) element of the second aspect of the present invention, the genetically engineered promoter of the third aspect of the present invention, or the recombinant expression cassette of the fourth aspect of the present invention is integrated into the genome of the cell; and

[0056] (b) regenerating the plant cell or plant callus into a plant.

[0057] In an eighth aspect of the present invention, a kit is provided, wherein the kit comprises the following reagents:

[0058] (a) the short enhancer (STE) element described in the second aspect of the present invention, the genetically engineered promoter described in the third aspect of the present invention, the recombinant expression cassette described in the fourth aspect of the present invention, the vector described in the fifth aspect of the present invention; or Agrobacterium containing the vector; and

[0059] (b) A gene editing reagent for performing gene editing at a predetermined position in a promoter corresponding to a transcription enhancing effector region upstream of a transcription start site.

[0060] In another preferred embodiment, the gene editing reagent includes (1) Cas enzyme; and / or (2) gRNA or its coding sequence corresponding to the predetermined position.

[0061] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Shown is a reporter system established in rice using luciferase as a reporter gene, in which nLUC driven by the 35S promoter serves as an internal control and firefly luciferase (fLuc) serves as a dualLUC reporter gene.

[0063] Figure 2 It shows that the short enhancer fragments were inserted at different positions of the transcription start site of different genes. In the vectors constructed with different rice endogenous promoters, luciferase was used as the reporter gene, and the STEvs0004 enhancer was inserted at different designated positions upstream of the transcription start site. The test results are shown in Figure 2 The horizontal axis is the distance between the insertion site and the TSS. The data of the analysis results were normalized with the vector containing only the promoter as the control. All data were analyzed by one-way ANOVA (N=3): *** indicates P<0.001.

[0064] Figure 3 A schematic diagram of the insertion of STEvs0004 into the rice gene is shown. Figure 3 A: STEvs0004 was inserted at position -113 upstream of the transcription start site of rice EUI gene; Figure 3 B shows the insertion of STEvs0004 at position -66 upstream of the transcription start site of the rice RFT1 gene. Yellow indicates the inserted STEvs0004; the red number marks the distance of the STEvs0004 insertion site relative to the TSS.

[0065] Figure 4 The results show that STEvs0004 activates rice EUI and RFT1 genes at the transcriptional level. Figure 4 A shows the activation effect on rice EUI gene at the transcriptional level; Figure 4 B shows the activation effect on the transcriptional level of rice RFT1 gene. All data were analyzed by one-way ANOVA; (N=3); *** indicates P<0.001.

[0066] Figure 5 The phenotypes of the activation effect of STEvs0004 on the EUI gene in rice are shown. Scale bar: 10 cm.

[0067] Figure 6 The phenotypes of the activation effect of STEvs0004 on the rice RFT1 gene are shown. Scale bar: 1 cm.

[0068] Figure 7 The activation effect of STEvs0004 on rice LASPO and QS genes at the transcriptional level and their heritability were shown. Figure 7 A shows the activation levels of STEvs0004 on the rice LASPO gene in T1 and T2 generations; Figure 7 B shows the activation levels of STEvs0004 on rice QS genes in T1 and T2 generations.

[0069] Figure 8 The activation of multiple target genes by STEvs0004 was shown. Figure 8 A shows the NMN content of the offspring plants after STEvs0004 was inserted into QS and QPRT at the same time; Figure 8 B shows the NMN content of the offspring plants after STEvs0004 was simultaneously inserted into QS, QPRT, and NADppase; Figure 8 C shows the NMN content of the offspring plants after STEvs0004 was simultaneously inserted into QPRT, NaMNAT, NADS and NADppase.

[0070] Fig. 9 The activation effects of STEvs0004, STEvs0010, STEvs0014, and STEos0005 on genes are shown. DETAILED DESCRIPTION

[0071] After extensive and in-depth research and a large number of screenings, the inventors unexpectedly discovered for the first time that some specific non-palindromic short nucleic acid sequences are a type of highly versatile enhancer-like elements (abbreviated as STE or STE elements) that can efficiently enhance plant gene expression. Specifically, the inventors targeted the insertion of the selected short enhancer (STE) element into a specific range of positions in the promoter of a gene (i.e., a predetermined position upstream of the TSS), thereby achieving efficient activation of the gene, and significantly enhancing its expression level (usually up to about several dozen times to about a thousand times). The present invention was completed on this basis.

