Specific primers for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil and their application

Abstract

The present invention belongs to the technical field of detection of Fusarium oxysporum causing ginseng root rot, and specifically discloses a specific primer and its application for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil, including PCR specific primers and qPCR specific primers; among them, the PCR specific primers include: 12269-F: GACAGAGTTAGGACGACCTTGGACC; 12269-R: CCCTTGGCTCAGTCTTCCCACGGTC; the qPCR specific primers include: upstream primer P-F2: TGACGGGTTTGGTGATTC; downstream primer P-R2: CCAGGCATACTGTCATAGG. The specific primers designed by the present invention can rapidly and quantitatively detect Fusarium oxysporum causing ginseng root rot in soil, establish a standard equation based on the results of real-time quantitative PCR detection, and clarify the relationship between the amount of bacteria in the soil and the occurrence of root rot; it not only provides safe and reliable technical support for the early prevention, diagnosis, and monitoring of ginseng root rot, but also can ensure the safety of ginseng production, reduce economic losses, and promote the high-quality and sustainable development of the ginseng industry.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of Fusarium oxysporum causing ginseng root rot, in particular to a specific primer for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil and its application. Background Art

[0002] Ginseng root rot is a disease that seriously affects the yield and quality of ginseng. One of its main pathogenic bacteria is Fusarium oxysporum ( Fusarium oxysporum ).

[0003] Fusarium oxysporum is a facultative parasitic fungus with strong viability and can survive in soil for more than ten years. It belongs to the genus Fusarium in the Deuteromycotina subphylum. Its hyphae are slender, colorless and septate. Its macroconidia are colorless, sickle-shaped, slightly curved, with 3 - 5 septa; its microconidia are colorless, single-celled, elliptical to ovoid.

[0004] Fusarium oxysporum mainly infects the roots and rhizomes of ginseng, causing the ginseng roots to rot, showing a dark brown wet rot, and later becoming a rotten state, only leaving the hollow root bark. The above-ground parts of the affected ginseng seedlings show no obvious symptoms in the early stage, and the leaves turn chlorotic and yellow, wither and die in the middle and late stages. The root rot caused by this bacterium is severe under high temperature and high humidity conditions, especially in the high-temperature and rainy seasons of July and August.

[0005] The detection of Fusarium oxysporum causing ginseng root rot ( Fusarium oxysporum ) is crucial for the early diagnosis and effective control of the disease. However, the current methods for detecting Fusarium oxysporum causing ginseng root rot mainly rely on the gradient dilution separation method, which has limitations such as a long cycle and poor repeatability, and needs to be further established and improved. Based on this, accurately quantifying the root rot bacteria in the soil for ginseng cultivation in advance, evaluating its potential disease risk, establishing a stable, rapid and accurate detection system for Fusarium oxysporum of ginseng, and carrying out the detection of ginseng-suitable soil and ginseng-suitable seeds have very important guiding significance for taking precise and effective control measures in production. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention provides a specific primer for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil and its application.

[0007] To achieve the above object, the present invention is implemented according to the following technical scheme:

[0008] The first technical solution provided by the present invention is a specific primer for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil, including a PCR specific primer and a qPCR specific primer;

[0009] Among them, the PCR specific primer includes:

[0010] 12269 - F: GACAGAGTTAGGACGACCTTGGACC;

[0011] 12269 - R: CCCTTGGCTCAGTCTTCCCACGGTC;

[0012] The specific qPCR primers include:

[0013] Forward primer P - F2: TGACGGGTTTGGTGATTC;

[0014] Reverse primer P - R2: CCAGGCATACTGTCATAGG.

[0015] The second technical solution provided by the present invention is an application of specific primers in the real - time fluorescence quantitative detection of Fusarium oxysporum f. sp. ginseng in soil.

[0016] Compared with the prior art, the specific primers designed by the present invention can be used for rapid quantitative detection of Fusarium oxysporum f. sp. ginseng causing ginseng root rot in soil. A standard equation is established based on the results of real - time quantitative PCR detection to clarify the relationship between the amount of bacteria in the soil and the occurrence of root rot. It not only provides safe and reliable technical support for the early prevention, diagnosis and monitoring of ginseng root rot, but also can ensure the safety of ginseng production, reduce economic losses, and promote the high - quality sustainable development of the ginseng industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Comparison of the genomes of Fusarium oxysporum f. sp. ginseng and other special forms (Venn diagram).

[0018] Figure 2 Comparison of the genomes of Fusarium oxysporum f. sp. ginseng and other special forms (dot plot).

[0019] Figure 3 For Fusarium oxysporum Fusarium oxysporum PCR electrophoresis pattern of primers 12269 F / R.

[0020] Figure 4 Sensitivity amplification results of primers 12269 F / R for strain 0083.

