Method for constructing fertility disorder animal model and application

Abstract

The invention discloses a method for constructing a fertility disorder animal model and application, the animal is female, and the method comprises the following steps: terminating expression of DLGAP5 protein of the animal at 359th amino acid to obtain the fertility disorder animal model. It is found that the function of a Dlgap5 gene in a female animal body is related to the female fertility, early expression termination of DLGAP5 protein in the female animal body at a specific site can affect the fertility of the female animal, and specifically, after expression termination of 359th amino acid of the DLGAP5 protein, infertility of the female animal can be caused.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology. Specifically, it relates to a method for constructing an animal model with reproductive disorders and its applications. Background Art

[0002] Assisted reproductive technology is short for human assisted reproductive technology (ART), which refers to the technology that uses medical assistance to enable infertile couples to become pregnant. It includes two major categories: artificial insemination (AI) and in vitro fertilization-embryo transfer (IVF-ET) and its derivative technologies. In vitro fertilization-embryo transfer and its derivative technologies mainly include in vitro fertilization-embryo transfer (IVF-ET), gamete or zygote intrafallopian transfer (GIFT or ZIFT), intracytoplasmic sperm injection (ICSI), embryo cryopreservation / thawing (CET / FET), preimplantation genetic diagnosis (PGD), etc.

[0003] Currently, the success rate of IVF / ICSI technology is only 30-40%, and there are quite a number of cases of repeated failures. Understanding the key events of oocyte meiotic maturation, fertilization, and early embryo development, and studying the mechanism of the transformation of oocytes into embryos are the keys to improving the success rate of assisted reproductive technology. Maternal effect genes (MEGs) refer to a class of genes that are expressed during egg development, and their expression products (mRNA or proteins) are stored in oocytes and encode signal molecules (transcription factors, receptors, or translational regulatory proteins) that guide embryo development. Research has shown that the disruption of MEGs in mammals can lead to embryonic defects.

[0004] In recent years, due to the decline in the cost of whole exome sequencing technology and the increasing maturity of analysis levels, combined with the development of assisted reproductive technology, the relationships between mutations in 33 MEGs, including TLE6, and female infertility have been successively elucidated. However, the functions of these genes and the roles played by their specific loci are not yet fully understood.

[0005] Therefore, how to better understand the functions of specific genes and the roles played by their specific loci is a difficult point in the study of female infertility. Summary of the Invention

[0006] In order to solve the above problems and better study the influence of specific gene loci on embryo development, the first object of this application is to provide a method for constructing an animal model with reproductive disorders. The animal is female, and the method includes: terminating the expression of the DLGAP5 protein in the animal at the 359th amino acid to obtain an animal model with reproductive disorders.

[0007] This application found the correlation between the function of the Dlgap5 gene in female animals and female fertility, that is, the premature termination of DLGAP5 protein expression in female animals will affect female fertility. Specifically, the infertility of female animals can be caused after the termination of expression of the 359th amino acid of the DLGAP5 protein.

[0008] In one embodiment, the DLGAP5 protein of the animal is terminated at the 359th amino acid by mutating the Dlgap5 gene, and the mutation of the Dlgap5 gene satisfies the following conditions (1)-(3):

[0009] (1) A nonsense mutation occurs at nucleotides 1075-1077 of the Dlgap5 gene;

[0010] (2) A synonymous mutation occurs at nucleotides 1099-1101 of the Dlgap5 gene;

[0011] (3) The mutation of the Dlgap5 gene is generated by CRISPR / Cas9 gene knock-in;

[0012] Optionally, nucleotides 1075-1077 of the Dlgap5 gene are mutated from AAT to TAG;

[0013] Optionally, nucleotides 1099-1101 of the Dlgap5 gene are mutated from TTG to CTC.

[0014] In one embodiment, the generation of the Dlgap5 gene mutation by CRISPR / Cas gene knock-in includes:

[0015] Injecting a Dlgap5 gene-specific target sgRNA, a Cas protein, and a donor DNA into a fertilized animal egg, culturing the fertilized animal egg, and obtaining an animal with a Dlgap5 gene knock-in;

[0016] Among them, the donor DNA contains a Dlgap5 gene fragment, and the Dlgap5 gene fragment contains a mutant sequence of the Dlgap5 gene.