[0072] The experimental results show that the STE of the present invention can universally and efficiently activate gene transcription. In addition, the inventors unexpectedly discovered that the transcription enhancement effect of the STE of the present invention is adjustable. Since the gene activation effect of the STE element of the present invention is correlated with the position of STE insertion, the transcription activation effect corresponding to the predetermined enhancement multiple can be obtained by adjusting the introduction site of the STE element of the present invention. On this basis, the inventors have also developed a universal in vivo overexpression technology, called in situ gene activation technology, which can be used to efficiently and flexibly regulate the transcription of complex genes in plants such as rice.

[0073] Short enhancer (STE) elements of the present invention

[0074] As used herein, the terms "short transcription enhancer of the present invention", "short enhancer of the present invention", "STE of the present invention", "non-palindromic STE of the present invention", "short enhancer element of the present invention", "STE element of the present invention" are used interchangeably, and all refer to the universal enhancer element of the present invention that can efficiently enhance the expression of plant genes. When the STE element of the present invention is inserted into the promoter region, the expression of the target gene operably linked to the promoter can be significantly increased or up-regulated. The STE of the present invention is shorter than the conventional enhancer, so it is referred to as a short enhancer. Since the STE of the present invention does not need to rely on a palindromic structure, it belongs to a non-palindromic STE.

[0075] Typically, the lower limit of the length of the short enhancer element of the invention (L min ) is at least 30 bp, such as ≥40 bp, ≥50 bp, ≥60 bp, ≥80 bp, ≥100 bp. In addition, the upper limit of the fragment length of the short enhancer of the present invention (L max ) is at most 200 bp, such as ≤180 bp, ≤160 bp, ≤150 bp, ≤130 bp, ≤120 bp, ≤100 bp. Preferably, the length of the STE of the present invention can be any of the above lower limits (L min ) and upper limit (L max ) is reasonably determined, for example, 30-200 bp, preferably 40-150 bp, more preferably 60-130 bp.

[0076] Preferably, the non-palindromic STE of the present invention does not contain any palindromic structure in its structure, and more preferably, does not contain any palindromic structure with a length of 6-20 bp or longer. The inventors' research shows that the presence of a palindromic structure will result in the inability to effectively enhance plant gene expression.

[0077] As used herein, the term "palindrome" refers to two sequences in double-stranded DNA that are identical in structure and opposite in orientation, and each single strand is consistent with the sequence of the other strand when read in the opposite direction when read in either direction. Typically, in a palindrome, the length of the sequences that are identical in structure and opposite in orientation is at least 6 bp or at least 8 bp.

[0078] In another preferred embodiment, the STE of the present invention includes STE derived from plants, STE derived from viruses, or a combination thereof.

[0079] In another preferred embodiment, the short enhancer (STE) is an endogenous short enhancer in plants.

[0080] In another preferred embodiment, the short enhancer (STE) is an endogenous short enhancer of rice.

[0081] In another preferred embodiment, the short enhancer (STE) is a short enhancer derived from a virus.

[0082] A preferred class of STEs of the present invention is STEs derived from viruses. In the present invention, the viruses are not particularly limited, and representative viruses include (but are not limited to) Cestrum yellow leaf curling virus (CmYLCV), Wheat dwarf virus (WDV), Cauliflower mosaic virus (CaMV), Taro bacilliform virus (TaBV)

[0083] When the STE element of the present invention is introduced or inserted at different positions upstream of the TSS of different promoters, the driving efficiency of the original promoter can be effectively improved, thereby significantly enhancing the transcription and expression of the target gene. In addition, when the introduction site or insertion site of the STE element of the present invention is approximately close to the TSS, the degree (or multiple) of transcriptional activation is higher.

[0084] STE transcription enhancing effector region of the present invention

[0085] The inventors unexpectedly discovered in a large number of experiments that inserting a short enhancer into a suitable region of a gene promoter can significantly increase the expression level of the gene, and the suitable region is named STE transcription enhancement effect region. Inserting the STE element of the present invention into the STE transcription enhancement effect region can efficiently activate the expression of the target gene.

[0086] Experiments show that when the STE element of the present invention is introduced or inserted at different positions upstream of the TSS of different promoters, it can universally and efficiently improve the driving efficiency of the original promoter, thereby significantly enhancing the transcription and expression of the target gene. In addition, the position of the insertion site (or introduction site) has an effect on the activation efficiency. The activation level of STE on the gene is greatly correlated with the distance of the insertion site from the transcription start site (TSS), and the insertion site close to the transcription start site (TSS) shows a higher activation level.

