Application of pear PbrGIS1 gene in promoting pollen tube growth

Abstract

The application discloses application of a pear PbrGIS1 gene in promoting growth of a pear pollen tube and belongs to the technical field of plant genetic engineering. The application clones a gene PbrGIS1 from pollen of 'Dangshan Quli' pear by using a plant gene cloning technique, the nucleotide sequence of the gene PbrGIS1 is shown in SEQ ID No. 1, and the amino acid sequence coded by the gene is shown in the sequence table SEQ ID No. 2. Research shows that PbrGIS1 can promote growth of the pear pollen tube, the change in expression of PbrGIS1 is related to the change in a ROS level and a cellulose content at a top end of the pollen tube, and meanwhile, PbrGIS1 also participates in a regulation mechanism of a self-incompatibility reaction. The pollen magnetic transfection technique is used to study the function of the gene in the pollen tube, and provides a wide application prospect for improving pollination efficiency.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to the function of pear PbrGIS1 gene and its application in promoting pollen tube growth. The PbrGIS1 gene is cloned from the pollen of 'Dangshan Quli' pear, and the overexpression by antisense oligonucleotide transfection (ODN) and pollen magnetic transfection shows that PbrGIS1 promotes the change of reactive oxygen species (ROS) level at the tip of pollen tube and reduces the content of cellulose, thereby promoting the growth of pear pollen tube. BACKGROUND

[0002] Self-incompatibility (SI) is a reproductive strategy that can prevent self-fertilization and promote cross-pollination, thereby enhancing species diversity. In Rosaceae, including pear and apple, fruit trees exhibit gametophytic self-incompatibility (GSI), which is controlled by S locus genes containing female determinants (S-RNase) and male determinants (SLF / SFBs) (Franklin et al. 2008; Kao et al. 2004; Chen et al. 2018; Ushijima K et al. 2003). When pollen from the same S site falls on the stigma, S-RNase causes toxicity and destroys cell structures, including cell wall components and reactive oxygen species (ROS) levels, leading to fertilization failure (Wang et al. 2010; Chen et al. 2018; Wu et al. 2023a). In contrast, pollen from different S sites can be fertilized because SLF / SFBs genes in the Skp1-Culin1-F-box (SCF) complex can neutralize S-RNase, promoting pollen tube elongation (Hua et al. 2006). Currently, many external factors related to SI response have also been found, including leucine-rich repeat extension (LRX; Wu et al. 2023a), GPI-anchored protein (COBRA; Wu et al. 2023b), myo-inositol oxygenase (MIOX3; Xu et al. 2024), pectin methylesterase (PME44; Tang et al. 2023), self-incompatibility pollen protein (SIPP; Garcia Valencia et al. 2017), and soluble inorganic pyrophosphatase (PPa; Li et al. 2018).

[0003] As a globally popular fruit, successful pollination and fertilization are crucial for ensuring pear yields. This study identified a novel gene, PbrGIS1, in pear pollen and investigated its effects on pollen tube growth and its role in pear self-incompatibility. Exploring and applying magnetic pollen transfection technology can significantly reduce the cost of artificial pollination, holding substantial theoretical and practical significance for agricultural production. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the pear PbrGIS1 gene or biomaterials related to the PbrAGP16 gene in promoting the growth of pear pollen tubes.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention seeks protection for the use of the PbrGIS1 gene or biological materials associated with the PbrGIS1 gene in at least one of the following (a1)-(a6):

[0007] (a1) Application in promoting pollen tube growth in pear flowers;

[0008] (a2) Application in the preparation of products that promote the growth of pear pollen tubes;

[0009] (a3) Application in improving ROS levels at the tip of pear pollen tubes;

[0010] (a4) Application in the preparation of products that improve the ROS level at the tip of pear pollen tubes;

[0011] (a5) Application in reducing the cellulose content at the tip of pear pollen tubes;

[0012] (a6) Application in the preparation of products with reduced cellulose content at the tip of pear pollen tubes;

[0013] (a7) Application in improving the efficiency of pear in vitro pollination;

[0014] (a8) Application in the preparation of products that improve the efficiency of pear in vitro pollination;

[0015] The PbrGIS1 gene is any one of the following DNA molecules (b1)-(b3):

[0016] (b1) The coding region comprises a DNA molecule with the nucleotide sequence shown in SEQ ID NO.1;

[0017] (b2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1;

[0018] (b3) a DNA molecule hybridizing under stringent conditions to the DNA sequence defined in (b1) or (b2) and encoding a protein associated with promoting pollen tube growth in Pyrus.