[0017] In one embodiment, the method satisfies the following conditions (1)-(3):

[0018] (1) The sgRNA includes the sequence shown in SEQ ID No.1;

[0019] SEQ ID No.1: AGACAAAGCAAATGAAATCTTGG;

[0020] (2) The Cas protein is Cas9 protein;

[0021] (3) The donor DNA includes the sequence shown in SEQ ID No. 2;

[0022] SEQ ID No. 2:

[0023] TGTGAAATTTGTTTGTTTGTTTGTTTGTTTTTCCTGTTAGTTTTAGCACT ACAACTCAAGACAAAGCATAGGAAATCTTGGTACAGCAAGGACTCGAGTC GCTAACAGACCGTAGTAAAGGTACGTTAGTTTAATTAAGCTGTCACTTCT.

[0024] In one embodiment, cultivating animal fertilized eggs to obtain animals with Dlgap5 gene knock-in includes:

[0025] Cultivating animal fertilized eggs to obtain F0 generation animals;

[0026] Mating F0 generation animals with wild-type animals to obtain F1 generation heterozygous animals;

[0027] Hybridizing F1 generation heterozygous animals to obtain F2 generation animals, thereby obtaining animals with Dlgap5 gene knock-in.

[0028] In one embodiment, screening F0 generation animals or F2 generation animals to obtain homozygous animals with Dlgap5 gene knock-in;

[0029] Optionally, the screening steps include:

[0030] Extracting the DNA of the animal for PCR amplification, and sequencing the PCR amplification product to determine whether the Dlgap5 genotype of the animal is homozygous.

[0031] In one embodiment, the screening steps meet the following conditions (1) to (2):

[0032] (1) The primers used for PCR amplification include the sequences shown in SEQ ID No. 3 and SEQ ID No. 4;

[0033] SEQ ID No. 3: TATGACAGAAGCAACTCTGTGTGT;

[0034] SEQ ID No. 4: ACGTCTCCTCTGTTAGGGTTGTTA;

[0035] (2) The sequencing is Sanger sequencing;

[0036] Optionally, the primers for Sanger sequencing include the sequence shown in SEQ ID No. 5;

[0037] SEQ ID No.5: TATGACAGAAGCAACTCTGTGTGT。

[0038] In one embodiment, the animal includes at least one of mouse, rat, cattle, horse, pig, sheep, goat, dog, cat, rabbit, camel, donkey, deer, and mink.

[0039] The second object of this application is to provide the application of the animal model constructed by the above method in the preparation or screening of therapeutic drugs for diseases related to Dlgap5 gene deficiency.

[0040] In one embodiment, the diseases related to Dlgap5 gene deficiency include female fertility disorders. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0042] Figure 1 It is a schematic structural diagram of the mouse Dlgap5 gene in Example 1 of this application;

[0043] Figure 2 It is a schematic diagram of the construction strategy of the specific target gRNA of the mouse Dlgap5 gene in Example 1 of this application;

[0044] Figure 3 It is the detection result of the gel electrophoresis of the PCR amplification product of the mouse Dlgap5 gene in Example 1 of this application; Figure 3 In it, maker and M refer to prestained protein, WT refers to wild-type mice, 21 - 31 refer to each F1 generation mouse, and Water refers to the blank control;

[0045] Figure 4 It is the comparison result of Sanger sequencing of wild-type mice (WT), heterozygous mice (KI / +), and homozygous mice (KI / KI) in Example 1 of this application;

[0046] Figure 5 It is the statistical result of the litter size of wild-type mice, heterozygous mice, and homozygous mice in Example 2 of this application. DETAILED DESCRIPTION OF THE INVENTION

[0047] Reference will now be made in detail to the embodiments of the present application, one or more examples of which are described below. Each example is provided by way of explanation and not limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present application without departing from the scope or spirit of the present application. For example, features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0048] Accordingly, it is intended that the present application cover such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features, and aspects of the present application are disclosed in or are obvious from the following detailed description. Those of ordinary skill in the art should understand that this discussion is only a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0049] Unless otherwise specified or there is a contradiction, the terms or phrases used herein have the following meanings:

[0050] As used herein, the selection range of the terms "and / or", "or / and", "and / or" includes any one of two or more related listed items, and also includes any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctive combinations selected from "and / or", "or / and", "and / or", it should be understood that in the present application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and also undoubtedly includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B.

