Application of OsLTP28 protein and coding gene thereof in regulation and control of plant fertility

Abstract

The invention discloses an application of OsLTP28 protein and a coding gene thereof in regulation and control of plant fertility. The invention provides a protein, which is named as OsLTP28 protein and is a protein as shown in SEQ ID NO: 1. A nucleic acid molecule for coding the OsLTP28 protein also belongs to the protection range of the invention. The invention relates to a DNA (Deoxyribonucleic Acid) molecule for coding OsLTP28 protein, namely an OsLTP28 gene. The invention also protects the application of the OsLTP28 protein or the OsLTP28 gene as an inhibition target in plant breeding. The target of plant breeding is (f1) and / or (f2): (f1) cultivation of plants with reduced fertility or cultivation of sterile plants; and (f2) cultivating the plant with reduced plant height. The method can be used for creating male sterile line germplasm resources and lodging-resistant germplasm resources, and has important application prospects in agricultural breeding and seed production.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of OsLTP28 protein and its encoding gene in regulating plant fertility. Background Art

[0002] The formation of male gametophyte pollen in plants includes two processes: microspore formation and male gamete formation. The microspore formation process takes place in young anthers, including the formation of microspore mother cells, meiosis, and tetrad dispersion. Male gametophytes, i.e. pollen grains, are formed by two mitotic divisions of microspores, which contain sperm cells called male gametes. Many related genes are involved in this series of pollen development processes. Only when they are expressed normally in a certain temporal and spatial order can the formation of fertile pollen be guaranteed.

[0003] my country is in a leading position in the world in the research and application of male sterility. In recent years, modern cell biology techniques, genetics and molecular biology methods have been used to conduct in-depth research on the male sterility process of model plants such as rice and Arabidopsis, and some new research results have been obtained, such as: the Ems1, CER1, AtGSL2 genes in Arabidopsis and the UDT1, MSP1, GAMYB, UDPG, WDA1 genes in rice. Mutations in the above genes directly lead to reduced fertility of plants, and some are completely sterile. Ems1 encodes a receptor kinase gene, which is mainly involved in the development of pollen mother cells and tapetum; UDT1 gene is a key gene for microspore development, which mainly acts during meiosis, and plays a role in the development of tapetum cells, meiosis of microspore mother cells and degradation of the middle layer; GAMYB gene is necessary for microspore mother cells to absorb nutrients closely to tapetum cells and then undergo normal meiosis; WDA1 gene is necessary for the formation of wax layer of rice pollen wall. The study of them deepens the understanding of the mechanism of plant male sterility. Compared with traditional methods, genetic engineering methods have some characteristics: shorter breeding cycle, relatively stable fertility, less impact by the environment, less dependence on genotype, and less environmental pollution.

[0004] Lodging is one of the main limiting factors affecting high and stable rice yields. Since the 1960s, the "Green Revolution" marked by crop dwarfing breeding has mainly used mutants of the gibberellin synthesis gene SD1 to cultivate semi-dwarf traits and improve the lodging resistance of crops (rice), resulting in a significant increase in rice yields over a large area. Summary of the invention

[0005] The purpose of the present invention is to provide the application of OsLTP28 protein and its encoding gene in regulating plant fertility.

[0006] The present invention provides a protein derived from rice (Oryza sativa L.), named OsLTP28 protein, which is as follows (a1) or (a2) or (a3) ​​or (a4):

[0007] (a1) the protein shown in SEQ ID NO: 1;

[0008] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of (a1);

[0009] (a3) a protein having the same function as (a1) obtained by substitution and / or deletion and / or addition of one or more amino acid residues;

[0010] (a4) A protein derived from rice and having 98% or more identity with (a1).

[0011] The labels may be specifically shown in Table 1.

[0012] Table 1 Tag sequences

[0013] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0014] Nucleic acid molecules encoding OsLTP28 protein also fall within the protection scope of the present invention.

[0015] The nucleic acid molecule may specifically be a DNA molecule.

[0016] The DNA molecule encoding the OsLTP28 protein is the OsLTP28 gene.