[0087] For a certain promoter, the transcription enhancing effect region suitable for inserting into the STE element of the present invention is not particularly limited, as long as it is upstream of the TSS. Generally, the 3' end of the transcription enhancing effect region can be located at positions upstream of the TSS, such as -1, -5, -10, -20, -40, -50, -100, -200, -300, etc. The 5' end of the transcription enhancing effect region can be located at positions upstream of the TSS, such as -50, -100, -200, -400, -500, -800, -1000, -1500, etc. Preferably, the transcription enhancing effect region of the present invention can be reasonably determined by the above-mentioned 3' end position and 5' end position, such as -1 to -1500, -5 to -100, etc.

[0088] Preferably, in the present invention, the transcription enhancing effector region is a region 5-1000bp upstream of the transcription start site (TSS), a region 10-800bp upstream, and more preferably a region 20-500bp upstream. When TSS is taken as the origin, the suitable introduction site of the STE of the present invention is -5 to -1000, preferably -10 to -800, and more preferably -20 to -500.

[0089] In addition, the closer the introduction site or insertion site of the STE element of the present invention is to the TSS, the higher the degree (or multiple) of transcriptional activation is. This unexpected characteristic is unique to the STE element of the present invention, so the transcriptional enhancement effect of the STE of the present invention is adjustable, that is, the transcriptional activation effect corresponding to the predetermined enhancement multiple can be obtained by adjusting the introduction site of the STE element of the present invention. When a higher multiple of transcriptional activation effect is required, the STE element of the present invention can be inserted immediately upstream of the TSS, such as -1 to -100, or -5 to -80, or -10 to -60. When a higher multiple of transcriptional activation effect is required, the STE element of the present invention can be inserted before the -100 position upstream of the TSS, such as -100 to -500, or -120 to -400, or -150 to -300. When a lower fold transcriptional activation effect is desired, the STE element of the present invention can be inserted before the -500 position upstream of the TSS, for example, between -500 and -1500, or between -600 and -1200, or between -700 and -1000.

[0090] It should be understood that when the STE element of the present invention is inserted into the STE transcription enhancement effector region of a promoter (such as a plant promoter), a certain number of original nucleotides (such as 1-50 nt of the original sequence) may be deleted on one side or both sides of the insertion site, or the original nucleotide sequence may not be deleted. The research of the present invention shows that the deletion of a small amount of nucleotides at the insertion site will not affect the enhancement function of the STE element of the present invention.

[0091] In the present invention, one or more STE elements of the present invention, such as 1 to 3, preferably 1 to 2, can be inserted into the STE transcription enhancement effector region of a promoter (such as a plant promoter). When two or more STE elements of the present invention are inserted, these STE elements can be adjacent or spaced a certain distance apart.

[0092] In-situ activation technology of the present invention and its application

[0093] The STE element of the present invention can be used for in-situ activations, thereby efficiently and universally enhancing the driving efficiency of plant endogenous promoters, thereby enhancing the expression of corresponding plant endogenous genes.

[0094] The in-situ activation technology of the present invention refers to a general method for targeting the short enhancer (STE) of the present invention to the transcription enhancement effector region of the target gene, thereby achieving upregulation of the expression of the target gene. The in-situ activation technology of the present invention can achieve efficient activation of plant genes and is heritable, and can be widely used in plant research and breeding.

[0095] In addition, the promoter, construct or expression cassette containing the STE element of the present invention can also be used to express foreign genes in plants, thereby improving the agronomic traits of plants (such as the quality of edible parts, leaf shape, leaf color, flower shape, flower color, etc.), or enhancing the resistance of plants to adverse environments (such as freezing, high temperature, drought, viruses, pathogens, insect pests or artificial herbicides). The present invention can also be used to produce specific protein products (such as antigenic proteins and biological agents) in plants, or to study the specific functions of foreign genes in plant parts (such as leaves and flower organs) (such as the effect on the development of mesophyll cells, or the effect on the formation of flower organs, etc.).

[0096] In one embodiment, the in situ activation technology of the present invention effectively enhances gene expression in rice. Extensive studies of a total of 500 edited lines have verified that in situ activation can effectively enhance gene expression, achieving a 3- to 998-fold increase in expression from T0 to T2 generations, and producing expected phenotypic traits, including the trait of flowering in two weeks and the ability to achieve different rice height regulation.