[0051] As used herein, "a plurality of", "a variety of", etc., unless otherwise specified, refer to a quantity greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0052] In this document, "further", "even further", "especially", etc. are used for descriptive purposes and indicate differences in content, but should not be construed as limiting the scope of protection of the present invention.

[0053] The term "primer" refers to an oligonucleotide, whether it exists naturally in a purified restriction digest or is synthetically produced. When placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducer such as DNA polymerase and at a suitable temperature and pH), the oligonucleotide can function as a starting point for synthesis. The primer is preferably single-stranded for maximum efficiency in amplification, but optionally can also be double-stranded. If it is double-stranded, the primer is first treated to separate its strands before being used to prepare the extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to initiate the synthesis of the extension product in the presence of an inducer. The exact length of the primer will depend on many factors, including temperature, primer source, and method of use. For example, in some embodiments, the primer ranges from 10 - 100 or more nucleotides (e.g., 10 - 300, 15 - 250, 15 - 200, 15 - 150, 15 - 100, 15 - 90, 20 - 80, 20 - 70, 20 - 60, 20 - 50 nucleotides, etc.).

[0054] The mouse Dlgap5 gene is located on chromosome 14 and is 2881 bp in length. It encodes the DLGAP5 protein, which is 846 amino acid residues long. DLGAP5 is also known as hepatoma up-regulated protein (HURP) and encodes a microtubule-associated protein that regulates the cell cycle. This protein is highly expressed in the M phase of mitosis, and its expression level varies cyclically within the cell cycle. It has a weak cytoplasmic localization during interphase, accumulates in the nucleus shortly before the start of mitosis, and localizes to the centromeric microtubules near the chromosomes during mitosis, participating in the regulation of the stability of the mitotic centromeric fibers. This protein is highly expressed in multiple tissues and organs, including plasma, infant liver, testis, ovary, etc.

[0055] Currently, a Dlgap5 gene knockout mouse model has been constructed, and it has been found that homozygous female mice are infertile. There has been no reported animal model of Dlgap5 gene knock-in constructed using SNP sites reported in humans for research related to female infertility.

[0056] To solve the above technical problems, the first aspect of the present application provides a method for constructing an animal model of reproductive disorder. The animal is female, and the method includes: terminating the expression of the DLGAP5 protein in the animal at the 359th amino acid to obtain an animal model of reproductive disorder. Specifically, terminating the expression of the DLGAP5 protein in the animal at the 359th amino acid means that the DLGAP5 protein expressed by the animal has an amino acid mutation p.N359*.

[0057] In the present application, the term "animal" refers to an animal in which the expression of the DLGAP5 protein with the amino acid mutation p.N359* can lead to female infertility. Specifically, it can be a mammal, such as a mouse, rat, bovine, horse, pig, sheep, goat, dog, cat, rabbit, camel, donkey, deer, mink. More specifically, it can be a rodent, such as (but not limited to): rat, mouse.

[0058] In the present application, the term "fertility disorder animal" or "fertility disorder animal model" refers to an animal with female infertility.

[0059] It is found in the present application that the function of the Dlgap5 gene in female animals is correlated with female fertility, and the premature termination of the expression of the DLGAP5 protein at a specific site in female animals will affect female fertility. Specifically, the infertility of female animals can be caused after the termination of the expression of the 359th amino acid of the DLGAP5 protein.

[0060] In some embodiments, the present application constructs the above-mentioned fertility disorder animal model by introducing a nonsense mutation into the nucleotide sequence encoding the 359th amino acid of the Dlgap5 gene, so that the animal expresses a truncated DLGAP5 protein. It is found in the present application that the nonsense mutation at a specific site of the Dlgap5 gene will lead to female infertility.

[0061] In some specific embodiments, the 1075-1077th nucleotides of the Dlgap5 gene have a nonsense mutation, so that the DLGAP5 protein expressed by the animal is prematurely terminated at the 359th amino acid. Among them, the nonsense mutation is a mutation that introduces a stop codon at the mutation site by nucleotide substitution. The three possible stop codons in the DNA sequence are TAG, TAA, and TGA. For example, for the full-length sequence of the Dlgap5 gene, the 1075-1077th nucleotides of the Dlgap5 gene can be mutated from AAT to TAG.