[0019] Further, in the above-mentioned use, the biological material associated with the PbrGIS1 gene is at least one of the following (c1) to (c6):

[0020] (c1) a protein encoded by the PbrGIS1 gene;

[0021] (c2) an expression cassette containing the PbrGIS1 gene;

[0022] (c3) a recombinant vector containing the PbrGIS1 gene or a recombinant vector containing the expression cassette of (c2);

[0023] (c4) a recombinant microorganism containing the PbrGIS1 gene or a recombinant microorganism containing the expression cassette of (c2) or a recombinant microorganism containing the recombinant vector of (c3);

[0024] (c5) a transgenic plant cell line containing the PbrGIS1 gene or a transgenic plant cell line containing the expression cassette of (c2) or a transgenic plant cell line containing the recombinant vector of (c3);

[0025] (c6) a magnetic transfection reagent containing the PbrGIS1 gene or a magnetic transfection reagent containing the expression cassette of (c2) or a magnetic transfection reagent containing the recombinant vector of (c3).

[0026] Still further, the protein encoded by the PbrGIS1 gene is at least one of the following (d1) to (d3):

[0027] (d1) a protein having an amino acid sequence shown in SEQ ID NO. 2;

[0028] (d2) a protein derived from SEQ ID NO. 2 by substitution and / or deletion and / or addition of one or several amino acid residues and associated with promoting pollen tube growth in Pyrus;

[0029] (d3) a fusion protein in which the N terminus or / and C terminus of (d1) or (d2) is linked to a protein tag.

[0030] Further, the application is to stably overexpress the PbrGIS1 gene in the pollen tube of pear, to promote the growth of the pollen tube of pear or / and to increase the ROS level at the tip of the pollen tube of pear or / and to reduce the cellulose content. Further, the PbrGIS1 gene is stably overexpressed in the pollen tube of pear by using magnetic transfection overexpression technology to treat the pollen of pear in vitro.

[0031] In the second aspect, the application discloses a method for promoting the growth of the pollen tube of pear, which stably overexpresses the PbrGIS1 gene in the pollen tube of pear to promote the growth of the pollen tube of pear.

[0032] In the third aspect, the application discloses a method for increasing the ROS level at the tip of the pollen tube of pear or / and reducing the cellulose content, which stably overexpresses the PbrGIS1 gene in the pollen tube of pear to increase the ROS level at the tip of the pollen tube of pear or / and reduce the cellulose content.

[0033] Further, in the above method, the PbrGIS1 gene is stably overexpressed in the pollen tube of pear by using magnetic transfection overexpression technology to treat the pollen of pear in vitro.

[0034] Further, the magnetic transfection overexpression technology comprises the following steps:

[0035] (1) designing primers to amplify the PbrGIS1 gene, inserting the PbrGIS1 gene into the enzyme cutting sites of XbaI and BamHI of the LAT52::GFP vector to construct a recombinant plasmid PbrGIS1-LAT52::GFP;

[0036] (2) mixing the transfection reagent and the recombinant plasmid PbrGIS1-LAT52::GFP to prepare the PbrGIS1-LAT52::GFP transfection reagent; using the PbrGIS1-LAT52::GFP transfection reagent to treat the pollen cells.

[0037] ​​The application screens and identifies a functional gene PbrGIS1 from 'Dangshan Qusi' pollen, and applies the functional gene PbrGIS1 in promoting pollen tube growth. The application clones the gene PbrGIS1 from 'Dangshan Qusi' pollen by using a plant gene cloning technology. The 'Dangshan Qusi' pollen is treated in vitro by ODN and pollen magnetic transfection test, and the results show that overexpression of the PbrGIS1 gene can actively promote the growth of the pollen tube, and the change of the PbrGIS1 gene expression is related to the change of the ROS level and the cellulose content at the top of the pollen tube. In addition, the PbrGIS1 is also involved in the regulation mechanism of self-incompatibility reaction. The application studies the function of the gene in the pollen tube by using the pollen magnetic transfection technology, and provides a wide application prospect for improving pollination efficiency.

[0038] The room temperature in the application is generally 25±10 DEG C, but is not limited to this.

[0039] Compared with the prior art, the application has advantages and effects:

[0040] (1) The discovery of the PbrGIS1 gene provides a new idea for improving the in vitro pollination efficiency of pear, reduces the labor cost, and provides a new way for implementing green agriculture.

[0041] (2) Compared with the traditional pollen gene gun technology, the method of overexpressing the pollen tube gene by using the pollen magnetic transfection technology has the advantages of high transformation efficiency, simple operation, cost saving, and directional improvement of traits. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 It is the test result of the PbrGIS1 gene affecting the growth of the pear pollen tube; wherein a is the pollen tube length of as-ODN, s-ODN, cell transfection and control treatment; b is the expression level of PbrGIS1 in the pollen tube of different treatments.

[0043] Figure 2 It is the test result of the PbrGIS1 gene affecting the growth of the pear pollen tube; wherein a is the pollen magnetic transfection fluorescence picture; b is the expression level of PbrGIS1 in the pollen tube detected by the pollen magnetic transfection experiment; c is the length of the pollen tube measured by the pollen magnetic transfection experiment.