[0097] In one embodiment, the in situ activation technology of the present invention can also achieve effective multiple gene activation. Specifically, four key enzymes in the β-nicotinamide mononucleotide (NMN) synthesis pathway were activated simultaneously, and the qPCR levels in all four gene in situ inserted strains increased by 20-50 times; the NMN content of rice increased by up to 2.66 times. Subsequent studies from T0 to T3 generations confirmed that the activation effect can be stably passed on to future generations.

[0098] The in situ activation technology of the present invention has high efficacy, wide applicability and stable heritability, and can be used as a potential alternative to traditional transgenic overexpression in plant research and breeding.

[0099] The main advantages of the present invention include:

[0100] (1) The in situ activation method of the present invention can activate genes efficiently and controllably. Using STEs with different activation strengths and targeting different target genes, the enhancement effect ranges from about 2 to 2000 times. Target genes with different activation multiples can be customized as needed to achieve stable and controllable activation.

[0101] (2) The in situ activation technology of the present invention can act on different types of genes under in vivo conditions, including genes that are not suitable for ectopic expression, such as genes with long ORFs and genes that are difficult to amplify, and is therefore universal.

[0102] (3) The in situ activation technology of the present invention can have stable heritability, and the activation effect can be stably passed on to future generations.

[0103] (4) The method of the present invention can not only realize the efficient activation of a single gene, but also realize the activation of multiple genes.

[0104] (5) The STE of the present invention has a high tolerance for the position of introduction. The STE element of the present invention can be inserted into a large region upstream of the promoter and exert its function. Moreover, even if the insertion site is slightly deviated, it can still exert an enhancing effect.

[0105] (6) The method of the present invention has wide applicability in different plants and has broad application prospects in plant research and breeding.

[0106] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0107] General Methods and Materials

[0108] (1) STE mining and data analysis

[0109] The JASPAR database (https: / / jaspar.genereg.net) was used to mine potential transcription factor (TF) binding sites in different locations of the genome and comprehensively collect transcription factor binding motifs of different genes. TFs with relative scores higher than 90% were selected to ensure high specificity. The sequences of the promoter regions of different genes were obtained from the rice genome (MSU 7.0), and the 1Kb upstream region of the transcription start site was used for screening. ggplot2 was used to further visualize the density of TF binding sites and identify segments with high activity enhancement effects.

[0110] (2) Vector construction

[0111] CRISPR-P2.0 was used to select the best performing targets and the corresponding oligonucleotide aptamers were designed. The target plasmid pCBSG032 and the oligonucleotide aptamer were assembled and connected by Golden Gate Assembly. First, a 25ul reaction system was established, which contained 50ng of pCBSG032 vector and 0.05pmol of oligonucleotide aptamer, and the following thermal cycling conditions were performed: 37℃ for 5 minutes, then 16℃ for 5 minutes, repeated 30 cycles, and then incubated at 60℃ for 5 minutes. The assembled plasmid was directly transformed into Escherichia coli (Novozyme Biotech Co., Ltd.) to generate CRISPR-Cas9 plasmids. For the reporter vectors p35Smini-dualLUC, pEUI-dualLUC, and pRFT1-dualLUC, the pCambia1300-LUC vector was used as the backbone. The upstream 2K sequences of EU (LOC_05g40384) and RFT1 (LOC_06g06300) were amplified and cloned into the target plasmid by Gibson assembly. The vector containing the candidate STE was amplified and cloned into the target region using the same method.

[0112] (3) Plant materials and culture conditions

[0113] The CRISPR-Cas9-edited line rice (Oryza sativa L.) ssp. japonica Xiushui134 (XS134) was grown in experimental fields in Shanghai, China (31.13°N, 121.28°E) from May to October and in Hainan, China (18.25°N, 109.50°E) from January to April.

[0114] (4) Isolation and transformation of protoplasts

[0115] 100 hulled rice seeds were inverted in 75% ethanol for about 1 minute, and then rinsed with sterile water; the seeds were inverted in 50% sodium hypochlorite solution for 20 minutes, and then rinsed 4 times with sterile water. Sterile seeds were germinated on 1 / 2MS medium and grown in a dark environment at 26-28℃ for 8-12 days. The transformation of rice protoplasts was carried out by conventional methods. The average transformation efficiency was 70-80%, and 20μg sgRNA plasmid was used for transformation. Rice protoplasts were transformed as described above. Each vector transformed an average of 10 5 protoplasts, 10 μg of transiently validated plasmid was used for each transformation, and the average transformation efficiency was 70-80%.