[0062] In some specific embodiments, the nonsense mutation of the Dlgap5 gene can be generated by inserting or deleting nucleotides in the nucleotide sequence of the Dlgap5 gene.

[0063] In some specific embodiments, the mutation of the Dlgap5 gene is generated by CRISPR / Cas gene knock-in.

[0064] Specifically, the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR / Cas) technology is based on the modification of the immune systems in bacteria and archaea, and consists of an R-S structure composed of multiple regularly short palindromic repeats and non-repetitive spacer sequences, and a gene operon encoding the Cas nuclease. Through the guide RNA (sgRNA)-mediated endonuclease Cas protein, the target DNA sequence is recognized and the DNA double-strand break is caused, promoting the repair of damaged DNA by homologous recombination or non-homologous end joining, thereby achieving site-directed gene knock-in at the target site. This method has the characteristics of high specificity, simple molecular construction, and short process.

[0065] In some embodiments, to prevent the binding and re-cutting of the gRNA to the sequence after homologous directed repair, the 1099-1101 nucleotides of the full-length Dlgap5 gene also have a synonymous mutation; for example, the 1099-1101 nucleotides of the Dlgap5 gene are mutated from TTG to CTC.

[0066] Synonymous mutation: A base substitution that does not cause an amino acid change is called a synonymous mutation, also known as a neutral mutation or a silent mutation. The reason for synonymous mutation is that the point mutation occurs in the third nucleotide of the codon. Due to the degeneracy of the genetic code, this mutated codon happens to encode the same amino acid as the codon before mutation, and the mutation does not change the amino acid sequence in the protein.

[0067] In some embodiments, the mutation of the Dlgap5 gene generated by CRISPR / Cas gene knock-in includes:

[0068] Injecting the Dlgap5 gene-specific target sgRNA, Cas protein, and donor DNA into the fertilized eggs of animals, culturing the fertilized eggs of animals, and obtaining animals with the Dlgap5 gene knocked in;

[0069] Among them, the donor DNA contains a Dlgap5 gene fragment, and the Dlgap5 gene fragment contains the above-mentioned mutation of the Dlgap5 gene.

[0070] Specifically, two key factors are required for gene mutation using the CRISPR / Cas technology. One is an effective sgRNA guiding sequence, and the other is the presence of the Cas protein.

[0071] In some specific embodiments, the sgRNA includes the sequence shown in SEQ ID No.1;

[0072] SEQ ID No.1: AGACAAAGCAAATGAAATCTTGG;

[0073] In some specific embodiments, the Cas protein is Cas9 protein, which has the ability to specifically recognize and cleave DNA sequences.

[0074] In this application, the donor DNA is a DNA template highly homologous to the Dlgap5 gene used in the process of gene knock-in using the CRISPR / Cas9 technology. The principle is that under the guidance of sgRNA, the Cas9 endonuclease specifically cleaves the DNA double strand to generate a DNA nick, and then the organism activates the homologous recombination repair pathway. When there is a highly homologous DNA template, that is, the donor DNA, it will be used as a repair template for repair, so as to achieve the purpose of introducing the target mutation into the genome at a specific site.

[0075] In some specific embodiments, in order to introduce the target mutation into the genome at a specific site, the donor DNA includes the sequence shown in SEQ ID No. 2;

[0076] SEQ ID No. 2:

[0077] TGTGAAATTTGTTTGTTTGTTTGTTTGTTTTTCCTGTTAGTTTTAGCACTACAACTCAAGACAAAGCA TAG GAAATCTTGGTACAGCAAGGA CTC GAGTCGCTAACAGACCGTAGTAAAGGTACGTTAGTTTAATTAAGCTGTCACTTCT.

[0078] Among them, the underlined TAG sequence is a nonsense mutation, and the underlined CTC sequence is a synonymous mutation.

[0079] Furthermore, in order to obtain a fertility disorder animal model, the steps of cultivating animal fertilized eggs to obtain animals with Dlgap5 gene knock-in include:

[0080] Cultivating animal fertilized eggs to obtain F0 generation animals;

[0081] Mating the F0 generation animals with wild-type animals to obtain F1 generation heterozygous animals;

[0082] Hybridizing the F1 generation heterozygous animals to obtain F2 generation animals, and obtaining animals with Dlgap5 gene knock-in.

