Primer probe group for detecting candida bloodstream infection, kit and application

Abstract

The invention provides a primer probe set for detecting candida bloodstream infection, a kit and application, and belongs to the technical field of microbiological detection. The primer probe group for detecting candida bloodstream infection comprises a primer probe group 1 and / or a primer probe group 2, the primer probe group 1 is one or more of a primer probe for detecting candida albicans, a primer probe for detecting candida tropicalis and a primer probe for detecting candida glabrata; and the primer probe group 2 is one or two of a primer probe for detecting candida krusei and a primer probe for detecting candida parapsilosis. The primer probe group 1 disclosed by the invention can be used for simultaneously and rapidly detecting candida albicans, candida tropicalis and candida glabrata; the primer probe group 2 can be used for simultaneously and rapidly detecting the candida krusei and the candida parapsilosis, and has the characteristics of high sensitivity, high detection specificity, simplicity and convenience in operation, short detection time and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial detection, and relates to detection of Candida bloodstream infection, and specifically to a primer probe set, a kit and an application thereof for detecting Candida bloodstream infection. Background Art

[0002] Bloodstream infection (BSI) is a common clinical emergency that seriously endangers the life safety of patients and has a very high mortality rate. In recent years, the incidence of fungal bloodstream infection has been increasing. Among them, bloodstream infection caused by Candida is the most common cause of bloodstream infection in hospitalized patients and is very likely to lead to death in critically ill patients. Among them, there are five species that occupy a considerable position in Candida bloodstream infection: Candida albicans (CA), Candida tropicalis (CT), Candida glabrata (CG), Candida krusei (CK), and Candida parapsilosis (CP). At present, blood culture is still the gold standard commonly used for isolation and detection of bloodstream infection in clinical practice, but its detection cycle is long and the positive detection rate is low, which cannot meet the clinical "rapid diagnosis" required for the diagnosis and treatment of bloodstream infection in critically ill patients. Therefore, when the pathogen is not clear, doctors can only use broad-spectrum antibiotics for treatment, which increases the patient's mortality rate and total hospitalization time, while increasing the patient's treatment costs and making treatment more difficult.

[0003] At present, molecular biological technologies for bloodstream infection include nucleic acid hybridization technology, nucleic acid amplification, DNA sequence analysis, gene chip and MALDI-TOF MS technology, which have shortened the diagnosis time and improved the identification efficiency to a certain extent. However, the sensitivity is low, and it is impossible to quickly identify low-concentration bacteria (<10 CFU / mL) in the patient's blood. Therefore, the rapid detection and early diagnosis of these low-concentration bloodstream infection bacteria will help patients take effective measures in time, which is of great significance to the treatment and prognosis of patients and is conducive to reducing the mortality rate of patients with fungal bloodstream infection. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a primer probe set, a kit and an application for detecting Candida bloodstream infection. The present invention uses a primer probe set to directly detect Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis in the blood quickly, accurately and specifically.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer probe group for detecting Candida bloodstream infection, wherein the primer probe group includes primer probe group 1 and / or primer probe group 2; the primer probe group 1 is one or more of a primer probe for detecting Candida albicans, a primer probe for detecting Candida tropicalis, and a primer probe for detecting Candida glabrata; the primer probe group 2 is one or two of a primer probe for detecting Candida krusei and a primer probe for detecting Candida parapsilosis;

[0007] The primers and probes for detecting Candida albicans were: CA-RAA-F, CA-RAA-R, and CA-qPCR-P;

[0008] The nucleotide sequences of CA-RAA-F, CA-RAA-R and CA-qPCR-P are shown in SEQ ID NO.1 to SEQ ID NO.3 respectively;

[0009] The primers and probes for detecting Candida tropicalis were: CT-RAA-F, CT-RAA-R, and CT-qPCR-P;

[0010] The nucleotide sequences of CT-RAA-F, CT-RAA-R and CT-qPCR-P are shown in SEQ ID NO.4 to SEQ ID NO.6 respectively;

[0011] The primers and probes for detecting Candida glabrata were: CG-RAA-F, CG-RAA-R, and CG-qPCR-P;

[0012] The nucleotide sequences of CG-RAA-F, CG-RAA-R and CG-qPCR-P are shown in SEQ ID NO.7 to SEQ ID NO.9 respectively;

[0013] The primers and probes for detecting Candida krusei were: CK-RAA-F, CK-RAA-R, and CK-qPCR-P;

[0014] The nucleotide sequences of CK-RAA-F, CK-RAA-R and CK-qPCR-P are shown in SEQ ID NO.10 to SEQ ID NO.12 respectively;

[0015] The primers and probes for detecting Candida parapsilosis were: CP-RAA-F, CP-RAA-R, and CP-qPCR-P;

[0016] The nucleotide sequences of the CP-RAA-F, CP-RAA-R and CP-qPCR-P are shown in SEQ ID NO.13 to SEQ ID NO.15, respectively.

[0017] Preferably, the CA-qPCR-P, CT-qPCR-P, CG-qPCR-P, CK-qPCR-P and CP-qPCR-P are respectively labeled with different fluorescent groups.

[0018] Preferably, the fluorescent group includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5 or TAMRA.

[0019] Preferably, in primer probe set 1, the CA-qPCR-P is labeled with FAM, the CT-qPCR-P is labeled with CY5, and the CG-qPCR-P is labeled with HEX; in primer probe set 2, the CK-qPCR-P is labeled with FAM, and the CP-qPCR-P is labeled with VIC.

[0020] The present invention provides a kit for detecting Candida bloodstream infection, and the kit comprises the above primer probe set.

[0021] Preferably, the kit comprises M1 protein magnetic beads, a RAP kit reaction system and a qPCR reaction solution containing magnesium acetate.

[0022] Preferably, the final concentration of the Candida albicans primers is 195-255 nM; the final concentration of the Candida tropicalis primers is 190-250 nM; the final concentration of the Candida glabrata primers is 190-230 nM; the final concentration of the Candida krusei primers is 95-155 nM; and the final concentration of the Candida parasitica primers is 180-205 nM.