[0116] (5) Dual luciferase gene reporter system

[0117] The schematic diagram of the construction of the dual luciferase gene reporter system is shown in Figure 1 As shown. Firefly luciferase (nLuc) was used as the internal reference. Luciferase (fLuc) was used as a reporter gene, and the ratio of fLuc / nLuc was used to evaluate the activation effect of the enhancer.

[0118] use Discover System (Promega) was used to measure the fluorescence of the dual luciferase reporter assay system. Specifically, different reporter gene plasmids were transfected into 100 μl (10 6 ml -1 ) rice protoplasts. PEG4000 was used for transfection. After incubation for 12-16 hours, 100ul (1×) lysis buffer (Promega) was added to the protoplasts after centrifugation and washing. After incubation for 15 minutes, an equal volume of 80ul ONE-Glo was added to the 96-well plate. TM EX reagent (Promega), incubate for about 3 minutes for firefly luciferase activity detection, and then add an equal volume of NanoDLR TM Stop& Reagent (Promega) and mix well. Add NanoDLR in the same volume as the original culture medium to each well. TM Stop& Reagent (Promega) and mix well to detect NanoLuc luciferase activity.

[0119] (6) Stable transformation of rice

[0120] CRISPR-Cas9 plasmids with target sites were extracted using the midipreps Volume Kit (Tiangen) and diluted to 1 μg / μl. Plasmids and donor DNA were mixed (1 ug plasmid + 2 pmol donor for a single STE insertion, and each STE contained 1 μg plasmid + 1 pmol donor for multiple different STE-KI strains), and then 50 μl of Gold-Micro solution (60 mg / ml) was added and bombarded. Biotransformation was performed using a PDS1000 / He particle bombardment system (Bio-Rad) with a target distance of 6.0 cm from the stop plate and a helium pressure of 7.5 MPa. One-month-old rice XS134 callus tissue was used for transformation. Hygromycin B (50 mg / L; YEASEN) was used to select hygromycin-resistant calli. Plantlets were regenerated from hygromycin-resistant calli using conventional rice transformation methods.

[0121] (7) Mutant identification method

[0122] Genomic DNA was extracted from leaves using the CTAB method. The mutant products were purified and amplified using touchdown PCR. The PCR products were then tested using Hi-TOM to confirm the mutation. Plantlets with Hi-TOM results above 1% mosaicism were identified as valid insertion plants. Results The different mutations were compared with the WT and predicted full-length insertion results.

[0123] (8) RNA extraction and RT-qPCR

[0124] Total RNA was extracted from leaves of transgenic seedlings using RNA Isolator Total RNA Extraction Reagent (Novogene Biotech Co., Ltd.) RNA Isolator extraction reagent and reverse transcribed using oligo (dT) primers and M-MLV reverse transcriptase (TransGenBiotech), followed by quantitative PCR (qPCR) experiments using designed primers. Each reverse transcription-quantitative PCR (RT-qPCR) experiment was repeated three times with at least three independent RNA preparations. The rice ACT1 gene was used as an internal control.

[0125] (9) NMN detection method

[0126] Nicotinamide mononucleotide (NMN) is a key precursor for NAD+ biosynthesis. NMN can be synthesized from aspartic acid by six key enzymes: LASPO, QS, QPRT, NaMNAT, NADS and NADppase. The regulation of STE on NMN by the present invention is tested to test the ability of STE to activate multiple target genes. The detection method of NMN is as follows:

[0127] Homozygous and knock-in T2 and / or T3 generation materials germinated, and when the seedlings grew to 14 days, 1g of leaves were collected, quickly cooled with liquid nitrogen, and then fully crushed. 1 gram of leaves was mixed with 100ul 0.1M KOH to stabilize the pH value. The NMN standard curve was drawn with a dilution gradient of 0, 0.1, 0.25, 0.5, 1, 2, and 4mg / 100g using NMN standard samples and 0.01M KOH, with a correlation coefficient of 0.99. The samples were transferred to a 96ELIAS plate (400ul, black, high adsorption, BBI), with a final volume of 250μL per well, including 69μL sample, 27.7μL 20% acetophenone in dimethyl sulfoxide, and 27.7μL 2M KOH. After incubation on ice for 2 minutes, 125μL 88% formic acid was added to each well, and then incubated at 37°C for 10 minutes. UV emission at 445 nm was measured on a Varioskan LUX microplate reader (Thermo Fisher) with an excitation wavelength of 382 nm. Rice seedling leaves were stored in 0.1 M KOH solution at a ratio of 1 gram to 100 ul. The NMN content was measured using the SD curve X = (Y-9.136) / 9167078*100, where X represents the NMN content (mg / g) and Y represents the fluorescence amount (au).