[0044] Figure 3The test results of PbrGIS1 mediating the ROS level of pollen tube top positively and the cellulose content negatively; wherein a is the fluorescence value of ROS in pollen tube treated with as-ODN, s-ODN, cell transfection and control by CM-H2DCFDA staining; b is the fluorescence value of cellulose in pollen tube treated with as-ODN, s-ODN, cell transfection and control; c is the ROS level in pollen tube detected by pollen magnetic staining experiment; d is the image of cellulose content in pollen tube induced by lat52::GFP vector and PbrWHY2-lat52::GFP fusion vector.

[0045] Figure 4 PbrGIS1 participates in self-incompatible reaction; the expression level of PbrGIS1 in pollen tube treated with self S-RNase, non-self S-RNase and control group.

[0046] Figure 5 The subcellular localization map of PbrGIS1. Specific embodiments

[0047] The present application is described in detail below in conjunction with specific embodiments. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present application, and various changes and modifications can be made to the present application without departing from the spirit and scope of the present application, so as to make it suitable for various uses and conditions.

[0048] Example 1 Identification of PbrGIS1 on pollen tube growth

[0049] The antisense oligodeoxynucleotide sequence (as-ODN) and the sense oligonucleotide sequence (s-ODN) of PbrGIS1 are designed through the RNAfold website (http: / / rna.tbi.univie.ac.at). At the same time, the primer sequence is modified by sulfur and purified by HPLC.

[0050] The PbrGIS1-ODN primers are as follows:

[0051] PbrGIS1-as-ODN: 5'-CCAAGGCCATCAGATGTCCC-3' (SEQ ID No. 5)

[0052] PbrGIS1-s-ODN: 5'-GGACAATTGGAGGGCATATAA-3' (SEQ ID No. 6)

[0053] The specific steps are as follows: pear pollen is added to 2 mL of culture medium (5 mM 2-morpholinoethanesulfonic acid (MES), 440 mM sucrose, 0.55 mM calcium nitrate, 1.60 mM magnesium sulfate, 1.60 mM boric acid, 1.00 mM potassium nitrate, pH = 6.2-6.3) and incubated on a shaker for 60 min; 12.5 μL of the liquid culture medium, 1.5 μL of Lipofectamine 2000 and 6 μL of ODN primers are incubated at room temperature for 15 min; the premixed ODN primers are added to 180 μL of the incubated pollen culture medium; the pollen is further cultured at 25°C for 3 h; observation and photography are performed using a Nikon Eclipse E100 microscope (Tokyo, Japan), and ImageJ is used to measure the pollen tube length. The results show that, after 3 hours of treatment (HAT), the pollen tube treated with as-ODN is shorter than that treated with s-ODN, transfection reagent and buffer (as shown in a of FIG. 1). Figure 1

[0054] 3000 rpm, 10 min to collect the pollen, remove the liquid culture medium, and store in a -80°C refrigerator. The pollen RNA is extracted, and the first strand cDNA is obtained by reverse transcription for qRT-PCR experiment of the PbrGIS1 gene. The RNA extraction uses a plant total RNA extraction kit (purchased from Beijing Tiangen Biotech Co., Ltd., and operated according to the operation instruction provided by the kit). The RNA reverse transcription to cDNA uses TransScript One-Step RT-PCR SuperMix (purchased from Beijing Zonnuo Biotech Co., Ltd., and operated according to the instruction provided by the kit). The specific quantitative primers of PbrGIS1 are designed as follows:

[0055] PbrGIS1-qPCR-F: 5'-CTGGGTATGTGCTGTATGGAATG-3' (SEQ ID No. 7)

[0056] PbrGIS1-qPCR-R: 5'-ATGATACTGCTGCCTCTTCTTCC-3' (SEQ ID No. 8)

[0057] The specific quantitative primers of pear UBQ gene as an internal reference are as follows:

[0058] PbUBQ-F: 5'-CCCTTCACTTGGTTCTCCGT-3' (SEQ ID No. 9)

[0059] PbUBQ-R: 5'-TAATCAGCAAGCGTGCGACC-3' (SEQ ID No. 10) ​

[0060] qRT-PCR experiments were performed using the LC480 SYBR Green Mix kit (purchased from Roche) according to the manufacturer's instructions. The 20 μL qRT-PCR reaction system included: 10 μL 2x SYBR Green Mix, 0.4 uM forward and reverse primers, 20 ng cDNA, and the rest was supplemented with sterile water. The 96-well qRT-PCR plate (purchased from Roche) was used, and the qRT-PCR instrument (model: LightCycler 480, Roche) was used for PCR. The qRT-PCR reaction program was: 95 °C pre-denaturation for 10 min; 95 °C denaturation for 3 s, 62 °C annealing for 10 s, 72 °C extension for 30 s, 45 cycles. Each cDNA was set up with three biological replicates and three technical replicates, and the average Ct value of each cDNA sample was calculated. The relative expression of PbrGIS1 was calculated by 2 -ΔΔCt The standard error was based on three repeated qRT-PCR analyses and at least 90 pollen tube growth assays. The variance analysis used the Student's t-test, and the letters (a and b) indicated P < 0.05. As shown in Fig. 2b, the expression level of PbrGIS1 in the as-ODN-treated pollen tube was decreased. These results indicated that the decrease in the expression level of PbrGIS1 inhibited the growth of the pear pollen tube. Figure 1