[0023] The present invention provides an application of the primer probe set in preparing a product for detecting Candida albicans or Candida bloodstream infection, wherein the Candida include one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

[0024] The present invention provides an application of M1 protein magnetic beads and the primer probe group in preparing a product for detecting Candida or Candida bloodstream infection, wherein the Candida includes one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

[0025] The present invention provides a method for detecting Candida albicans or Candida albicans bloodstream infection using the above kit, the method being used for non-diagnostic purposes and comprising the following steps:

[0026] M1 protein magnetic beads are used to enrich pathogens in the blood, and pathogen nucleic acids are extracted. After the RAP kit reaction system and the qPCR reaction solution containing magnesium acetate are mixed, pathogen nucleic acids are added, and RAA amplification and qPCR amplification are performed using the primer probe set.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention provides a primer probe group for detecting Candida bloodstream infection. The primer probe group includes primer probe group 1 and / or primer probe group 2. Primer probe group 1 can quickly detect Candida albicans, Candida tropicalis, and Candida glabrata; primer probe group 2 can quickly detect Candida krusei and Candida parapsilosis, and has the characteristics of high sensitivity, high detection specificity, simple operation, short detection time, etc.

[0029] The present invention also provides a kit for detecting Candida bloodstream infection. Based on the kit, the present invention combines multiple RAP technology with M1 magnetic bead enrichment technology, integrates the RAA system and the qPCR system in one tube, realizes two-stage amplification in a single closed tube, and uses M1 magnetic beads to pre-treat blood specimens, further improving the amplification efficiency and sensitivity of detecting Candida. On the one hand, the short probe in qPCR is used to avoid the use of complex and long probes in RAA, thereby improving the versatility of the technology. On the other hand, the reaction time of qPCR is shortened, making the detection faster, thereby realizing high sensitivity, specificity, and rapid detection of multiple Candida or Candida bloodstream infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 A schematic diagram of the detection principle of the RAP combined with magnetic beads enrichment technology provided by the present invention;

[0031] Figure 2 The results of the analytical sensitivity (LOD) of the RAP method and the conventional qPCR method for detecting CA provided by the present invention are shown in Figure 1; wherein A is the sensitivity diagram of RAP for detecting CA; B is the sensitivity diagram of screening the optimal primers in the PCR method and using the conventional qPCR method to determine CA;

[0032] Figure 3 The results of the analytical sensitivity (LOD) of the RAP method and the conventional qPCR method for detecting CT provided by the present invention are shown in Figure 1; wherein A is the RAP sensitivity diagram for detecting CT; and B is the sensitivity diagram for determining CT using the conventional qPCR method by screening the optimal primers in the PCR method;

[0033] Figure 4 The results of the analytical sensitivity (LOD) of the RAP method and the conventional qPCR method for detecting CG provided by the present invention are shown in Figure 1; wherein A is a sensitivity diagram of RAP for detecting CG; and B is a sensitivity diagram of the inner primers of qPCR in the RAP method for determining CG using a conventional qPCR method;

[0034] Figure 5The results of the analytical sensitivity (LOD) of the RAP method and the conventional qPCR method for detecting CK provided by the present invention are shown in Figure 1; wherein A is a sensitivity graph of RAP for detecting CK; and B is a sensitivity graph of the inner primers of qPCR in the RAP method for determining CK using a conventional qPCR method;

[0035] Figure 6 The results of the analytical sensitivity (LOD) of the RAP method and the conventional qPCR method for detecting CP provided by the present invention are shown in Figure 1; wherein A is a sensitivity diagram of RAP for detecting CP; and B is a sensitivity diagram of the inner primers of qPCR in the RAP method for determining CP using a conventional qPCR method;

[0036] Figure 7 Figure 1 is a multiple RAP detection limit analysis diagram using primer probe sets before M1 magnetic bead enrichment, A is the multiple RAP detection limit analysis result using CA primer probes before M1 magnetic bead enrichment; B is the multiple RAP detection limit analysis result using CT primer probes before M1 magnetic bead enrichment; C is the multiple RAP detection limit analysis result using CG primer probes before M1 magnetic bead enrichment; D is the multiple RAP detection limit analysis result using CK primer probes before M1 magnetic bead enrichment; E is the multiple RAP detection limit analysis result using CP primer probes before M1 magnetic bead enrichment;

[0037] Figure 8 Figure 1 is a multiple RAP detection limit analysis diagram using primer probe set after M1 magnetic bead enrichment, A is the multiple RAP detection limit analysis result using CA primer probe after M1 magnetic bead enrichment; B is the multiple RAP detection limit analysis result using CT primer probe after M1 magnetic bead enrichment; C is the multiple RAP detection limit analysis result using CG primer probe after M1 magnetic bead enrichment; D is the multiple RAP detection limit analysis result using CK primer probe after M1 magnetic bead enrichment; E is the multiple RAP detection limit analysis result using CP primer probe after M1 magnetic bead enrichment;

[0038] Fig. 9 are the CT values ​​and fluorescence value results of amplification curves amplified using primer pairs with different permutations and combinations, A is the CT value and fluorescence value results of amplification curves amplified using CA primer pairs with different permutations and combinations; B is the CT value and fluorescence value results of amplification curves amplified using CT primer pairs with different permutations and combinations; C is the CT value and fluorescence value results of amplification curves amplified using CG primer pairs with different permutations and combinations; D is the CT value and fluorescence value results of amplification curves amplified using CK primer pairs with different permutations and combinations; E is the CT value and fluorescence value results of amplification curves amplified using CP primer pairs with different permutations and combinations;

[0039] Fig.10Figure 1 is the amplification effect of Candida detected by the RAP method of Example 1 under different primer concentrations. A is the amplification effect of CA detected by the RAP method of Example 1 under different primer concentrations; B is the amplification effect of CT detected by the RAP method of Example 1 under different primer concentrations; C is the amplification effect of CG detected by the RAP method of Example 1 under different primer concentrations; D is the amplification effect of CK detected by the RAP method of Example 1 under different primer concentrations; E is the amplification effect of CP detected by the RAP method of Example 1 under different primer concentrations. DETAILED DESCRIPTION

[0040] The present invention provides a primer probe group for detecting Candida bloodstream infection, wherein the primer probe group includes primer probe group 1 and / or primer probe group 2; the primer probe group 1 is one or more of a primer probe for detecting Candida albicans, a primer probe for detecting Candida tropicalis, and a primer probe for detecting Candida glabrata; the primer probe group 2 is one or two of a primer probe for detecting Candida krusei and a primer probe for detecting Candida parapsilosis;

[0041] The primers and probes for detecting Candida albicans are: CA-RAA-F, CA-RAA-R and CA-qPCR-P; the nucleotide sequences of CA-RAA-F, CA-RAA-R and CA-qPCR-P are shown in SEQ ID NO.1 to SEQ ID NO.3, respectively.