[0017] The OsLTP28 gene may specifically be as follows (c1) or (c2) or (c3) or (c4):

[0018] (c1) a DNA molecule whose coding region is shown in SEQ ID NO: 2;

[0019] (c2) the DNA molecule shown in SEQ ID NO: 3;

[0020] (c3) a DNA molecule having 75% or more identity with (c1) or (c2) and encoding the OsLTP28 protein;

[0021] (c4) A DNA molecule that hybridizes with (c1) or (c2) under stringent conditions and encodes the OsLTP28 protein.

[0022] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0023] The expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the OsLTP28 gene all fall within the protection scope of the present invention.

[0024] The present invention also protects the use of OsLTP28 protein or OsLTP28 gene, which is at least one of the following (d1) to (d9):

[0025] (d1) regulating plant fertility;

[0026] (d2) regulating plant fruiting rate;

[0027] (d3) Regulate plant pollen development;

[0028] (d4) regulating plant grain development;

[0029] (d5) regulating plant height;

[0030] (d6) cultivating transgenic plants with reduced fertility or sterility;

[0031] (d7) cultivating transgenic plants with improved fertility;

[0032] (d8) cultivating transgenic plants with reduced plant height;

[0033] (d9) Cultivate transgenic plants with increased plant height.

[0034] The regulation means that the OsLTP28 protein content is reduced and the plant fertility is reduced.

[0035] The regulation means that the expression of OsLTP28 gene is inhibited and the fertility of plants is reduced.

[0036] The regulation means that the OsLTP28 protein content is reduced and the plant fruit setting rate is reduced.

[0037] The regulation means that the expression of OsLTP28 gene is inhibited and the fruit setting rate of plants is reduced.

[0038] The regulation means that the OsLTP28 protein content is reduced and the pollen development of the plant is inhibited.

[0039] The regulation means that the expression of OsLTP28 gene is inhibited and the pollen development of plants is inhibited.

[0040] The regulation means that the OsLTP28 protein content is reduced and the plant grain development is inhibited.

[0041] The regulation means that the expression of OsLTP28 gene is inhibited and the development of plant grains is inhibited.

[0042] The regulation means that the OsLTP28 protein content is reduced and the plant height is reduced.

[0043] The regulation means that the expression of OsLTP28 gene is inhibited and the height of the plant is reduced.

[0044] The present invention also protects the use of a substance that inhibits the expression of the OsLTP28 gene in plant breeding; the goals of the plant breeding are (f1) and / or (f2):

[0045] (f1) cultivating plants with reduced fertility or cultivating sterile plants;

[0046] (f2) Growing plants with reduced plant height.

[0047] The substance that inhibits the expression of the OsLTP28 gene can specifically be: a gene editing vector targeting the OsLTP28 gene. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsLTP28 gene. Specifically, the target of the sgRNA is: TGCGGGCCGTTCCTGCTGGG. The target of the sgRNA is located at positions 136-155 of SEQ ID NO: 2.

[0048] The present invention also protects the use of a substance that reduces the content of OsLTP28 protein in plant breeding; the goals of the plant breeding are (f1) and / or (f2):

[0049] (f1) cultivating plants with reduced fertility or cultivating sterile plants;

[0050] (f2) Growing plants with reduced plant height.

[0051] The present invention also protects the use of OsLTP28 protein or OsLTP28 gene as an inhibition target in plant breeding; the goals of the plant breeding are (f1) and / or (f2):

[0052] (f1) cultivating plants with reduced fertility or cultivating sterile plants;

[0053] (f2) Growing plants with reduced plant height.

[0054] The present invention also protects a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: inhibiting the expression of the OsLTP28 gene in a starting plant to obtain a target plant; the fertility of the target plant is lower than that of the starting plant and / or the plant height of the target plant is lower than that of the starting plant.

[0055] The present invention also protects a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: reducing the content of OsLTP28 protein in a starting plant to obtain a target plant; the fertility of the target plant is lower than that of the starting plant and / or the plant height of the target plant is lower than that of the starting plant.

[0056] The present invention also protects a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: mutating the segment "TGCGGGCCGTTCCTGCTGGGCGGCGCG" in the OsLTP28 gene in the plant genomic DNA into "TGCGGGCCGTTCCTGCTTGGGCGGCGCG" or "TGCGGGCCGTTGTGGGCGGCGCG" in a homozygous mutation manner.

[0057] Any of the above mentioned fertility may be male fertility.

[0058] Any of the above mentioned fertility can be manifested as pollen fertility.