[0128] Example 1: Screening of STE

[0129] In-depth mining of short-length STEs was performed in regions predicted to have enhancers in viruses and rice. Candidate enhancers were constructed into reporter vectors with three different reporter promoters and verified by in vitro transformation using rice protoplasts.

[0130] A reporter system was established in rice using luciferase as a reporter gene, in which nLUC driven by the 35S promoter was used as a control and firefly luciferase (fLuc) was used as a dualLUC reporter gene. The schematic diagram is shown in Figure 1 Three different promoters, miniCMV promoter, rice EUI promoter and rice RFT1 promoter, were used to compare the activation potential and stability of different STEs. For the candidate STEs with activation effects verified, their key motifs were analyzed to derive shorter STEs with effective activation levels.

[0131] Finally, 15 STEs with activation effects were screened from three viruses, namely Wheat dwarf virus (WDV), Cauliflower mosaic virus (CaMV), and Tarobacilliform virus (TaBV), and were named STEvs0001 to 0015. Twenty STEs with activation effects were screened from rice and were named STEos0001 to 0020.

[0132] Example 2: Correlation between STE insertion position and transcriptional activation

[0133] To detect the correlation between the STE insertion position and transcriptional activation, a reporter system was established in rice using luciferase as a reporter gene. Figure 1 , wherein nLUC driven by 35S promoter was used as control, and firefly luciferase (fLuc) was used as dualLUC reporter gene. Seven different promoters including miniCMV promoter (SEQ ID NO: 5), rice EUI promoter (SEQ ID NO: 6) and rice RFT1 promoter (SEQ ID NO: 7) were used to compare the activation ability of the STE of the present invention at different insertion positions. A representative short enhancer STEvs0004 (SEQ ID NO: 1) of the present invention was transfected into seven promoters containing different reporter genes constructed by exogenous means to explore the most suitable STE insertion position in the promoter.

[0134] The results show Figure 2 As shown in Table 1. When the STEvs0004 of the present invention is introduced or inserted at different positions upstream of the TSS of different promoters, it can effectively improve the driving efficiency of the original promoter, thereby significantly enhancing the transcription and expression of the target gene. The experimental results show that the STE of the present invention exhibits a gene activation effect on the reporter gene, up to more than 2000 times (RFT1 promoter, -25bp insertion position). In addition, when the introduction site or insertion site of the STEvs0004 of the present invention is approximately close to the TSS, the degree (or multiple) of transcriptional activation is higher (see Table 1 for details).

[0135] Table 1 Correlation between STE insertion position and transcriptional activation (results are expressed as activation fold)

[0136]

[0137] Example 3: In situ insertion of STE leads to efficient activation of rice genes in vivo

[0138] In order to fully explore the application of in situ STE activation in vivo, STEvs0004 was inserted 133 bp and 66 bp upstream of the TSS of rice EUI and RFT1 (see Figure 3 EUI encodes a cytochrome P450 monooxygenase involved in GA metabolism and the control of internode elongation; RFT1 is a flowering-related gene that mainly induces the reproductive development of the shoot apical meristem (SAM).

[0139] The T0 generation STEvs0004 insertion materials were successfully obtained at the designated positions of EUI and RFT1, and several homozygous insertion plants were found. These T0 plants were significantly upregulated in EUI: EUI#35, EUI#54 and EUI#59 plants had an activation intensity of about 160 times ( Figure 4 A); RFT1#17, RFT1#44, RFT1#46 and RFT1#49 plants can reach an activation level of about 800 times ( Figure 4 B) The T0 generation materials in EUI show extreme dwarfing ( Figure 5 ); The T0 generation materials in RFT1 can directly induce spikelet development of regenerated callus cells during tissue culture ( Figure 6 ).

[0140] The above results indicate that in situ STE activation can be used to directly regulate cellular processes in vivo, and high-level activation of EUI and RFT1 by the STE of the present invention produces very obvious phenotypes.