[0083] Specifically, the wild-type animal refers to an animal of the same species as the F0 generation animal but without gene mutations.

[0084] In some embodiments, the F0 generation animals or F2 generation animals are screened to obtain homozygous animals with Dlgap5 gene knock-in.

[0085] In some embodiments, the screening step includes:

[0086] Extracting the DNA of the animal for PCR amplification, and sequencing the PCR amplification product to determine whether the Dlgap5 genotype of the animal is homozygous.

[0087] Specifically, in PCR, DNA denatures into single strands at a high temperature of 95°C in vitro, and primers bind to the single strands according to the principle of base complementary pairing at a low temperature (usually around 60°C). Then, the temperature is adjusted to the optimal reaction temperature of DNA polymerase (around 72°C), and DNA polymerase synthesizes complementary strands along the direction from phosphate to pentose sugar (5'-3'). Therefore, by controlling the denaturation and renaturation of DNA through temperature changes, adding designed primers, DNA polymerase, and dNTP, the in vitro replication of specific genes can be completed.

[0088] In some specific embodiments, the primers used for PCR amplification include the sequences shown in SEQ ID No.3 and SEQ ID No.4;

[0089] SEQ ID No.3: TATGACAGAAGCAACTCTGTGTGT;

[0090] SEQ ID No.4: ACGTCTCCTCTGTTAGGGTTGTTA;

[0091] In some specific embodiments, the sequencing is Sanger sequencing. Among them, Sanger sequencing starts from a fixed point of nucleotides, randomly terminates at a specific base, and fluorescently labels each base, generating a series of nucleotides of different lengths ending with A, T, C, and G. Then, it is detected by electrophoresis on a urea-denatured PAGE gel, so as to obtain a visible DNA base sequence. Sanger sequencing only needs to design a 5'-end primer, which binds to the 5'-end of one of the single strands after the template DNA double strand is unwound, ensuring that the sequence can extend from the 5'-end to the 3'-end of the specific template single strand.

[0092] Specifically, the primer for Sanger sequencing includes the sequence shown in SEQ ID No.5;

[0093] SEQ ID No.5: TATGACAGAAGCAACTCTGTGTGT.

[0094] The second aspect of the present application provides the use of the animal model constructed by the above method in the preparation or screening of therapeutic drugs for diseases related to Dlgap5 gene deficiency. The animal model of the present application can help study the potential therapeutic targets of Dlgap5 gene-related diseases and plays an important role in studying the pathogenic mechanism and drug screening of Dlgap5 gene-related diseases.

[0095] In some embodiments, the diseases related to Dlgap5 gene deficiency include female fertility disorders, and more specifically, it can be female infertility. Specifically, the present application discovers that the nonsense mutation at a specific locus of the Dlgap5 gene is correlated with female infertility. Therefore, the animal model of the present application plays an important role in studying the pathogenic mechanism and drug screening of female infertility.

[0096] The embodiments of the present application will be described in detail below in conjunction with examples, but the present application is not limited to these examples. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0097] Example 1

[0098] 1. Construction of an animal model of fertility disorder

[0099] This example provides a method for constructing an animal model of fertility disorder based on the CRISPR / Cas9 gene knock-in technology, including the following steps:

[0100] (1) Vector design and construction & in vitro transcription: Refer to the gene sequence and genomic region of the mouse Dlgap5 gene (the following Figure 1 shown gene is oriented from left to right, with a total size of 30.629 kb) to design the sequences of sgRNA and donor DNA.

[0101] The mouse Dlgap5 gene (GenBank transcript number: NM_144553.2; Ensembl: ENSMUSG00000037544) is located on mouse chromosome 14. This gene has a total of 19 exons, where the ATG start codon is located in exon 2 and the TGA stop codon is located in exon 19. N359* is located in exon 9, and exon 9 is selected as the target cleavage site.

[0102] The sgRNA construction strategy is as Figure 2 shown. Among them, the sgRNA primer sequences used are as follows:

[0103] AGACAAAGCAAATGAAATCTTGG;

[0104] The donor DNA sequence is as follows:

[0105] TGTGAAATTTGTTTGTTTGTTTGTTTGTTTTTCCTGTTAGTTTTAGCACTACAACTCAAGACAAAGCA TAG GAAATCTTGGTACAGCAAGGA CTC GAGTCGCTAACAGACCGTAGTAAAGGTACGTTAGTTTAATTAAGCTGTCACTTCT。

[0106] Among them, the underlined TAG sequence is a nonsense mutation, and the underlined CTC sequence is a synonymous mutation.