[0021] Figure 5 For Fusarium oxysporum Fusarium oxysporum qPCR electrophoresis pattern of primers P - 2F / R.

[0022] Figure 6 For SYBR Green real - time fluorescence quantitative PCR detection of Fusarium oxysporum: A, amplification curve of Fusarium oxysporum; B, melting curve of Fusarium oxysporum; C, standard curve of Fusarium oxysporum.

[0023] Figure 7 is Fusarium oxysporum Fusarium oxysporum SYBR Green fluorescence quantitative PCR sensitivity detection.

[0024] Figure 8 is the amplification curve of the test strain sample detected by SYBR Green real-time fluorescence quantitative PCR primers p2-F / R.

[0025] Figure 9 is Fusarium oxysporum the symptom map of ginseng roots 6 days after inoculation.

[0026] Figure 10 is Fusarium oxysporum the symptom map of ginseng roots 8 days after inoculation.

[0027] Figure 11 is Fusarium oxysporum the symptom map of ginseng roots 9 days after inoculation.

[0028] Figure 12 is Fusarium oxysporum the symptom map of ginseng roots 16 days after inoculation.

[0029] Figure 13 is SYBR Green real-time fluorescence quantitative PCR detection Fusarium oxysporum the amplification curve and melting curve of ginseng root tissue DNA 6 days after inoculation, where A is the amplification curve of Fusarium oxysporum and B is the melting curve of Fusarium oxysporum.

[0030] Figure 14 is SYBR Green real-time fluorescence quantitative PCR detection Fusarium oxysporum the amplification curve and melting curve of ginseng root tissue DNA 8 days after inoculation, where A is the amplification curve of Fusarium oxysporum and B is the melting curve of Fusarium oxysporum.

[0031] Figure 15 is SYBR Green real-time fluorescence quantitative PCR detection Fusarium oxysporum the amplification curve and melting curve of ginseng root tissue DNA 9 days after inoculation, where A is the amplification curve of Fusarium oxysporum and B is the melting curve of Fusarium oxysporum.

[0032] Figure 16 is SYBR Green real-time fluorescence quantitative PCR detection Fusarium oxysporum the amplification curve and melting curve of ginseng root tissue DNA 16 days after inoculation, where A is the amplification curve of Fusarium oxysporum and B is the melting curve of Fusarium oxysporum. Specific implementation method

[0033] To make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0034] The Fusarium oxysporum Fusarium oxysporum used in the following examples, FO-0083, was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on February 21, 2025. The deposit number is CGMCC No. 41815, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0035] Example 1: Design method of specific primers for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil

[0036] 1. Preparation of culture media

[0037] Preparation of PDA medium: Weigh 200 g of potatoes, wash and peel them. Add distilled water to the pot and heat it to boiling on an induction cooker. After the potatoes are cooked, filter out the residue, make up to 1000 mL with distilled water, add 18 g of agar powder and 20 g of glucose, continue to heat and boil on the induction cooker, stir evenly to quickly melt the agar powder, dispense the prepared medium into Erlenmeyer flasks, and perform autoclaving at 121 °C for 30 min to make the PDA medium for standby.

[0038] Preparation of LB medium: Weigh 950 mL of distilled water, add 10 g of tryptone and 5 g of yeast extract, and stir evenly to dissolve the tryptone and yeast extract in water. Adjust the pH to 7.0 with (5 mol / L) NaOH, make up to 1000 mL with ddH2O, dispense into Erlenmeyer flasks respectively, and sterilize at high temperature to make the liquid LB medium for standby.

[0039] 2. DNA extraction

[0040] Extraction of fungal DNA: Transfer the purified test strain into a Petri dish containing PDA medium, culture at 25 °C. When the mycelium grows to 2 / 3 of the whole Petri dish, scrape the mycelium with a sterilized spatula, and scrape an appropriate amount of mycelium into a sterilized mortar with liquid nitrogen, quickly grind it into powder, and use a kit to extract fungal DNA.

[0041] Extraction of ginseng tissue DNA: Rinse the soil on the ginseng sample to be detected, dry the residual moisture with absorbent paper, take 100 mg of fresh plant tissue, grind it thoroughly in a mortar containing liquid nitrogen and quartz sand, extract DNA with a kit, and purify and recover the extracted DNA.

[0042] Extraction of soil DNA: Weigh 0.25 g of soil into a 2 mL centrifuge tube, and extract DNA according to the soil genomic DNA extraction kit.

[0043] The DNA concentrations of the above-extracted DNA were all measured using NanoDrop2000c. After passing the test, they were stored at -20 °C for later use.

[0044] 3. Comparison of the genomes of Fusarium oxysporum f. sp. ginseng and other special forms

[0045] First, comparative genomics analysis was carried out, and the results are as Figure 1 and Figure 2 shown. From Figure 1 and Figure 2 it can be seen that compared with other special forms, Fusarium oxysporum f. sp. ginseng has 213 specific gene clusters. By searching the genomic information, there are a total of 505 genes inside, among which 260 are found in 0083 and 245 are found in 0414.