[0042] In the present invention, the CA-qPCR-P is labeled with a fluorescent group, and the site of the fluorescent group is further labeled at the 5' end of the probe sequence. In the present invention, the fluorescent group preferably includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5, TAMRA or HEX, and more preferably, the CA-qPCR-P is preferably labeled with FAM. The CA-qPCR-P is labeled with a quencher group, and the site of the fluorescent group is further labeled at the 3' end of the probe sequence. The quencher group preferably includes BHQ1, BHQ2 or BHQ3, and more preferably, the CA-qPCR-P is preferably labeled with BHQ1.

[0043] In the present invention, the primers and probes for detecting Candida tropicalis are: CT-RAA-F, CT-RAA-R and CT-qPCR-P; the nucleotide sequences of CT-RAA-F, CT-RAA-R and CT-qPCR-P are shown in SEQ ID NO.4 to SEQ ID NO.6, respectively.

[0044] In the present invention, the CT-qPCR-P is labeled with a fluorescent group, and the site of the fluorescent group is further labeled at the 5' end of the probe sequence. In the present invention, the fluorescent group preferably includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5, TAMRA or HEX, and further preferably, the CT-qPCR-P is preferably labeled with CY5. The CT-qPCR-P is labeled with a quenching group, and the site of the fluorescent group is further labeled at the 3' end of the probe sequence. The quenching group preferably includes BHQ1, BHQ2 or BHQ3, and further preferably, the CT-qPCR-P is preferably labeled with BHQ1.

[0045] In the present invention, the primers and probes for detecting Candida glabrata are: CG-RAA-F, CG-RAA-R and CG-qPCR-P; the nucleotide sequences of CG-RAA-F, CG-RAA-R and CG-qPCR-P are shown in SEQ ID NO.7 to SEQ ID NO.9, respectively.

[0046] In the present invention, the CG-qPCR-P is labeled with a fluorescent group, and the site for labeling the fluorescent group is the 5' end of the probe sequence. In the present invention, the fluorescent group preferably includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5, TAMRA or HEX, and further preferably, the CG-qPCR-P is preferably labeled with HEX. The CG-qPCR-P is labeled with a quencher group, and the site for labeling the fluorescent group is the 3' end of the probe sequence. The quencher group preferably includes BHQ1, BHQ2 or BHQ3, and further preferably, the CG-qPCR-P is preferably labeled with BHQ1.

[0047] In the present invention, the primers and probes for detecting Candida krusei are: CK-RAA-F, CK-RAA-R and CK-qPCR-P; the nucleotide sequences of CK-RAA-F, CK-RAA-R and CK-qPCR-P are shown in SEQ ID NO.10 to SEQ ID NO.12, respectively.

[0048] In the present invention, the CK-qPCR-P is labeled with a fluorescent group, and the site of the fluorescent group is further labeled at the 5' end of the probe sequence. In the present invention, the fluorescent group preferably includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5, TAMRA or HEX, and further preferably, the CK-qPCR-P is preferably labeled with FAM. The CK-qPCR-P is labeled with a quencher group, and the site of the fluorescent group is further labeled at the 3' end of the probe sequence. The quencher group preferably includes BHQ1, BHQ2 or BHQ3, and further preferably, the CK-qPCR-P is preferably labeled with BHQ1.

[0049] In the present invention, the primers and probes for detecting Candida parapsilosis are: CP-RAA-F, CP-RAA-R and CP-qPCR-P; the nucleotide sequences of the CP-RAA-F, CP-RAA-R and CP-qPCR-P are shown in SEQ ID NO.13 to SEQ ID NO.15, respectively.

[0050] In the present invention, the CP-qPCR-P is labeled with a fluorescent group, and the site for labeling the fluorescent group is the 5' end of the probe sequence. In the present invention, the fluorescent group preferably includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5, TAMRA or HEX, and further preferably, the CP-qPCR-P is preferably labeled with VIC. The CP-qPCR-P is labeled with a quencher group, and the site for labeling the fluorescent group is the 3' end of the probe sequence. The quencher group preferably includes BHQ1, BHQ2 or BHQ3, and further preferably, the CP-qPCR-P is preferably labeled with BHQ1.

[0051] In the present invention, RAA primers are designed according to the RAA primer design principle, and the length of RAA primers corresponding to each pathogen is between 30 and 35 bp, and the probe is a Taqman probe. After the RAA primers are amplified by the RAA reaction, they also act as qPCR primers for amplification in the qPCR stage. Compared with the two-step RAP method of using a pair of RAA primers and a pair of qPCR primers for amplification, the cumbersomeness of primer design is solved, the operation is simpler, and at the same time, it still has high detection specificity and sensitivity.

[0052] The present invention has no special restrictions on the synthesis method of the primer probe set provided, and there is no special requirement for the labeled fluorescent group, and the synthesis can be carried out according to the conventional synthesis method in the art. The primer probes described in the present invention are all synthesized by Shanghai Bioengineering Co., Ltd.

[0053] The present invention provides a kit for detecting Candida bloodstream infection, and the kit comprises the above primer probe set.

[0054] In the present invention, the kit includes M1 protein magnetic beads, a RAP kit reaction system and a qPCR reaction solution containing magnesium acetate. The M1 protein magnetic beads are prepared by mixing proteinA magnetic beads and M1 protein, the amino acid sequence of the M1 protein is shown in SEQ ID NO.21, and the nucleotide sequence encoding the M1 protein is shown in SEQ ID NO.22. The mass ratio of the proteinA magnetic beads and the M1 protein is 4:1. As a preferred embodiment, the preparation method of the M1 magnetic beads preferably includes the following steps: adding 1 mg of proteinA magnetic beads to 1 mL of PBS, discarding the supernatant after separation on a magnetic stand for 3 minutes, repeating twice, resuspending in 1 mL of PBS, adding 250 μg of M1 protein, suspending in a suspension instrument for 30 minutes, discarding the supernatant after separation on a magnetic stand for 3 minutes, and resuspending in 100 μL of PBS to prepare the M1 protein magnetic beads. The M1 protein magnetic beads of the present invention can capture pathogens in the sample, achieve the enrichment of pathogens in the blood, and after enrichment, the relative concentration of pathogens can be increased and other interfering components in the blood can be removed. The pathogens preferably include Candida, such as one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis. The sources of the proteinA magnetic beads and the M1 protein of the present invention are not particularly limited, and any commercially available product separated from other components known in the art can be used, such as the commercial information of proteinA magnetic beads is BioMagbeads, BMPA1500.