[0107] The p.N359*(AAT to TAG) mutation site will be introduced into exon 9 by homology-directed repair. The synonymous mutation p.L367=(TTG to CTC) will also be introduced to prevent the binding and re-cutting of the gRNA to the sequence after homology-directed repair. After the design is completed, the Donor Oligo is further synthesized, the sgRNA vector is constructed, and the required sgRNA and Cas9 are obtained by in vitro transcription.

[0108] (2) Microinjection: The specific target sgRNA obtained in the first step above, the donor DNA containing the p.N359*(AAT to TAG) mutation and the synonymous mutation (p.L367=(TTG to CTC)), and Cas9 are microinjected together into the mouse fertilized eggs. The fertilized eggs after microinjection are transplanted into the uterus of surrogate mother mice, and the mice born are F0 generation mice; 10 days after the F0 generation mice are born, their tails are cut to extract DNA for PCR and sequencing identification to obtain positive F0 mice, and the corresponding amino acid of their Dlgap5 gene [p.N359*(AAT to TAG)] is changed.

[0109] (3) Reproduction and identification of F1 generation mice: The sexually mature positive F0 generation mice obtained in the second step are respectively mated with wild-type mice (C57BL / 6J) for one generation, and finally F1 generation mice (heterozygous) are obtained, and further PCR and sequencing verification are carried out.

[0110] (4) Obtaining F2 generation homozygous mice: The F1 generation sexually mature heterozygous mice are crossed to obtain F2 generation mice. After the same PCR and sequencing verification, homozygous mice can be obtained, which are the Dlgap5 (NM_144553.3 p.N359*) gene knock-in mouse animal model.

[0111] 2. Identification of mouse genotypes

[0112] The process of mouse genotype identification includes: using the gDNA extraction kit (TIANamp Genomic DNA Kit, DP304-03) from Tiangen Biotech Co., Ltd. to extract DNA from mouse tissue samples. The extraction steps are as follows:

[0113] 1. Add 200 μL of buffer GA to the mouse toe or tail, and use alcohol-sterilized scissors to cut the tissue into pieces;

[0114] 2. Add 20 μL of Proteinase K solution and mix well by inverting up and down;

[0115] 3. Insert the EP tube into the floating device and place it in a 56 °C water bath for 1 h, and invert and mix once during this period;

[0116] 4. Add 200 μL of buffer GB, mix well by inverting thoroughly, and place at 70 °C for 10 min;

[0117] 5. Add 200 μL of absolute ethanol, mix well by inverting up and down and then shake vigorously on the oscillator for 15 sec;

[0118] 6. Transfer the above mixture to the adsorption column that has been placed in the collection tube and labeled, centrifuge at 12000 rcf / min for 30 sec, discard the collection tube and place the adsorption column into a new collection tube;

[0119] 7. Add 500 μL of buffer GD to the adsorption column, mix well by inverting up and down, then centrifuge at 12000 rcf / min for 30 sec, discard the collection tube and place the adsorption column into a new collection tube;

[0120] 8. Add 600 μL of wash buffer PW to the adsorption column, mix well by inverting up and down, then centrifuge at 12000 rcf / min for 30 sec, discard the collection tube and place the adsorption column into a new collection tube;

[0121] 9. Repeat step 8;

[0122] 10. Centrifuge the adsorption column at 12000 rcf / min for 2 min without sample, discard the collection tube and place the adsorption column into a new 1.5 mL EP tube, and air-dry for 5 min;

[0123] 11. Drop 250 μL of TE onto the middle part of the adsorption membrane in a suspended manner, let it stand at room temperature for 5 min, then centrifuge at 12000 rcf / min for 1 min, discard the adsorption column, cover the EP tube, and label it;

[0124] After the gDNA extraction was completed, PCR amplification was performed using the primers Dlgap5-F / R and then sequencing was carried out. Among them, the PCR reaction system was as follows: 10 μL of Green mix Buffer, 1 μL of gDNA, 1 μL of Dlgap5-F, 1 μL of Dlgap5-R, and finally made up to 20 μL with ddH2O. The PCR reaction program was: pre-denaturation at 95 °C for 5 min; denaturation at 94 °C for 30 s; annealing at 60 °C for 30 s; extension at 72 °C for 40 s, for a total of 35 cycles; extension at 72 °C for 5 min, and finally the program ended at 4 °C.