[0141] Example 4: In situ insertion of STE causes activation of rice genes and is heritable

[0142] To determine whether plants with in situ STE activation are heritable, two genes, LASPO and QS, were selected to test the feasibility and progeny of using STE to induce transcriptional activation in stable plants. LASPO and QS are two key enzymes in the NMN synthesis pathway that regulate intracellular NMN synthesis, where NMN serves as an NAD+ substrate in rice.

[0143] STEvs0004 was inserted 211bp and 150bp upstream of the TSS of rice LASPO and QS, and 96 and 94 T0 generation materials with STEvs0004 insertion were successfully obtained, respectively. Several homozygous lines were generated in the T1 and T2 generations. The transcriptional activation levels of the T1 and T2 homozygous lines were analyzed.

[0144] The results showed that the target genes were significantly activated in all plants analyzed; in the T1 and T2 generations, the activation levels of LASPO#14 and LASPO#40 reached about 40 times ( Figure 7 A), while the activation levels of QS#45 and QS#57 reached about 15 times ( Figure 7 B). The above results demonstrate the potential of using STE in situ activation for efficient gene overexpression in rice plants and the generation of stable progeny.

[0145] Example 5: Activation of rice metabolic pathways regulated by multiple genes

[0146] Nicotinamide mononucleotide (NMN) was used as an example to verify whether STE can activate multiple target genes. NMN can be synthesized from aspartic acid by six key enzymes: LASPO, QS, QPRT, NaMNAT, NADS and NADppase.

[0147] By single transformation with gene gun, STEvs0004 was inserted into the combination of the above target genes, such as inserting STEvs0004 into QS and QPRT at the same time; inserting STEvs0004 into QS, QPRT and NADppase at the same time; inserting STEvs0004 into QPRT, NaMNAT, NADS and NADppase at the same time. The NMN content of these different insertion combinations was detected.

[0148] The results showed that the NMN content in the three insertion combinations increased significantly, which were 0.146mg / 100g, 0.168mg / 100g and 0.277mg / 100g, with an increase of about 1.3 times, about 1.7 times and about 2.2 times ( Figure 8 ). The results show that the STE of the present invention has an activation effect on multiple target genes.

[0149] Example 6: Different STE pairs induce in vivo activation of rice genes

[0150] Example 3 was repeated, except that in addition to STEvs0004, STEvs0010 (SEQ ID NO: 2), STEvs0014 (SEQ ID NO: 3) and STEos0005 (SEQ ID NO: 4) were knocked into rice EUI or RFT1 gene, respectively.

[0151] The results are as follows Fig. 9As shown. STEvs0004, STEvs0010 and STEvs0014 were inserted into the -113 position of EUI, and three STE-inserted plants were successfully obtained, and several homozygous plants were found. These T0 plants were significantly upregulated in EUI. Plants #1 and #19 inserted with STEvs0014 showed an activation level of about 10 times; plants #3, #12, and #15 inserted with STEvs0010 showed an activation level of about 45 times; plants #96, #65, and #114 inserted with STEvs0004 showed an activation level of about 160 times. STEos0005 was inserted into the -66 position of RFT1 to obtain plants with significantly upregulated RFT1: in the three plants #6-1, #6-8 and #6-13, the transcription level of the RFT1 gene was increased by about 50 times, and it was able to directly induce the spikelet development of regenerated callus cells. The above results show that different STEs of the present invention can be used for in situ activation, directly regulating the expression of target genes, and the enhancement multiples are different.

[0152] discuss

[0153] The inventors have successfully developed an effective and universal method for simultaneously activating single and multiple gene combinations in rice in situ, called STE in situ activation technology. Using this in situ activation method, the expression of single or multiple metabolic genes in protoplasts and rice endogenous can be upregulated; gradient gene activation can also be achieved and corresponding phenotypes can be produced; the activation intensity can be successfully inherited to offspring. Traditional methods of gene overexpression through ectopic expression of exogenous transgenes usually introduce multiple gene copies and violate transgenic supervision guidelines. In contrast, in situ insertion of STEs to activate endogenous genes may be a more natural experimental mechanism. In particular, STE in situ activation can allow different types of genes to be acted on under in vivo conditions, such as genes with long ORFs and genes that are difficult to amplify, because these genes are usually not suitable for ectopic expression. In addition, the in situ insertion of STEs with different activation abilities at EUI targets resulted in different gradients of plant height in rice, indicating that the STE-based activation strategy can produce corresponding degrees of activation effects in endogenous genes and can play a role in in vivo regulation. The present invention is the first to successfully produce corresponding functional phenotypes in higher plants using a technology based on the insertion of STEs.