[0055] In the present invention, the final concentration of the Candida albicans primer is preferably 195-255nM, more preferably 200-250nM, and more preferably 200nM; the final concentration of the Candida albicans probe is preferably 130-135nM, more preferably 132-134nM, and more preferably 133nM; the final concentration of the Candida tropicalis primer is preferably 190-250nM, more preferably 200-220nM, and more preferably 200nM; the final concentration of the Candida tropicalis probe is preferably 97-103nM, more preferably 98-102nM, and more preferably 100nM; the final concentration of the Candida glabrata primer is preferably 190-230nM, more preferably 200-220nM, and more preferably 20 0nM; the final concentration of Candida glabrata probe is preferably 130-135nM, more preferably 132-134nM, more preferably 133nM; the final concentration of Candida krusei primer is preferably 95-155nM, more preferably 100-150nM, more preferably 150nM or 125nM; the final concentration of Candida krusei probe is preferably 97-103nM, more preferably 98-102nM, more preferably 100nM; the final concentration of Candida quasinus primer is preferably 180-205nM, more preferably 190-200nM, more preferably 200nM; the final concentration of Candida quasinus probe is 64-68nM, more preferably 65-67nM, more preferably 66nM. When the present invention adopts the above primer final concentration, the amplification effect is best.

[0056] The present invention provides an application of the primer probe set in preparing a product for detecting Candida albicans or Candida bloodstream infection, wherein the Candida include one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

[0057] The present invention provides an application of M1 protein magnetic beads and the primer probe group in preparing a product for detecting Candida or Candida bloodstream infection, wherein the Candida includes one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

[0058] The present invention provides a method for detecting Candida albicans or Candida albicans bloodstream infection using the above kit, the method being used for non-diagnostic purposes and comprising the following steps:

[0059] M1 protein magnetic beads are used to enrich pathogens in the blood, and pathogen nucleic acids are extracted. After the RAP kit reaction system and the qPCR reaction solution containing magnesium acetate are mixed, pathogen nucleic acids are added, and RAA amplification and qPCR amplification are performed using the primer probe set.

[0060] The principle diagram of the present invention using multiple one-system RAP method combined with magnetic bead enrichment to detect Candida bloodstream infection is as follows Figure 1 As shown. Since the enzymes in the RAA and qPCR reactions require different temperatures, the two reaction systems can react separately without interfering with each other. First, the qPCR system and the RAA system are prepared in a certain proportion and divided into eight tubes. The RAA reaction is first carried out in the tube at 40°C for 15 minutes, and then heated to 97°C in the second stage to inactivate the recombinase. At the same time, the remaining RAA primers in the RAA reaction serve as qPCR primers, and then the large amount of target products in the first stage RAA reaction are used as templates to continue the next step of qPCR reaction and detect the results.

[0061] In the present invention, M1 protein magnetic beads are used to enrich pathogens in blood and extract pathogen nucleic acids. As a preferred embodiment, the method of using M1 protein magnetic beads to enrich pathogens in blood includes the following steps: in a 3-4 mL whole blood sample, 160 μL of 1 mg M1 protein magnetic beads is added, and PBS is used to make up to 10 mL, followed by adding 40 μL of CaCl2 with a final concentration of 1M, and the suspension is suspended for 1 hour in a suspension instrument, and after magnetic separation on a magnetic stand, the supernatant is discarded, and PBS is used to wash 3 times to remove blood components and pathogens that are not adsorbed on the M1 protein magnetic beads, and finally resuspended in 150 μL PBS for use.

[0062] In the present invention, after the RAP kit reaction system and the qPCR reaction solution containing magnesium acetate are mixed, pathogen nucleic acid is added, and RAA amplification and qPCR amplification are performed using the primer probe set. During RAA amplification, the temperature of the RAA reaction is preferably 39-42°C. In the present invention, the RAA reaction temperature is more preferably 40°C. During qPCR amplification, the reaction temperature of qPCR is the normal qPCR cycle temperature, and the reaction temperatures of the two are very different. At 40°C, the hot start DNA polymerase in the qPCR reaction system is not activated, and magnesium ions activate the RAA reaction; at the qPCR reaction temperature, the recombinase in the RAA system will be inactivated, and the RAA primers act as qPCR primers, so that the products after the RAA reaction undergo corresponding qPCR reactions. The present invention does not specifically limit the source of the RAP kit reaction system, and a commercially available product of a conventional RAA (basic method) reaction kit known in the art can be used. The RAP kit reaction system is shown in Table 2. The qPCR reaction solution containing magnesium acetate is shown in Table 3. In the present invention, the time of the RAA reaction is preferably 15min. The present invention has no particular limitation on the source of the qPCR reaction solution, and any commercially available product known in the art may be used.

[0063] In the present invention, the amplification procedures of the qPCR reactions of CA, CT, CG, CK and CP are preferably 95°C 5 min, 95°C 15 s, 55°C 45 s, 40 cycles; 95°C 5 min, 95°C 15 s, 60°C 45 s, 40 cycles; 95°C 3 min, 95°C 15 s, 55°C 45 s, 40 cycles; 95°C 5 min, 95°C 15 s, 60°C 45 s, 40 cycles; 95°C 5 min, 95°C 15 s, 60°C 45 s, 40 cycles.

[0064] In the present invention, if the amplification curve corresponding to CA has a peak and shows S-type amplification, it is determined that the sample to be tested contains CA, and if the amplification curve corresponding to CA does not have a peak or has no obvious S-type amplification, it is determined that the sample to be tested does not contain CA; if the amplification curve corresponding to CT has a peak and shows S-type amplification, it is determined that the sample to be tested contains CT, and if the amplification curve corresponding to CT does not have a peak or has no obvious S-type amplification, it is determined that the sample to be tested does not contain CT; if the amplification curve corresponding to CG has a peak and shows S-type amplification, it is determined that the sample to be tested contains CG, and if the amplification curve corresponding to CG does not have a peak or has no obvious S-type amplification, it is determined that the sample to be tested does not contain CG; if the amplification curve corresponding to CK has a peak and shows S-type amplification, it is determined that the sample to be tested contains CK, and if the amplification curve corresponding to CK does not have a peak or has no obvious S-type amplification, it is determined that the sample to be tested does not contain CK; if the amplification curve corresponding to CP has a peak and shows S-type amplification, it is determined that the sample to be tested contains CP, and if the amplification curve corresponding to CP does not have a peak or has no obvious S-type amplification, it is determined that the sample to be tested does not contain CP.