[0046] These genes were analyzed by Blastn in NCBI, and 105 genes with low identity were found. Specific primers were designed based on these genes and screened.

[0047] 4. Test strains

[0048] The test strains shown in Table 1 were cultured in potato dextrose agar medium (PDA) at 25 °C for 5 - 7 d. Then, the mycelium was gently scraped with a sterilized spatula, and an appropriate amount of mycelium was taken into a sterilized mortar, and quickly ground into powder with liquid nitrogen. DNA was extracted using the fungal genomic DNA extraction kit.

[0049] Table 1 Information of test strains

[0050]

[0051] 5. Conventional PCR amplification of Fusarium oxysporum and other pathogenic bacteria strains

[0052] Using the selected Fusarium strains as the amplification template, the DNA of pathogenic bacteria strains was amplified by conventional PCR using the designed primers. The PCR electrophoresis pattern of Fusarium oxysporum Fusarium oxysporum primer 12269 F / R is as Figure 3As shown in the figure. Fusarium oxysporum and Fusarium oxysporum f. sp. ginseng strains from different regions, other Fusarium strains of the same genus but different species of ginseng root rot, and pathogenic bacteria of other genera were selected to determine the specificity of PCR primers. The specificity of the primers was verified with ddH2O as a control. Then, by optimizing the primer concentration and annealing temperature, the reaction system of conventional PCR was determined. Finally, a pair of primers was selected as its specific primers, and the selected PCR specific primers are shown in Table 2.

[0053] Table 2 Screening of PCR Specific Primers for Fusarium oxysporum

[0054]

[0055] 6. Sensitivity Determination

[0056] Use ddH2O to Fusarium oxysporum and Fusarium oxysporum f. sp. ginseng The DNA templates of the target strains were diluted from 100 ng·μL -1 to 1 fg·μL -1 in a 10-fold gradient and used as templates for conventional PCR amplification. The lowest detection limit was determined by taking the weakest band that could be observed, and the sensitivity of the conventional PCR primers was detected. The amplification results of primer 12269 F / R for strain 0083 are as Figure 4 shown.

[0057] From the gel electrophoresis Figure 4 it can be seen that the sensitivity of primer 12269 F / R for strain 0083 is 1 ng·μL -1 .

[0058] 7. Construction of Standard Positive Plasmid

[0059] (1) Using Fusarium oxysporum f. sp. ginseng strain 0083 as the amplification template, perform PCR amplification with the conventional PCR specific primers 12269F / R;

[0060] (2) Use a DNA recovery kit to perform gel extraction and recovery of the PCR products;

[0061] (3) After ligating the recovered fragment with the vector pMD18-T vector, transfer it into DH5α competent cells, mix well, and let it stand on ice for 30 min;

[0062] (4) Heat in a 42°C water bath for 45 s, take it out, and quickly transfer it to ice and let it stand for 2 min;

[0063] (5) Add 1 mL of LB liquid medium to the centrifuge tube, place the floating device, and culture it in a shaker at 37 °C and 150 r. After taking it out, centrifuge at 4000 r for 5 min;

[0064] (6) In the workbench, aspirate the supernatant, leave 100 - 200 μL of liquid to mix with the precipitate, and evenly coat it on the LA culture dish with Amp added;

[0065] (7) Send it to an incubator at 37 °C for inverted culture;

[0066] (8) Screen monoclonal colonies, extract the plasmid using a plasmid mini - kit, and send the obtained recombinant plasmid to Sangon for sequencing.

[0067] 8. qPCR Amplification of Fusarium oxysporum

[0068] Based on the primer design principle, use the same gene fragment as the specific primer for conventional PCR obtained by screening, and design specific primers according to this gene using Primer Premier 5.0. Using the selected Fusarium strains and Fusarium oxysporum f. sp. ginseng strains as amplification templates, the designed specific primer pairs are used for real - time qPCR amplification of the pathogen strain DNA, Fusarium oxysporum Fusarium oxysporum The qPCR electrophoresis diagram of primer P - 2F / R is as Figure 5 shown, and SYBR Green real - time fluorescence quantitative PCR detection of Fusarium oxysporum is as Figure 6 shown, Figure 6 where: A. Amplification curve of Fusarium oxysporum; B. Melting curve of Fusarium oxysporum; C. Standard curve of Fusarium oxysporum. By optimizing the primer concentration and annealing temperature, optimize the reaction system of qPCR, and finally screen out a pair of primers as its specific primers. The screened qPCR specific primers are shown in Table 3.