[0061] Example 2 Application of magnetic transfection of PbrGIS1 in promoting pollen tube growth

[0062] In the present application, the plasmid vector is the LAT52::GFP vector (Qian et al., 2020). The resistance tag of this vector is kanamycin, and the double enzyme digestion is preferably XbaI and BamHI (purchased from NEB). The optimal reaction system and conditions for enzyme digestion: 800 ng LAT52::GFP empty plasmid, 5 μL 10x Cutsmart Buffer, 1 μL BamHI endonuclease, 1 μL XbaI endonuclease, supplemented with ddH2O to 50 μL, 37 °C reaction for 4 h.

[0063] The primer pair for PCR amplification of the gene is:

[0064] PbrGIS1-F: 5'-ATGGCTGGGTATGTGCTGTATG-3' (SEQ ID No. 3)

[0065] PbrGIS1-R: 5'-ATCCTCATCTTTAATTCCATTTCCTC-3' (SEQ ID No. 4)

[0066] ​PCR amplification system: 2 μL 'Dangshan pear' pollen cDNA, 2.5 μL of each primer, 25 μL 2x PhantaMax Buffer, 1 μL dNTP Mix, 1 ul PhantaMax Super-Fidelity DNA Polymerase (purchased from Nanjing Novozyme Biotech Co., Ltd.), and ddH2O to 50 μL. The amplification program is: 94°C, pre-denaturation 3 min, 94°C denaturation 30 s, 60°C annealing 30 s, 72°C extension 140 s, 35 cycles of thermal cycling, 72°C extension 10 min, 4°C storage. After amplification, the PCR product with a single band of interest was detected by 1.5% agarose gel electrophoresis, and the specific band was recovered according to the gel recovery kit (purchased from Nanjing Novozyme Biotech Co., Ltd.) according to the instructions.

[0067] The double enzyme-digested vector was ligated with the purified DNA, and the ligase Exnase II was purchased from Nanjing Novozyme Biotech Co., Ltd. The reaction system was 20 μL: 150 ng LAT52::GFP linear vector, 50 ng gene fragment, 4 μL 5x CE II Buffer, 2 μL Exnase II, and the rest was supplemented with ddH2O, 37°C for 30 min. Then the ligation product was transferred into E. coli DH5a (purchased from Nanjing Novozyme Biotech Co., Ltd.), ice bath for 30 min, heat shock for 45 s, then ice bath for 2 min, 37°C 220 rpm shaking bed activation for 60 min. After activation, it was coated on the LB solid plate with 100 μg / ml kanamycin, and after 14 hours, 5 positive clones were picked for sequencing (completed by Shanghai Sunway Biotech Co., Ltd.). The recombinant plasmid PbrGIS1-LAT52::GFP with successful sequencing was extracted using an endotoxin-free plasmid extraction kit (purchased from Nanjing Novozyme Biotech Co., Ltd.).

[0068] The optimal method of pollen magnetic transfection is as follows: put 'Dangshan pear' pollen cells into a tissue culture dish placed on a magnetic marker plate (purchased from Nanjing Dongna Co., Ltd.), and the volume of the medium containing cells depends on the size of the culture dish, preferably 0.5 mL of transfection volume, and incubate for 15 minutes. Mix the transfection reagent (purchased from Nanjing Dongna Co., Ltd.) and PbrGIS1-LAT52::GFP recombinant plasmid, preferably 0.5-2 μL, DNA amount 0.5-3 μg. LAT52::GFP empty plasmid as control; the prepared The transfection reagent and control reagent were added into the cells, respectively, and the cell culture plate was still placed on the magnetic marker plate for incubation for 20 minutes; the supernatant pollen culture medium was carefully removed from the cells, and fresh culture medium was added, and the culture plate was still placed on the magnetic marker plate. Care should be taken not to suck away the cells sinking due to magnetic force; the culture plate was removed from the magnetic marker plate; after 3 hours of standard condition culture at 25°C and 120 rpm, whether the MNP / DNA complex was transferred into the pollen was determined by observing whether there was GFP fluorescence in the magnetically transfected pollen by laser confocal microscope LSM800 (Zeiss, Germany). The pollen tube length was counted by Nikon Eclipse E100 microscope (Tokyo, Japan), and data analysis was performed. The RNA of the magnetically transfected pollen was extracted, and first-strand cDNA was obtained by reverse transcription, which was used for qRT-PCR experiment of PbrGIS1 gene. The pollen RNA extraction, cDNA reverse transcription and qRT-PCR experiment were the same as in Example 1. The standard error was based on the qRT-PCR analysis of 3 repeats and at least 90 pollen tube growth analysis. The variance analysis used Student's t-test, and the P values were represented by letters (a and b) as P < 0.05.