[0065] The detection method of the present invention is based on the high sensitivity and rapidity of the RAA reaction. In the first stage, the template can be enriched in a short time (within 15 minutes), and then the second stage qPCR is performed. The entire amplification process can be completed within 70 minutes. The method has ultra-high sensitivity and can reach a single copy / reaction, which is better than conventional qPCR.

[0066] Based on the primer probe set or kit described in the present invention, rapid detection of low-concentration (less than 10 CFU / mL) pathogens in the blood can be achieved. The detection described in the present invention combines recombinase-assisted PCR technology (Recombinase aided PCR, RAP) with magnetic bead enrichment technology, uses recombinant human mannan-binding lectin protein (M1 protein) magnetic beads to enrich trace pathogens in the blood, and performs multiple-system RAP detection on various bloodstream infection Candida after nucleic acid extraction. Due to the low concentration of fungal pathogens in the patient's blood, conventional molecular biological methods have limited sensitivity and cannot effectively detect them. The present invention uses M1 magnetic beads to pre-treat the specimen, which can capture pathogens in the blood sample. Combining the multiple-system RAP technology with the M1 magnetic bead enrichment technology, by adjusting the buffer ratio of the RAA reaction system and the qPCR reaction system and selecting a suitable reaction enzyme, a two-stage amplification in a single tube closed tube is finally achieved. The present invention overcomes the shortcomings of RAA and qPCR. On the one hand, the short probe in qPCR is used to avoid the use of complex and long probes in RAA, thereby improving the versatility of the detection method. On the other hand, the reaction time of qPCR is shortened, making the detection faster and realizing the detection of various Candida bloodstream infections.

[0067] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0068] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0069] Example 1

[0070] Preparation of simulated positive blood samples with different bacterial concentrations and simulated PBS specimens with different bacterial concentrations:

[0071] After the colonies of Candida albicans (CA), Candida tropicalis (CT), Candida glabrata (CG), Candida krusei (CK) and Candida parapsilosis (CP) were cultured in YPD culture medium at 27°C and 220rpm overnight, the bacterial suspension was centrifuged at 5000g for 3 minutes, the supernatant was discarded, and the suspension was repeated twice. The suspension was resuspended with 1mL PBS, and the concentration of each bacterial suspension was measured by counting on an abalone counting plate after diluting PBS 10 times. The concentration of each bacterial suspension was gradiently diluted with PBS solution, and the same bacterial suspension of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis was drawn into 1mL PBS and 1mL blood sample, respectively. PBS simulated specimens with different bacterial concentrations and simulated positive blood samples with the same bacterial concentration as the PBS simulated specimens were prepared (the final concentrations of CA, CT and CG were all <10CFU / mL, 20CFU / mL, 50CFU / mL, 100CFU / mL, 200CFU / mL, 300CFU / mL, 500CFU / mL, 1000CFU / mL; the final concentrations of CK and CP were all <10CFU / mL, 50CFU / mL, 100CFU / mL, 300CFU / mL, 500CFU / mL, 700CFU / mL, 900CFU / mL).

[0072] PBS mock specimens were used for plating to determine the actual bacterial concentration of the simulated blood samples.

[0073] The blood sample is taken from the blood of a healthy person and does not contain infectious pathogens. After adding a quantitative Candida albicans liquid, it is made into a quantitative Candida albicans simulated blood positive sample.

[0074] Among them, high-concentration simulated blood samples (the final concentrations of CA, CT and CG were 20CFU / mL, 50CFU / mL, 100CFU / mL, 200CFU / mL, 300CFU / mL, 500CFU / mL and 1000CFU / mL; the final concentrations of CK and CP were 50CFU / mL, 100CFU / mL, 300CFU / mL, 500CFU / mL, 700CFU / mL and 900CFU / mL) were subjected to multiple RAP and qPCR detection without M1 enrichment to determine the sensitivity of mRAP for Candida blood samples; low-concentration simulated blood samples (<10CFU / mL) were subjected to multiple RAP and qPCR detection after M1 enrichment to determine the sensitivity of M1 enrichment and mRAP methods for low-concentration Candida blood samples.

[0075] Add 1 mg protein A magnetic beads (BioMagbeads, BMPA1500) to 1 mL PBS, separate on a magnetic stand for 3 minutes and discard the supernatant, repeat twice, resuspend with 1 mL PBS, add 250 μg M1 protein (the amino acid sequence of the M1 protein is shown in SEQ ID NO.21, and the nucleotide sequence encoding the M1 protein is shown in SEQ ID NO.22; M1 protein and its preparation, see patent application number: CN201910560238.2), suspend in a mixer for 30 minutes, separate on a magnetic stand for 3 minutes and discard the supernatant, resuspend with 100 μL PBS to prepare M1 magnetic beads.

[0076] Use M1 magnetic beads to pre-treat the above-mentioned <10CFU / mL simulated positive blood samples to enrich pathogens. The specific steps are as follows: add 1mL of simulated positive blood sample to a 14mL large round-bottom tube, then add 160μL M1 magnetic beads, then add PBS buffer to make the total system reach 10mL, and finally add 40μL of 1M calcium chloride, suspend in a suspension instrument for 1h, remove the cover and place the large round-bottom tube on a magnetic stand for separation for 5min, discard the supernatant, add 1000μL PBS to wash 3 times, discard the supernatant, and finally resuspend in 150μL PBS buffer and transfer to an EP tube for use.

[0077] The collected high-concentration simulated positive blood samples and the low-concentration simulated blood enriched liquid are used Nucleic acid was extracted using Microbiome DNA Isolation Kit to obtain positive sample nucleic acid, which was stored at -80°C until use.

[0078] The nucleic acid of the positive samples was tested for mRAP using the primers and probes of CA, CT, CG, CK and CP in Table 1 , and qPCR was performed in parallel using the qPCR primers and probes in Table 1 .