[0069] Table 3 Screening of qPCR Specific Primers for Fusarium oxysporum

[0070]

[0071] 9. Fusarium oxysporum Establishment of qPCR Standard Curve

[0072] Dilute the recombinant positive plasmid standard with ddH2O to 8 concentrations of 9.79×10 6 ~ 9.79×10 2 copies / μL, and use them as templates for amplification. Taking the Ct value as the ordinate and the logarithm of the standard plasmid copy number as the abscissa, establish and synthesize the standard curve using Origin software. The result is as shown in C in 6.

[0073] 10. Primer P-2 F / R qPCR sensitivity verification

[0074] 9.79×10 6 ~ 9.79×10 -1 copies / μL 8 gradients Fusarium oxysporum The recombinant positive standard plasmid was used as a template for fluorescence quantitative PCR amplification, and the minimum detection limit was set as its amplification curve was smooth and repeatable. Fusarium oxysporum The sensitivity of fluorescent quantitative PCR primers, the results are as follows Figure 7 shown.

[0075] Depend on Figure 7 It can be seen that 9.79×10 6 ~ 9.79×10 -1 copies / μL 8 gradients Fusarium oxysporum The recombinant positive standard plasmid was used as a template for fluorescence quantitative PCR amplification. The results showed that the established fluorescence quantitative PCR could detect a minimum of 9.79×10 -1 copies / μL of standard DNA.

[0076] 11. Specificity verification of primer P-2 F / R qPCR

[0077] Using the DNA of the pathogen as a template, replacing the conventional primers with specific primers and using ddH2O as a negative control, qPCR amplification was performed to obtain the amplification curve as shown below. Figure 8 As shown. Figure 8 It can be seen that the designed specific primers are specific to Fusarium oxysporum.

[0078] 12. Monitor the dynamic changes of infection

[0079] Preparation of spore suspension: Fusarium oxysporum Transfer to PDA plate, and when mycelium grows to 2 / 3 of the culture dish, remove the stem and put it into liquid CMC, culture at 25℃ for 7 days, filter and count with a hemocytometer, and dilute to 10% by concentration gradient. 6 、 10 5 , 10 4 , 10 3 , 10 2 , 10 1 and 10 0 spores / mL spore suspension.

[0080] Indoor inoculation: Pick fresh and healthy ginseng roots, wash them, disinfect the surface with 75% alcohol twice, rinse with sterile water several times and blow dry on a sterile operating table. Spray 1000 μL and dilute to 10% by gradient. 6 、 10 5 , 10 4 , 10 3 , 10 2 , 10 1 and 10 0 A spore suspension of 100 spores / mL was incubated on each inoculated ginseng root at 25°C. After inoculation, the disease status of the ginseng was observed and recorded daily, and samples were taken until the ginseng samples remained disease-free.

[0081] After 6 days of inoculation, the concentration of spore suspension was 10 6 When the disease begins, collect ginseng samples diluted at various concentrations ( Figure 9 ). The same method was used to observe the concentration of spore suspension collected 8 days after inoculation. 5 Onset of disease ( Figure 10 ), the concentration of spore suspension was 10 after 9 days of inoculation. 4 Onset of disease ( Figure 11 ) and the concentration of spore suspension was 10 3 Onset of disease ( Figure 12 ) were diluted with various concentrations of ginseng samples. The spore suspension remaining on the surface of the ginseng root was rinsed with ddH2O. The diseased part of the ginseng was taken, quickly frozen in liquid nitrogen, ground, and DNA was extracted from the ginseng tissue using a kit. qPCR detection was performed after sampling at different concentrations and at different time points ( Figure 13 — Figure 16 ), and analyze the dynamic changes of latent infection amount of pathogens in spore suspensions of different concentrations.

[0082] In summary, the two molecular rapid detection systems of conventional PCR and fluorescent quantitative PCR established in the present invention, as well as the rapid quantitative detection of Fusarium oxysporum that causes root rot in the soil, clarify the relationship between the amount of soil bacteria and the occurrence of root rot, and carry out the detection of ginseng-friendly soil and ginseng seeds, not only provide safe and reliable technical support for the early prevention, diagnosis and monitoring of ginseng root rot, but also can ensure the safety of ginseng production, reduce economic losses, and promote the high-quality and sustainable development of the ginseng industry.

[0083] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A specific primer for real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil, characterized in that, It includes specific primers for PCR and specific primers for qPCR; Among them, the specific primers for PCR are: 12269-F: GACAGAGTTAGGACGACCTTGGACC; 12269-R: CCCTTGGCTCAGTCTTCCCACGGTC; The specific primers for qPCR are: Forward primer P-F2: TGACGGGTTTGGTGATTC; Reverse primer P-R2: CCAGGCATACTGTCATAGG.

2. Use of the specific primer as described in claim 1 in real-time fluorescence quantitative detection of Fusarium oxysporum causing ginseng root rot in soil.

Images