[0125] After the program was completed, the PCR amplification products were subjected to agarose gel electrophoresis to determine the band size, and the PCR amplification products were sent to Tsingke Biotechnology Co., Ltd. (Beijing, China) for Sanger sequencing verification.

[0126] Among them, the primer sequences used for genotype identification were as follows:

[0127] Dlgap5-F: TATGACAGAAGCAACTCTGTGTGT (SEQ ID No.3);

[0128] Dlgap5-R: ACGTCTCCTCTGTTAGGGTTGTTA (SEQ ID No.4);

[0129] The length of the PCR product of mouse tissue DNA: 519 bp.

[0130] Sequencing primer:

[0131] Dlgap5-F: TATGACAGAAGCAACTCTGTGTGT (SEQ ID No.5).

[0132] The products of PCR amplification of F1 generation mice in this example with the primers Dlgap5-F / R were subjected to 2% agarose gel electrophoresis, and the detection results are shown in the electrophoresis Figure 3 shown below. Figure 3 In the figure, the maker and M refer to pre-stained proteins, WT refers to wild-type mice, 21 - 31 refer to each F1 generation mouse, and Water refers to the blank control; this figure shows that the Dlgap5 gene amplification of each F1 generation mouse was successful and could be sent for sequencing to distinguish genotypes.

[0133] The analysis software for sequencing result analysis and sequence comparison was "Chromas", and the sequence comparison software used the online website: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi.

[0134] The gene sequence of wild-type mice includes:

[0135] TTTCCTGTTAGTTTTAGCACTACAACTCAAGACAAAGCA AAT GAAATCTTGGTACAGCAAGGA TTG GAGTCGCTAACAGA;

[0136] The gene sequence of homozygous mutant mice includes:

[0137] TTTCCTGTTAGTTTTAGCACTACAACTCAAGACAAAGCA TAG GAAATCTTGGTACAGCAAGGA CTC GAGTCGCTAACAGA;

[0138] The gene sequence of heterozygous mutant mice includes:

[0139] TTTCCTGTTAGTTTTAGCACTACAACTCAAGACAAAGCA AAT GAAATCTTGGTACAGCAAGGA TTG GAGTCGCTAACAGA; and

[0140] TTTCCTGTTAGTTTTAGCACTACAACTCAAGACAAAGCA TAG GAAATCTTGGTACAGCAAGGA CTC GAGTCGCTAACAGA.

[0141] The "peak graphs" of the sequencing results of mice with different mutation types are as follows Figure 4 As shown, according to the signal of the base "T" at the underlined position, there are two peaks at the corresponding position in heterozygous mice. One strand has the base replaced and the other strand remains wild-type. There is a single peak at the corresponding left position in homozygous mice, and both strands are mutant. There is a single peak at the corresponding right position in wild-type mice, and both strands are wild-type.

[0142] Example 2

[0143] Fertility of mice with different genotypes was further identified. Experimental mice were all used for the next experiment after determining their genotypes by PCR. Among them, there were 8 male mice in the WT group (aged 8 - 10 weeks), and several female wild-type mice, female Dlgap5 heterozygous mice, and female Dlgap5 homozygous mice (≥3 mice in each group, aged 8 - 10 weeks). Each male mouse was caged with two female mice respectively. Then, every morning at 8 o'clock and afternoon at 2 o'clock, it was observed whether vaginal plugs were formed in female mice. After continuous observation for five days, the female mice were separated and raised, and continued to be observed for 19 - 23 days until parturition, and the number of offspring was counted.

[0144] Figure 5 It is the statistical result of the average litter size of wild-type, heterozygous and homozygous mice. In this figure, the black circles represent wild-type female mice, the squares represent heterozygous female mice, and the triangles represent homozygous female mice. T-test was used for statistical analysis between different groups. ns indicates p > 0.05 between two groups, and **** indicates p < 0.0001 between two groups.