[0069] The results showed that GFP fluorescence was detected in the pollen tube into which the LAT52::GFP or PbrGIS1-LAT52::GFP fusion vector was introduced, indicating the applicability of pollen magnetic staining technology in the study of gene overexpression in pear pollen tube Figure 2 a) in the results. 3 HAT Figure 2 c) in the results, the pollen tube into which the PbrGIS1-LAT52::GFP fusion vector was introduced was longer than the pollen tube into which the LAT52::GFP vector was introduced. At the same time, compared with the LAT52::GFP vector, the expression amount of PbrGIS1 in the pollen tube of the PbrGIS1 fusion vector was increased Figure 2 b) in the results. These results showed that the increase of PbrGIS1 expression amount promoted the growth of pear pollen tube.

[0070] Example 3 Identification of PbrGIS1 affecting ROS and cellulose content in pollen tube

[0071] The pollen culture was the same as in Examples 1 and 2.

[0072] The present application uses 5-(and 6-)chloromethyl-2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA, Thermo Fisher Scientific, USA) and nitroblue tetrazolium (NBT, Merck, Germany) fluorescent staining method to determine the ROS level of the pollen tube tip, the optimal method is as follows: after adding H2DCFDA fluorescent dye with a final concentration of 20 mM to the as-ODN treated pollen sample for 20 min, washing the sample with liquid medium for three times; after adding NBT fluorescent dye with a final concentration of 1 mg / ml to the magnetofection treated pollen sample, washing the sample with liquid medium for three times; using laser confocal microscope LSM800 (Zeiss, Germany) to observe and take pictures, and using Zeiss software to count the fluorescence intensity of the pollen tube tip. Calcofluor White (Merck, Germany) is used for cellulose staining of the pollen tube, with a final concentration of 1 mg / mL.

[0073] The results show that the ROS fluorescence of the pollen tube tip treated by as-ODN decreases compared with the pollen tube treated by s-ODN, transfection reagent and buffer (as shown in Figure 3 a) of FIG. 6. In contrast, the pollen tube tip introduced with PbrGIS1-LAT52::GFP vector shows higher ROS fluorescence compared with LAT52::GFP vector (as shown in Figure 3 c) of FIG. 6. These results show that PbrGIS1 plays a positive role in the ROS level at the tip of pear pollen tube. In addition, Calcofluor White fluorescent staining shows that the cellulose fluorescence is enhanced after as-ODN treatment (as shown in Figure 3 b) of FIG. 6), and the cellulose fluorescence of the pollen tube introduced with PbrGIS1-LAT52::GFP is weakened (as shown in Figure 3 d) of FIG. 6). These results show that PbrGIS1 negatively mediates the cellulose content at the tip of pear pollen tube.

[0074] Example 4 PbrGIS1 responds to self S-RNase

[0075] The full-length coding sequences of PbrS1-RNase and PbrS2-RNase genes are amplified from the style of "Huanghua pear", and the full-length coding sequences of PbrS7-RNase and PbrS34-RNase genes are amplified from the style of "Dangshan pear"; four S-RNases are inserted into the pCold-TF expression vector to produce his-labeled recombinant proteins; BamHI and XbaI are selected as endonucleases. The primer pair sequences are as follows:

[0076] PbrS1-RNase-F: 5'-ATGTACGATTATTTTCAATTTACGCAGCAAT-3' (SEQ ID No. 11) PbrS1-RNase-R: 5'-ATACTGAACACTGGAGGGGCAGG-3' (SEQ ID No. 12)

[0077] PbrS2-RNase-F: 5'-ATGGCGAGATACGATTATTTTCAATTTACGC-3' (SEQ ID No. 13) PbrS2-RNase-R: 5'-ATACTGAATATCATCAATGGGGCAGAA-3' (SEQ ID No. 14)

[0078] PbrS7-RNase-F: 5'-ATGTACGATTATTTTCAATTTACGCAGCAAT-3' (SEQ ID No. 15) PbrS7-RNase-R: 5'-ATACTTAACATCGGCCGGGCAG-3' (SEQ ID No. 16)

[0079] PbrS34-RNase-F: 5'-ATGTACGATTATTTTCAATTTACGCAGCAAT-3' (SEQ ID No. 17) PbrS34-RNase-R: 5'-ATACTGAATACTATTGTTTGGGCAAAAATG-3' (SEQ ID No. 18)

[0080] The preferred procedure of PCR, enzyme digestion system and recombination vector construction are the same as Example 2.