[0059] Any of the above fertility characteristics can be reflected in the fruit setting rate.

[0060] Any of the above mentioned sterility may be male sterility.

[0061] Any of the above plants may be monocots or dicots.

[0062] Any of the above plants may be a plant of the Poaceae family.

[0063] Any of the above plants may be a rice plant.

[0064] Specifically, any of the above plants can be rice.

[0065] Specifically, any one of the above plants can be rice Zhonghua No. 11.

[0066] Specifically, any one of the above plants can be Dongjin rice.

[0067] First, the inventors of the present invention obtained a rice osltp28 mutant (named as mutant A), in which T-DNA insertion occurred in the genomic DNA, and the insertion position was located in the promoter region of the OsLTP28 gene, so that the expression level of the OsLTP28 gene (encoding the rice lipid transport protein OsLTP28) in the rice body was reduced. Compared with wild-type rice, the rice osltp28 mutant has a reduced plant height, thus having the advantage of lodging resistance. Compared with wild-type rice, the rice osltp28 mutant has a reduced number of mature pollen in the stamens, thereby reducing male fertility.

[0068] Then, the inventors of the present invention performed gene editing on rice targeting the OsLTP28 gene, and obtained a new rice osltp28 mutant (named as mutant B). Compared with wild-type rice, the rice osltp28 mutant has a reduced plant height, thus having the advantage of lodging resistance. Compared with wild-type rice, the rice osltp28 mutant has a reduced number of mature pollen in the stamens, thereby reducing male fertility.

[0069] OsLTP28 protein has the function of regulating plant height and plant male fertility, and can be used in plant breeding. Taking OsLTP28 gene as an inhibition target can create male sterile germplasm resources and lodging-resistant germplasm resources, which has important application prospects in agricultural breeding and seed production. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 Schematic diagram of the primer identification principle in Example 1.

[0071] Figure 2 This is the electrophoresis diagram in Example 1.

[0072] Figure 3 This is the statistical result of the relative expression level of the OsLTP28 gene in Example 2.

[0073] Figure 4 This is a photo of the plants at the heading stage in Example 2.

[0074] Figure 5 These are the statistical results of the plant height at the mature stage in Example 2.

[0075] Figure 6 These are photos of anthers and pollen after staining in Example 2.

[0076] Figure 7 These are the statistical results of the fertile pollen ratio and the sterile pollen ratio in Example 2.

[0077] Figure 8 This is a photo of mature rice ears in Example 2.

[0078] Fig. 9 It is the statistical result of the ratio of full grain seeds and the ratio of empty grain seeds in the embodiment.

[0079] Fig.10 Schematic diagram of the elements of the pCBSG032 vector.

[0080] Fig.11 These are the sequencing results of the osltp28-1 mutant and the osltp28-2 mutant.

[0081] Fig.12 These are photos of plants at the heading stage and statistical results of plant height at the mature stage in Example 5.

[0082] Fig.13 These are the statistical results of the fertile pollen ratio and the sterile pollen ratio in Example 5. DETAILED DESCRIPTION

[0083] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0084] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. 2 -KI staining solution: Dissolve 0.5g KI in 1.25mL deionized water, add 0.25g iodine tablets, dilute to 75mL, and store in a dark place.

[0085] Example 1. Obtaining mutant rice and OsLTP28 gene

[0086] 1. Obtaining mutant rice and OsLTP28 gene

[0087] Rice osltp28 mutant: from the Korean rice mutant library (Crop Biotech Institute, KyungHee University, Republic of Korea, http: / / www.postech.ac.kr / life / pfg / risd, ordering website: https: / / orygenesdb.cirad.fr / cgi-bin / searching.pl). The seed number or label of the rice osltp28 mutant is 1A-22510L, and the relevant information provided by the seller is shown in Table 2. The rice osltp28 mutant was obtained by T-DNA insertion in Dongjin rice. In the Dongjin rice genomic DNA, the nucleotide sequence around the T-DNA insertion position is shown in SEQ ID NO: 4 (the insertion position is between nucleotides 1683 and 1684).