[0079] Reagents used in primer probe set 1: RAA kit is Amp Future DNA Basic Method Constant Temperature Amplification Kit (WLE8201KIT), qPCR kit is Hot Start TTx (DNA) Kit (HSTTX-101) of Japan TOYOBO, ETSSB is NEB's ultra-thermostable single-stranded protein (M2401S), and amplification instrument is Kunpeng Archimed X6 fluorescence quantitative PCR instrument.

[0080] Primer probe set 1 RAP method: Prepare the RAP kit reaction system according to Table 2, and prepare the total reaction solution according to the proportion of the components in the qPCR and RAA kits: Take out a dry powder tube from the Amp Future DNA Basic Method Constant Temperature Amplification Kit, prepare 40.5μL of mixed solution A according to Table 2, and add 40.5μL to the RAA dry powder tube to dissolve the RAA dry powder; dispense 13.5μL of mixed solution A fused with RAA dry powder into eight-tube strips; then prepare mixed solution B containing magnesium acetate according to Table 2, and add 3.5μL of mixed solution B to the cap of the eight-tube strip; finally, add 3μL of sample nucleic acid to the tube and seal the cap. Centrifuge instantly in the Eastwin handheld centrifuge to allow the magnesium acetate to fall into the RAA system and start the RAA reaction. Finally, put it into the PCR instrument and the reaction procedure is carried out according to Table 4.

[0081] Reagents used in primer probe set 2: RAA kit is Amp Future DNA Basic Method Constant Temperature Amplification Kit (WLE8201KIT), qPCR kit is Taq DNA enzyme (TE5H2B.5-01) from Beijing Najie Diagnostics, ET SSB is NEB's ultra-thermostable single-stranded protein (M2401S), and the amplification instrument is Kunpeng ArchimedX6 fluorescence quantitative PCR instrument.

[0082] Primer probe set 2 RAP method: Prepare the RAP kit reaction system according to Table 3, and prepare the total reaction solution according to the proportion of the components in the qPCR and RAA kits: Take out a dry powder tube from the Amp Future DNA Basic Method Constant Temperature Amplification Kit, and prepare 52.05μL of mixed solution A according to Table 3, and add 52.05μL to the RAA dry powder tube to dissolve the RAA dry powder; dispense 17.35μL of mixed solution A fused with RAA dry powder into eight-tube strips; then add 0.65μL of mixed solution B (magnesium acetate) to the cap of the eight-tube strip according to Table 2; finally, add 2μL of sample nucleic acid to the tube and seal the cap. Centrifuge instantly in the Eastwin handheld centrifuge to allow the magnesium acetate to fall into the RAA system and start the RAA reaction. Finally, put it into the PCR instrument and the reaction procedure is carried out according to Table 4.

[0083] Table 1 shows the primer and probe information for detecting Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

[0084] Table 1 Multiplex RAP and qPCR primer and probe information

[0085]

[0086]

[0087] Table 2 shows the reaction system of the primer probe set 1 RAP kit and Table 3 shows the reaction system of the primer probe set 2 RAP kit.

[0088] Table 2 Primer probe set 1 RAP kit reaction system

[0089]

[0090] Table 3 Primer probe set 2 RAP kit reaction system

[0091]

[0092]

[0093] The RAABuffer in Table 2 and Table 3 is the component contained in the Amp Future DNA Basic Method Constant Temperature Amplification Kit.

[0094] Table 4 shows the amplification program of RAP, and both primer probe set 1 and primer probe set 2 are this amplification program.

[0095] Table 4 RAP amplification procedure

[0096]

[0097] The nucleic acid of the positive samples was simultaneously subjected to qPCR: the reagent used in the qPCR method was Entrans qPCRProbe SetV2 (RK21211) of ABclonal; the conventional qPCR reaction system was prepared according to Table 5, and the primer pairs (qPCR-F and qPCR-R) and probes in Table 1 were used for qPCR amplification detection. The amplification procedures of qPCR for Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis are shown in Tables 6 to 10, respectively.

[0098] Table 5 shows the conventional qPCR reaction system.

[0099] Table 5 Conventional qPCR reaction system

[0100] qPCR amplification system Dosage (μL) Buffer 5 Nuclease-free water Make up to 20 μL Taq hot start enzyme 0.2 dNTP 0.25 <![CDATA[MgCl2]]> 1.2 qPCR-F (10 μM) 0.4 each qPCR-R (10 μM) 0.4 each qPCR-P (10 μM) 0.4 each DNA template 2

[0101] Tables 6, 7, 8, 9 and 10 are the qPCR amplification programs for Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis, respectively.

[0102] Table 6 CAqPCR amplification procedure

[0103]

[0104] Table 7CT qPCR amplification procedure

[0105]

[0106] Table 8CG qPCR amplification program

[0107]

[0108]

[0109] Table 9CK qPCR amplification program

[0110]

[0111] Table 10CP qPCR amplification program

[0112]

[0113] Example 2

[0114] A kit for multiplex one-system RAP combined with magnetic beads for enrichment and detection of Candida bloodstream infection, the kit comprising primer probe set 1 and primer probe set 2 (primer and probe information is shown in Table 1) for multiplex one-system RAP combined with magnetic beads for enrichment and detection of Candida bloodstream infection, a RAP kit reaction system (see Table 2 and Table 3), and the M1 magnetic beads prepared in Example 1.

[0115] The above-mentioned kit provided by the present invention was used to distinguish and identify 15 bloodstream infection-related pathogens with reference to the RAP method of Example 1. The identification results are shown in Table 11.

[0116] As can be seen from Table 11, the RAP method can distinguish and identify the listed strains, and no cross-reactions were observed.

[0117] Table 11 Multiple RAP specificity detection analysis results

[0118] serial number sample CA CT CG CK CP 1 Candida albicans Positive Negative Negative Negative Negative 2 Candida tropicalis Negative Positive Negative Negative Negative 3 Candida glabrata Negative Negative Positive Negative Negative 4 Candida krusei Negative Negative Negative Positive Negative 5 Candida parapsilosis Negative Negative Negative Negative Positive 6 Aspergillus Negative Negative Negative Negative Negative 7 Klebsiella pneumoniae Negative Negative Negative Negative Negative 8 Streptococcus pneumoniae Negative Negative Negative Negative Negative 9 Pseudomonas aeruginosa Negative Negative Negative Negative Negative 10 Escherichia coli Negative Negative Negative Negative Negative 11 Stenotrophomonas maltophilia Negative Negative Negative Negative Negative 12 Staphylococcus aureus Negative Negative Negative Negative Negative 13 Enterococcus faecalis Negative Negative Negative Negative Negative 14 Enterobacter cloacae Negative Negative Negative Negative Negative 15 Mycobacterium tuberculosis Negative Negative Negative Negative Negative

[0119] Example 3

[0120] The analytical sensitivity of the RAP method of the present invention was evaluated using serial 10-fold dilutions of the DNA clone plasmid.