[0081] 500 ng of the recombination plasmid was transformed into E. coli Rosetta (DE3) respectively, and spread on the plate containing 100 μg / mL ampicillin to screen the recombination gene, and cultured in 37 °C incubator for 14 h. The pCold-TF vector plasmid was also transformed into Rosetta (DE3) as a control. Single colony was selected for identification. The E. coli Rosetta (DE3) transformed with the recombination plasmid was inoculated in liquid screening medium for activation, and cultured in 37 °C, 220 rpm for overnight, then transferred to new liquid screening medium for culture, and the OD 600= 0.4-0.6, the inoculation amount of the activation culture and the expansion culture is preferably 1:50; 2 ml of the bacterial solution is taken as a negative control. The expansion culture conical flask is quickly placed on ice for 45 min, and then IPTG inducer is added, preferably at a final concentration of 0.5 mmol / L, and induction expression is performed at 16°C, 220 rpm for 18-24 h.

[0082] After the expression is completed, the bacteria are collected by centrifugation at 4°C, 12000 rpm. The bacteria are resuspended with 15 mL of PBS buffer (140 mmol / L sodium chloride, 2.7 mmol / L potassium chloride, 10 mmol / L disodium hydrogen phosphate, 1.8 mmol / L potassium dihydrogen phosphate, pH 7.4), and then ultrasonic broken, power 240 W, broken for 4 s, and stopped for 6 s, until the solution is clear. After the ultrasonic breaking is completed, the supernatant is collected by centrifugation at 4°C, 12000 rpm for 20 min. The control protein pCold-TF is also expressed by the above method.

[0083] The recombinant protein is purified by Ni-NTA agarose affinity chromatography filler (purchased from Shanghai Biosciences Co., Ltd.). The specific operation is as follows: the above filler is equilibrated with PBS buffer at a flow rate of 1 ml / min; the broken protein supernatant is added to the purification column at a flow rate of 0.5 ml / min; the column is washed with 20 mmol / L imidazole-containing washing solution (500 mmol / L sodium chloride, 50 mmol / L tris(hydroxymethyl) aminomethane, 20 mM imidazole, pH = 7.4) at a flow rate of 1 ml / min; the purification column is eluted with 8 times the column volume of 400 mmol / L imidazole-containing elution solution (500 mmol / L sodium chloride, 50 mmol / L tris(hydroxymethyl) aminomethane, 400 mM imidazole, pH = 7.9) at a flow rate of 1 ml / min, and the eluate is collected to obtain the purified protein. The protein is concentrated and desalted using a 30 kDa ultrafiltration tube. 10 μL of the purified protein is taken, 2 μL of 5× protein loading buffer (purchased from Shanghai Biosciences Co., Ltd.) is added, and then 10 μL is taken for 12% regular SDS-PAGE electrophoresis. After staining with coomassie brilliant blue and decolorizing, the purification of the recombinant protein is detected. Finally, the purified protein is dialyzed at 4°C, 5000 rpm using pollen culture medium, and then placed in -80°C for standby.

[0084] The “Dangshan pear” pollen is pre-cultured in the basic medium for 1 h, and then treated with recombinant PbrS1-RNase and PbrS2-RNase proteins or recombinant PbrS7-RNase and PbrS34-RNase proteins (final concentration of 0.15 U). Then, it is cultured at 25°C, 120 rpm for 30 min on a shaker. The RNA extraction, cDNA reverse transcription and qRT-PCR experiment are the same as in Example 1.

[0085] To verify whether PbrGIS1 is involved in GSI, we treated the Dangshan pear pollen tubes with non-self (PbrS1-RNase and PbrS2-RNase) and self S-RNases (PbrS7-RNase and PbrS34-RNase) for 30 min. Real-time fluorescent quantitative PCR analysis showed that the expression level of PbrGIS1 in the pollen tubes treated with self SI was lower than that in the pollen tubes treated with non-self SC and pCold ( Figure 4 ) Therefore, PbrGIS1 is involved in pear GSI by responding to self S-RNase.

[0086] Example 5 Identification of PbrGIS1 subcellular localization

[0087] In the present application, the plasmid vector is 1300::GFP vector. The resistance tag of this vector is kanamycin, and the double enzyme digestion is preferably XbaI and BamHI (purchased from NEB company). The optimal reaction system and conditions of enzyme digestion: 800 ng of 1300::GFP empty plasmid (Tang et al., 2023), 5 μL of 10×Cutsmart Buffer, 1 μL of BamHI endonuclease, 1 μL of XbaI endonuclease, supplemented with ddH2O to 50 μL, 37°C reaction for 4 h.