[0145] According to Figure 5 the results, there is no significant difference in the average litter size between wild-type and heterozygous mice, and the litter size of homozygous mice is 0, which is significantly different from the average litter size of wild-type and heterozygous mice.

[0146] The technical features of the above embodiments can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0147] The above embodiments only express several implementation manners of the present application, and their descriptions are relatively specific and detailed, but they should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims.

Claims

1. A method for constructing an animal model of fertility disorder, characterized in that: The animal is female, and the method comprises: terminating the expression of the DLGAP5 protein of the animal at the 359th amino acid to obtain a fertility disorder animal model.

2. The method according to claim 1, characterized in that The Dlgap5 gene is mutated so that the expression of the animal's DLGAP5 protein is terminated at amino acid position 359, and the mutation of the Dlgap5 gene satisfies the following conditions (1) to (3): (1) a nonsense mutation occurs at nucleotides 1075 to 1077 of the Dlgap5 gene; (2) a synonymous mutation occurs at nucleotides 1099 to 1101 of the Dlgap5 gene; (3) The mutation of the Dlgap5 gene was generated by CRISPR / Cas gene knock-in; Optionally, nucleotides 1075 to 1077 of the Dlgap5 gene are mutated from AAT to TAG; Optionally, nucleotides 1099 to 1101 of the Dlgap5 gene are mutated from TTG to CTC.

3. The method according to claim 2, characterized in that The mutation of the Dlgap5 gene produced by CRISPR / Cas gene knock-in includes: Injecting Dlgap5 gene-specific target sgRNA, Cas protein and donor DNA into animal fertilized eggs, culturing the animal fertilized eggs, and obtaining Dlgap5 gene knock-in animals; Wherein, the donor DNA contains a Dlgap5 gene fragment, and the Dlgap5 gene fragment contains a mutant sequence of the Dlgap5 gene.

4. The method according to claim 3, characterized in that The method satisfies the following conditions (1) to (3): (1) The sgRNA comprises the sequence shown in SEQ ID No. 1; SEQ ID No.1: AGACAAAGCAAATGAAATCTTGG; (2) The Cas protein is Cas9 protein; (3) The donor DNA comprises the sequence shown in SEQ ID No. 2; SEQ ID No.2: TGTGAAATTTGTTTGTTTGTTTGTTTGTTTTTCCTGTTAGTTTTAGCACT ACAACTCAAGACAAAGCATAGGAAATCTTGGTACAGCAAGGACTCGAGTC GCTAACAGACCGTAGTAAAGGTACGTTAGTTTAATTAAGCTGTCACTTCT.

5. The method according to claim 4, characterized in that Cultivating the animal fertilized eggs to obtain Dlgap5 gene knock-in animals includes: Cultivating the fertilized eggs of the animals to obtain F0 generation animals; F0 generation animals were mated with wild-type animals to obtain F1 generation heterozygous animals; F2 generation animals were obtained by crossing F1 generation heterozygous animals to obtain Dlgap5 gene knock-in animals.

6. The method according to claim 5, characterized in that Screening the F0 generation animals or the F2 generation animals to obtain homozygous animals with Dlgap5 gene knock-in; Optionally, the screening step includes: The DNA of the animal is extracted for PCR amplification, and the PCR amplification product is sequenced to determine whether the Dlgap5 genotype of the animal is homozygous.

7. The method according to claim 6, characterized in that The screening steps satisfy the following conditions (1) to (2): (1) The primers used in the PCR amplification include the sequences shown in SEQ ID No. 3 and SEQ ID No. 4; SEQ ID No.3: TATGACAGAAGCAACTCTGTGTGT; SEQ ID No.4: ACGTCTCCTCTGTTAGGGTTGTTA; (2) The sequencing is Sanger sequencing; Optionally, the primer for Sanger sequencing includes the sequence shown in SEQ ID No.5; SEQ ID No. 5: TATGACAGAAGCAACTCTGTGTGT.

8. The method according to any one of claims 1 to 7, characterized in that: The animal comprises at least one of mice, rats, cows, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer and minks.

9. Use of the animal model constructed by the method according to any one of claims 1 to 8 in the preparation or screening of therapeutic drugs for diseases associated with Dlgap5 gene deficiency.

10. The use according to claim 9, characterized in that The diseases associated with Dlgap5 gene defects include female fertility disorders.

Images