[0121] Using pUC57 as an empty vector, the target gene sequences of CA, CT, CG, CK and CP with nucleotide sequences as shown in SEQ ID NO.16 to SEQ ID NO.20 (see Table 12) were cloned into pUC57, and the positive plasmid DNAs of CA, CT, CG, CK and CP containing the target genes were synthesized (the positive plasmid DNAs of CA, CT, CG, CK and CP were synthesized by Beijing Qingke Biological Co., Ltd.). The positive plasmids were diluted in a 10-fold continuous concentration gradient, with a concentration range of 10 0 ~10 5The positive plasmid DNA of different concentrations was used as template, and the conventional qPCR system was prepared according to Table 5. The multiplex one RAP system was configured according to Table 2 and Table 3, respectively. The conventional qPCR and RAP experiments were performed according to the method described in Example 1 to evaluate their sensitivity.

[0122] Table 12 Positive plasmid target gene sequences

[0123]

[0124]

[0125] Depend on Figure 2 to Figure 6 As shown in A, the sensitivity of multiple RAP for detecting CA, CT, CG, CK and CP is 10 0 , 10 0 , 10 0 , 10 0 and 10 0 Copy / React. By Figure 2 to Figure 6 As shown in Figure B, the sensitivity of qPCR for detecting CA, CT, CG, CK and CP is 10 2 , 10 1 , 10 1 , 10 1 and 10 1 Copies / reaction. It can be seen that the RAP detection method of the present invention is more sensitive than conventional qPCR.

[0126] Example 4

[0127] The simulated positive blood samples with high bacterial concentrations prepared in Example 1 (CA, CT and CG 20-1000 CFU / mL; CK and CP 50-900 CFU / mL) were directly used without M1 magnetic bead enrichment. The nucleic acid was extracted by using Microbiome DNA Isolation Kit, and then detected by the mRAP method described in Example 1. The detection results of CA, CT, CG, CK and CP are shown in Figure 2. Figure 7 As shown in A to E. Figure 7 This is the RAP detection limit analysis diagram before enrichment.

[0128] Figure 7 The results showed that when M1 magnetic beads were not used to enrich pathogens, the detection limits of multiple RAP for the five pathogens were between 20 and 100 CFU / mL, respectively. The detection limits were low and could not be used to detect blood samples with a bacterial count of <10 CFU / mL in patients with early bloodstream infection.

[0129] The method for preparing simulated positive blood samples with different bacterial concentrations in Example 1 was used to prepare simulated blood samples with low bacterial concentrations of CA, CT, CG, CK and CP (the final concentrations of CA were 1 CFU / mL, 2 CFU / mL, 4 CFU / mL, 5 CFU / mL and 7 CFU / mL; the final concentrations of CT were 1 CFU / mL, 2 CFU / mL, 5 CFU / mL, 6 CFU / mL and 8 CFU / mL; the final concentrations of CG were 1 CFU / mL, 5 CFU / mL, 6 CFU / mL, 8 CFU / mL and 9CFU / mL; the final concentration of CK was 1CFU / mL, 2CFU / mL, 3CFU / mL, 5CFU / mL and 8CFU / mL; the final concentration of CP was 1CFU / mL, 4CFU / mL, 5CFU / mL, 6CFU / mL and 9CFU / mL; the actual concentration of the sample was calculated by plating the simulated sample with PBS of equal concentration), the method described in Example 1 was used to enrich the low-concentration bacterial count simulated positive blood sample using M1 magnetic beads, and then nucleic acid was extracted, and then detected according to the mRAP method described in Example 1. The detection results of CA, CT, CG, CK and CP are shown as follows: Figure 8 As shown in A to E. Figure 8 This is the detection limit analysis diagram of RAP after enrichment.

[0130] Figure 8 The results showed that after using M1 magnetic beads to enrich pathogens, the detection limit of multiple RAP and the LOD of the five pathogens could all be detected to be <10CFU / mL. After enrichment of blood specimens, the detection of blood samples with a bacterial count of <10CFU / mL in patients with early bloodstream infection was successfully achieved, which is beneficial for the early diagnosis and treatment of patients with bacteremia.

[0131] Figure 7-8 The results of the minimum detection limits before and after multiple RAP enrichment showed that after adding M1 magnetic beads to enrich the pathogens, the detection limits of CA, CT, CG, CK and CP were significantly reduced, and M1 magnetic beads played an important role.

[0132] Figure 2 to Figure 8 The results show that the primer probe set provided by the present invention can quickly detect CA, CT, CG, CK and CP, and has higher sensitivity than ordinary qPCR, greatly shortened reaction time and good specificity.

[0133] Example 5

[0134] Another set of primers was designed using conventional methods, and the sequences are as follows:

[0135] CA-RAA-F2 primer sequence: TTGGGTTTGCTTGAAAGACGGTAGTGGTAA (SEQ ID NO. 23);

[0136] CA-RAA-R2 primer sequence: ATTGATATGCTTAAGTTCAGCGGGTAGTCC (SEQ ID NO. 24);

[0137] CT-RAA-F2 primer sequence: GTTGAGCAATACGCTAGGTTTGTTTGAAAG (SEQ ID NO. 25);

[0138] CT-RAA-R2 primer sequence: GCGGGTAGTCCTACCTGATTTGAGGTCAAA (SEQ ID NO. 26);

[0139] CG-RAA-F2 primer sequence: AAGCTTCTCTATTAATCTGCTGCTCGTTTG (SEQ ID NO. 27);

[0140] CG-RAA-R2 primer sequence: TCCTCCGCTTATTGATATGCTTAAGTTCAG (SEQ ID NO. 28);

[0141] CK-RAA-F2 primer sequence: TCAAATAAGCGGAGGAAAAGAAAACCAACAG (SEQ ID NO. 29);

[0142] CK-RAA-R2 primer sequence: CAGTATTTAGCCTTAGATGGAATTTACCAC (SEQ ID NO. 30);

[0143] CP-RAA-F2 primer sequence: TCTTAAGTTATTTCCATGCTGTTGATTTTG (SEQ ID NO. 31);

[0144] CP-RAA-R2 primer sequence: AACCACTAACTAAAGTAGTAACACCACCT (SEQ ID NO. 32).