[0088] The optimal operation of constructing the vector is the same as that of Example 2. 500 ng of the recombinant plasmid correctly sequenced is transferred into GV3101 competent cells, which are subjected to ice bath for 5 min, liquid nitrogen for 5 min, 37°C for 5 min, ice bath for 5 min again, and then incubated at 30°C on a shaker for 2 h, and then plated on plates containing 50 mg / mL kanamycin and rifampicin. After two days, the single colony of Agrobacterium correctly identified is transferred into a 10 ml centrifuge tube containing 2 ml of liquid LB medium (containing 50 mg / mL of rifampicin and kanamycin), and cultured at 28°C on a shaker for 24 h. 2 mL of the above bacterial body is transferred into 20 mL of liquid LB medium, and cultured at 28°C on a shaker at 220 rpm for 8-12 h until the OD600 of the bacterial solution is 0.8-1.0. Centrifugation is performed at 5000 rpm for 5 min, and the culture medium is discarded. Resuspend using induction solution containing (10 mM MES, 10 mM MgCl2 and 200 μM acetyl-syringone) until the OD600 is 0.6-0.8, and then incubate at 25°C on a horizontal shaker at 80 rpm in the dark for 3 h. Then, the induction solution is injected into the leaves of tobacco growing vigorously using a 1 ml syringe, and then incubated in the dark for 24 h, and then transferred to light conditions for further treatment for 48 h before observing under a fluorescence microscope.

[0089] As Figure 5As shown, the tobacco cells transformed with the empty vector 1300::GFP have green fluorescence in the cell membrane, cytoplasm and nucleus, while the tobacco cells transformed with PbrGISl have green fluorescence in the cytoplasm and cell membrane, thus PbrGISl is located in the cytoplasm and nucleus of the tobacco cells.

[0090] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the scope of the present application.

[0091] SEQUENCE LISTING

[0092] SEQ ID NO: 1

[0093] ATGGCTGGGTATGTGCTGTATGGAATGGCTGGGAACTTGATAACTGAGCTAGCTGGGAAGCTGAGGATGGCACGGGAAATTGAAAGCCGGACAATTGGAGGGCATATAAGATTTGGGACATCTGATGGCCTTGGACCACAAGCTACTGCTTCAGGTCTGCCCGGAAGAAGAGGCAGCAGTATCATGGTGTCGAGCATTCTTCATCCTCTGATAATCCCTACTAGGCCTACAACTGAGTGTCTGATCCAGAGTCTCAGCCATGATCTTAAGACTCGCATCCTCGGTCAGAATCATGTCCTCGATAAGGGTGTCCAAGGAAAGCTGTCAGCTGACTTTGGAAGCAAGTTGCGGACAGCTCAGAATGAATTAGAGAATGAGCTTTACATGCTTGGAAAGCTACGGATGTCTATTTTCTGGAGCATTTCGCGGATTTTTAATATCATTTTTCTAGAAGAAGTTATGGTCATTTTAACACTGAAAGGTTCCCAAGAGGTTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAAACAAGTAGCCAAAACTGATGCAATCAAGAACAAACCAGCTGACACATATTCAAATATCAGAGGAAATGGA

[0094] ATTAAAGATGAGGATTAA

[0095] SEQ ID NO: 2

[0096] MAGYVLYGMAGNLITELAGKLRMAREIESRTIGGHIRFGTSDGLGPQATASGLPGRRGSSIMVSSILHPLIIPTRPTTECLIQSLSHDLKTRILGQNHVLDKGVQGKLSADFGSKLRTAQNELENELYMLGKLRMSIFWSISRIFNIIFLEEVMVILTLKGSQEVEQFVTDKKALKAINPIKQVAKTDAIKNKPADTYSNIRGNGIKDED

[0097] SEQ ID NO: 3

[0098] 5'-ATGGCTGGGTATGTGCTGTATG-3'

[0099] SEQ ID NO: 4

[0100] 5'-ATCCTCATCTTTAATTCCATTTCCTC-3'

[0101] SEQ ID NO: 5

[0102] 5'-CCAAGGCCATCAGATGTCCC-3'

[0103] SEQ ID NO: 6

[0104] 5'-GGACAATTGGAGGGCATATAA-3'

[0105] SEQ ID NO: 7

[0106] 5'-CTGGGTATGTGCTGTATGGAATG-3'

[0107] SEQ ID NO: 8

[0108] 5'-ATGATACTGCTGCCTCTTCTTCC-3'

[0109] SEQ ID NO: 9

[0110] 5'-CCCTTCACTTGGTTCTCCGT-3'

[0111] SEQ ID NO: 10

[0112] 5'-TAATCAGCAAGCGTGCGACC-3'