[0088] Table 2

[0089] Locus ID Chr. Start End FST Plant Name Orientation Region Source Mutagen Os03g59380 Os03 33798940 33799765 1A-22510L C03722 forward promoter Postech T-DNA

[0090] The gene with the mutation in the promoter region is named OsLTP28 gene, and its open reading frame is shown in SEQ ID NO: 2. The OsLTP28 gene in Dongjin rice genomic DNA is shown in SEQ ID NO: 3. The protein encoded by the OsLTP28 gene is OsLTP28 protein, as shown in SEQ ID NO: 1.

[0091] 2. Identification of mutant rice genotypes

[0092] 1. PCR amplification

[0093] The purchased seeds were sown and cultivated into plants, which were the test plants.

[0094] There are 18 test plants in total, numbered #1-#18.

[0095] The test plants were subjected to the following operations: leaves were taken to extract genomic DNA. Using the genomic DNA as a template, PCR amplification was performed using a primer pair consisting of 1A-22510-LP and 2717-LB and a primer pair consisting of 1A-22510-LP and 1A-22510-RP to obtain PCR amplification products.

[0096] 1A-22510-LP: CCATAGATCGATCGATCGATCGGT;

[0097] 1A-22510-RP:CATAATGCCCCTTGCCACAATTTT;

[0098] 2717-LB: ACGCTGAACTTGTGGCCGTT.

[0099] See the schematic diagram of primer identification principle for Figure 1 .

[0100] PCR amplification reaction system (20 μl): 2xKOD Mix 10 μl, genomic DNA 2 μl, 10 μM upstream primer 1 μl, 10 μM downstream primer 1 μl, KOD DNA Polymerase 1 μl, ddH 2 Add 0.1% HO to 20 μl.

[0101] The reaction conditions of PCR amplification were as follows: 95°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, 68°C for 40 sec, 24 cycles; 68°C for 10 min.

[0102] 2. Add 5 μl of 10X loading buffer to the PCR product obtained in step 1, and then perform 2% agarose gel electrophoresis. Interpretation is performed based on the electrophoresis band display. The interpretation method is shown in Table 3.

[0103] Table 3

[0104] 1A-22510-RP / 2717-LB 1A-22510-LP / 1A-22510-RP Wild type plants No banding With stripes Heterozygous osltp28 mutant With stripes With stripes Homozygous osltp28 mutant With stripes No banding

[0105] Electrophoresis diagram Figure 2 Plants #1, #2, #4, #5, #6, #7, #8, #10, #12, #13, #14 and #15 were all homozygous osltp28 mutants, and plant #9 was a heterozygous osltp28 mutant. Plants #16, #17 and #18 were all wild-type plants. Plants #3 and #11 failed to amplify and no identification results were obtained.

[0106] Example 2: Phenotypic Identification

[0107] Test seeds: seeds obtained by self-pollination of the homozygous osltp28 mutant plants obtained in Example 1 and seeds obtained by self-pollination of the wild-type plants obtained in Example 1.

[0108] The test seeds were sown and cultured until they emerged, and then transferred to the fields in the suburbs of Beijing for normal cultivation and management.

[0109] 1. Detection of OsLTP28 gene expression

[0110] At the vegetative growth stage (3-leaf stage), the third mature leaf was taken to extract total RNA and reverse transcribe to obtain cDNA. Using cDNA as a template and Osactin gene as an internal reference gene, the relative expression level of OsLTP28 gene was detected.

[0111] During the reproductive growth stage of the plant, spikelets of 5 cm in length were taken to extract total RNA and reverse transcribe to obtain cDNA. The relative expression level of the OsLTP28 gene was detected using cDNA as a template and the Osactin gene as an internal reference gene.

[0112] The primers used to detect the OsLTP28 gene are:

[0113] 03g59380-RTF:ATGGCGAGCGCTCGTCGCAG;

[0114] 03g59380-RTR:GATATCTTGCTGCAGTCGGT.

[0115] Results Figure 3 .

[0116] 2. Detect plant height

[0117] Observe and measure plant height during the vegetative growth stage. The vegetative growth stage refers to the entire period from germination to heading, which is usually 90-120 days. Figure 4 Compared with the self-pollinated progeny of wild-type plants, the plant height of the self-pollinated progeny of mutant plants was significantly reduced.

[0118] The plant height was observed and measured at maturity, and the statistical results are shown in Figure 5 (Average of 10 plants). The height of the self-pollinated offspring of the wild-type plants was about 110 cm, and the height of the self-pollinated offspring of the osltp28 mutant was about 80 cm. Compared with the self-pollinated offspring of the wild-type plants, the height of the self-pollinated offspring of the mutant plants was significantly reduced.