[0145] The above primers were used to arrange and combine the two sets of primers respectively, and the corresponding probes in Table 1 were used to perform the RAP method of Example 1 of the present invention to amplify the nucleic acids of CA, CT, CG, CK and CP respectively, and the best primer pair was screened according to the CT value and fluorescence value of the amplification curve. The results are as follows: Fig. 9 shown.

[0146] Among them, one of the two sets of primers is the upstream primer F (denoted as F1) and the downstream primer R (denoted as R1) of CA, CT, CG, CK and CP in Table 1.

[0147] according to Fig. 9 It can be seen that although the primers are designed using conventional methods, the primers protected by the present invention have a higher amplification effect.

[0148] Example 6

[0149] The other conditions were the same as in Example 1, except for the primer concentration.

[0150] The primer concentration setting scheme is as follows:

[0151] In primer probe set 1, the final concentrations of RAA primers for CA, CT and CG were controlled at 100 nM, 150 nM, 200 nM and 250 nM, respectively, and other reaction conditions remained unchanged, and the primer concentrations were screened; in primer probe set 2, the final concentrations of RAA primers for CK and CP were controlled at 100 nM, 150 nM, 175 nM and 200 nM, respectively, and other reaction conditions remained unchanged, and the primer concentrations were screened.

[0152] according to Fig.10 It can be seen that the RAA primers of CA and CG have the best amplification effect when the final concentration is 200nM, with fewer cycles required for peak onset and higher fluorescence values, so 200nM is used; the RAA primers of CT have similar amplification effects when the final concentrations are 200nM and 250nM, so 200nM is selected; the primers of CK have the best amplification effect when the final concentration is 150nM, so 150nM is used; the primers of CP have the best amplification effect when the concentration is 200nM, so 200nM is used.

[0153] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer probe set for detecting Candida bloodstream infection, characterized in that: The primer probe group includes primer probe group 1 and / or primer probe group 2; the primer probe group 1 is one or more of a primer probe for detecting Candida albicans, a primer probe for detecting Candida tropicalis, and a primer probe for detecting Candida glabrata; The primer probe set 2 is one or both of a primer probe for detecting Candida krusei and a primer probe for detecting Candida parapsilosis; The primers and probes for detecting Candida albicans were: CA-RAA-F, CA-RAA-R, and CA-qPCR-P; The nucleotide sequences of CA-RAA-F, CA-RAA-R and CA-qPCR-P are shown in SEQ ID NO.1 to SEQ ID NO.3 respectively; The primers and probes for detecting Candida tropicalis were: CT-RAA-F, CT-RAA-R, and CT-qPCR-P; The nucleotide sequences of CT-RAA-F, CT-RAA-R and CT-qPCR-P are shown in SEQ ID NO.4 to SEQ ID NO.6 respectively; The primers and probes for detecting Candida glabrata were: CG-RAA-F, CG-RAA-R, and CG-qPCR-P; The nucleotide sequences of CG-RAA-F, CG-RAA-R and CG-qPCR-P are shown in SEQ ID NO.7 to SEQ ID NO.9 respectively; The primers and probes for detecting Candida krusei were: CK-RAA-F, CK-RAA-R, and CK-qPCR-P; The nucleotide sequences of CK-RAA-F, CK-RAA-R and CK-qPCR-P are shown in SEQ ID NO.10 to SEQ ID NO.12 respectively; The primers and probes for detecting Candida parapsilosis were: CP-RAA-F, CP-RAA-R, and CP-qPCR-P; The nucleotide sequences of the CP-RAA-F, CP-RAA-R and CP-qPCR-P are shown in SEQ ID NO.13 to SEQ ID NO.15, respectively.

2. The primer probe set according to claim 1, characterized in that: The CA-qPCR-P, CT-qPCR-P, CG-qPCR-P, CK-qPCR-P and CP-qPCR-P are respectively labeled with different fluorescent groups.

3. The primer probe set according to claim 2, characterized in that: The fluorescent group includes FAM, VIC, HEX, ROX, JOE, TET, CY3, CY5 or TAMRA.

4. The primer probe set according to claim 2 or 3, characterized in that: In primer probe set 1, the CA-qPCR-P is labeled with FAM; the CT-qPCR-P is labeled with CY5, and the CG-qPCR-P is labeled with HEX; In primer probe set 2, the CK-qPCR-P is labeled with FAM, and the CP-qPCR-P is labeled with VIC.

5. A kit for detecting Candida bloodstream infection, characterized in that: The kit comprises the primer-probe set according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit comprises M1 protein magnetic beads, a RAP kit reaction system and a qPCR reaction solution containing magnesium acetate.

7. The kit according to claim 5 or 6, characterized in that The final concentration of the primers for Candida albicans is 195-255 nM; the final concentration of the primers for Candida tropicalis is 190-250 nM; the final concentration of the primers for Candida glabrata is 190-230 nM; The final concentration of the Candida krusei primers was 95–155 nM; The final concentration of Candida albicans primers was 180-205 nM.

8. Use of the primer probe set according to any one of claims 1 to 4 in the preparation of a product for detecting Candida or Candida bloodstream infection, characterized in that: The Candida species include one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

9. Use of M1 protein magnetic beads and the primer probe set according to any one of claims 1 to 4 in the preparation of a product for detecting Candida or Candida bloodstream infection, characterized in that: The Candida species include one or more of Candida albicans, Candida tropicalis, Candida glabrata, Candida krusei and Candida parapsilosis.

10. A method for detecting Candida or Candida bloodstream infection based on the kit according to any one of claims 5 to 7, characterized in that: The method is used for non-diagnostic purposes and comprises the following steps: M1 protein magnetic beads are used to enrich pathogens in the blood, and pathogen nucleic acids are extracted. After the RAP kit reaction system and the qPCR reaction solution containing magnesium acetate are mixed, pathogen nucleic acids are added, and RAA amplification and qPCR amplification are performed using the primer probe set.

Images