[0113] SEQ ID NO: 11

[0114] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0115] SEQ ID NO: 12

[0116] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0117] SEQ ID NO: 13

[0118] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0119] SEQ ID NO: 14

[0120] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0121] SEQ ID NO: 15

[0122] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0123] SEQ ID NO: 16

[0124] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0125] SEQ ID NO: 17

[0126] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

[0127] SEQ ID NO: 18

[0128] 5'- ATG TAC GAT TAT TTT CAATTT ACG CAG CAAT -3'

Claims

1. PbrGIS1 The gene is used in at least one of the following (a1)-(a8): (a1) Application in promoting pollen tube growth in pear flowers; (a2) Application in the preparation of products that promote the growth of pear pollen tubes; (a3) Application in improving ROS levels at the tips of pear pollen tubes; (a4) Application in the preparation of products that improve the ROS level at the tip of pear pollen tubes; (a5) Application in reducing the cellulose content at the tip of pear pollen tubes; (a6) Application in the preparation of products with reduced cellulose content at the tip of pear pollen tubes; (a7) Application in improving the efficiency of pear in vitro pollination; (a8) Application in the preparation of products that improve the efficiency of pear in vitro pollination; The aforementioned PbrGIS1 A gene is a DNA molecule with a coding region as shown in SEQ ID NO.

1.

2. As described in claim 1 PbrGIS1 The application of gene-related biomaterials in at least one of the following (a1)-(a8): (a1) Application in promoting pollen tube growth in pear flowers; (a2) Application in the preparation of products that promote the growth of pear pollen tubes; (a3) Application in improving ROS levels at the tips of pear pollen tubes; (a4) Application in the preparation of products that improve the ROS level at the tip of pear pollen tubes; (a5) Application in reducing the cellulose content at the tip of pear pollen tubes; (a6) Application in the preparation of products with reduced cellulose content at the tip of pear pollen tubes; (a7) Application in improving the efficiency of pear in vitro pollination; (a8) Application in the preparation of products that improve the efficiency of pear in vitro pollination; The above and PbrGIS1 Gene-related biological materials are at least one of the following (c1)-(c6): (c1) PbrGIS1 Proteins encoded by genes; (c2) contains the above PbrGIS1 Gene expression cassettes; (c3) contains the above PbrGIS1 A recombinant vector of the gene, or a recombinant vector containing the expression cassette described in (c2); (c4) contains the above PbrGIS1 Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in (c2), or recombinant microorganisms containing the recombinant vector described in (c3); (c5) contains the above PbrGIS1 A transgenic plant cell line containing the gene, or a transgenic plant cell line containing the expression cassette described in (c2), or a transgenic plant cell line containing the recombinant vector described in (c3); (c6) contains the above PbrGIS1 A magnetic transfection reagent for a gene, or a magnetic transfection reagent containing the expression cassette described in (c2), or a magnetic transfection reagent containing the recombinant vector described in (c3).

3. The application according to claim 2, characterized in that, The PbrGIS1 The protein encoded by the gene is either (d1) or (d2): (d1) A protein with the amino acid sequence shown in SEQ ID NO.2; (d2) A fusion protein to which a protein tag is attached to the N-terminus and / or C-terminus of (d1).

4. The application according to claim 1 or 2, characterized in that, The above PbrGIS1 The gene is stably overexpressed in pear pollen tubes, promoting pollen tube growth and / or increasing ROS levels at the pollen tube tip and / or reducing cellulose content.

5. The application according to claim 4, characterized in that, The pear pollen was treated in vitro using magnetic transfection overexpression technology to express the above-mentioned... PbrGIS1 The gene is stably overexpressed in pear pollen tubes.

6. A method for promoting pollen tube growth in pear blossoms, characterized in that, The as described in claim 1 PbrGIS1 The gene is stably overexpressed in pear pollen tubes, promoting pollen tube growth.

7. A method for increasing the ROS level at the tip of pear pollen tubes and / or reducing the cellulose content, characterized in that, The as described in claim 1 PbrGIS1 The gene is stably overexpressed in pear pollen tubes, increasing ROS levels at the pollen tube tip and / or reducing cellulose content.

8. The method according to any one of claims 6-7, characterized in that, The pear pollen was treated in vitro using magnetic transfection overexpression technology to express the above-mentioned... PbrGIS1 The gene is stably overexpressed in pear pollen tubes.

9. The method according to claim 8, characterized in that, The magnetic transfection overexpression technique specifically includes the following steps: (1) Design primers for PCR amplification PbrGIS1 Genes, will be described PbrGIS1 The gene was inserted into the XbaI and BamHI restriction sites of the LAT52::GFP vector to construct the recombinant plasmid PbrGIS1. - LAT52::GFP; (2) After mixing the transfection reagent and the recombinant plasmid PbrGIS1-LAT52::GFP, pollen cells were treated.

Images