[0154] In addition, compared with some palindromic enhancing elements with shorter length (such as about 12 nt), the non-palindromic STE of the present invention is not only more versatile (applicable to a variety of different promoters) and has a higher expression level enhancement factor (1-3 orders of magnitude higher), but can also be inserted in a variety of positions upstream of TSS from a few bp to thousands of bp and still effectively enhance the expression level of the target gene.

[0155] sequence

[0156] STEvs0004 (SEQ ID NO:1):

[0157] TGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAC ATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTC

[0158] STEvs0010 (SEQ ID NO:2):

[0159] CGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAAT

[0160] STEvs0014 (SEQ ID NO:3):

[0161] GCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGAT

[0162] STEos0005 (SEQ ID NO:4):

[0163] GGACCGGATACCAAACCCCCTCTCGCAATCCGTCCCCAACCACACCCATCCACCCTCGGGGCCCACCTCCCTCTCGCTTC CATGTGGGTCCCAAGCCGGCTACTCTGACCTCCGG

[0164] miniCMV promoter (SEQ ID NO:5):

[0165] ATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCA TTTGGAGAGA

[0166] Rice EUI promoter (SEQ ID NO:6):

[0167]

[0168] Rice RFT1 promoter (SEQ ID NO:7):

[0169]

[0170] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for increasing the transcription level of a target gene, characterized in that: The method comprises: (i) for a target gene whose expression is to be increased, determining a promoter operably linked to the target gene and a transcription start site of the target gene; and (ii) inserting a short enhancer (STE) element into the transcription enhancing effector region of the target gene, thereby increasing the transcription level of the target gene in a predetermined cell or plant; The transcription enhancement effector region is a region from -1 to -1500 bp upstream of the transcription start site of the target gene.

2. The method according to claim 1, characterized in that The short enhancer (STE) element is a short nucleotide sequence with a non-palindromic structure and a promoter activation function.

3. The method according to claim 1, characterized in that When a higher multiple of transcriptional activation effect is required, the insertion position of the short enhancer (STE) element is the region -1 to -100 bp upstream of the transcription start site of the target gene; when a lower multiple of transcriptional activation effect is required, the insertion position of the short enhancer (STE) element is the region -500 to -1500 bp upstream of the transcription start site of the target gene.

4. A short enhancer (STE) element for enhancing gene transcription, characterized in that The short enhancer (STE) element is a short nucleotide sequence with a non-palindromic structure and a promoter activation function; and the length of the short enhancer (STE) element is 30-800 bp.

5. A genetically engineered promoter, characterized in that: The promoter is a promoter in which the short enhancer (STE) element according to claim 4 is inserted into the transcription enhancement effector region corresponding to the upstream of the transcription start site in the original promoter.

6. A recombinant expression cassette, characterized in that, The expression cassette comprises the genetically engineered promoter of claim 5 and a target gene operably linked to the promoter.

7. A carrier, characterized in that The vector contains the short enhancer (STE) element of claim 4, the genetically engineered promoter of claim 5, or the recombinant expression cassette of claim 6.

8. A genetically engineered host cell, characterized in that The host cell contains the vector according to claim 7; Or the short enhancer (STE) element of claim 4, the genetically engineered promoter of claim 5, or the recombinant expression cassette of claim 6 is integrated into the genome of the host cell.

9. A method for preparing a transgenic plant, characterized in that: Includes steps: (a) providing a transgenic plant cell or plant callus, wherein the plant cell or the cell in the plant callus contains the vector of claim 7; or the short enhancer (STE) element of claim 4, the genetically engineered promoter of claim 5, or the recombinant expression cassette of claim 6 is integrated into the genome of the cell; and (b) regenerating the plant cell or plant callus into a plant.

10. A kit, characterized in that: The kit contains the following reagents: (a) the short enhancer (STE) element of claim 4, the genetically engineered promoter of claim 5, the recombinant expression cassette of claim 6, the vector of claim 7; or Agrobacterium containing the vector; and (b) A gene editing reagent for performing gene editing at a predetermined position in a promoter corresponding to a transcription enhancing effector region upstream of a transcription start site.

Images