[0119] Reduced plant height is a lodging resistance trait.

[0120] 3. Testing male fertility

[0121] During the flowering period of the plant, small flowers in the pollen stage were taken and anthers were obtained by dissection under a stereoscope. I 2 -KI solution, quickly crush the anthers to release the pollen, observe the pollen under a microscope and take pictures.

[0122] See the photos of anthers and pollen after staining for Figure 6 .

[0123] The statistical results of the fertile pollen ratio and the sterile pollen ratio are shown in Figure 7 (Average value of 10 plants). The mature pollen of the self-pollinated offspring of the wild-type plant is easily stained dark due to being full of starch and other metabolites, and the pollen is round. More than 60% of the pollen of the self-pollinated offspring of the osltp28 mutant cannot be stained dark, and the pollen is irregular, shrunken, and abnormally developed. The results show that the pollen development of the self-pollinated offspring of the osltp28 mutant is affected.

[0124] 4. Analysis of Rice Ear Phenotype and Seed Setting Rate

[0125] See the photo of mature rice ears Figure 8 .

[0126] The statistical results of the proportion of filled seeds and empty seeds in mature rice ears are shown in Fig. 9 (Average value of 10 strains).

[0127] The self-pollinated offspring of the wild-type plant had normal fruit set per spikelet, with a fruit set rate of 90%. The self-pollinated offspring of the osltp28 mutant had normal flowering time, but the fruit set rate per spikelet was extremely low, with only about 30% eventually forming seeds.

[0128] Example 3: Preparation of culture medium and infection solution

[0129] The formula of NB basic medium is shown in Table 4.

[0130] Table 4

[0131]

[0132]

[0133] Callus induction medium (pH 5.8): On the basis of NB basic medium, enzymatic hydrolyzed casein (to make its concentration in the medium 500 mg / L), 2,4-D (to make its concentration in the medium 2 mg / L), proline (to make its concentration in the medium 2.8 g / L), sucrose (to make its concentration in the medium 30 g / L) and plant gel (to make its concentration in the medium 2.6 g / L) were added.

[0134] Callus subculture medium (pH 5.8): On the basis of NB basic medium, add enzymatic hydrolyzed casein (so that its concentration in the medium is 500 mg / L), 2,4-D (so that its concentration in the medium is 2 mg / L), proline (so that its concentration in the medium is 0.5 g / L), sucrose (so that its concentration in the medium is 30 g / L) and plant gel (so that its concentration in the medium is 2.6 g / L).

[0135] Co-cultivation medium (pH 5.2): On the basis of NB basic medium, acetosyringone (to make its concentration in the medium 100 μM), glucose (to make its concentration in the medium 10 g / L) and phytagel (to make its concentration in the medium 2.6 g / L) were added.

[0136] Screening medium (pH 5.8): On the basis of NB basic medium, add hydrolyzed casein (so that its concentration in the medium is 500 mg / L), 2,4-D (so that its concentration in the medium is 2 mg / L), proline (so that its concentration in the medium is 2.8 g / L), sucrose (so that its concentration in the medium is 30 g / L), G418 (so that its concentration in the medium is 150 mg / L), cephalosporin (so that its concentration in the medium is 500 mg / L) and plant gel (so that its concentration in the medium is 2.6 g / L).

[0137] Differentiation medium (pH 5.8): On the basis of NB basic medium, add kinetin (to make its concentration in the medium 2 mg / L), NAA (to make its concentration in the medium 0.5 mg / L), sucrose (to make its concentration in the medium 30 g / L), sorbitol (to make its concentration in the medium 30 g / L), G418 (to make its concentration in the medium 150 mg / L), cephalosporin (to make its concentration in the medium 300 mg / L) and phytagel (to make its concentration in the medium 2.6 g / L).

[0138] Rooting medium (pH 5.8): contains 1 / 4 concentration of MS inorganic salt, 1× concentration of MS vitamin, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L plant gel, and the balance is water.

[0139] The formula of AAM infection solution (pH 5.2) is shown in Table 5.

[0140] Table 5

[0141]

[0142] Example 4. Obtaining osltp28 mutant

[0143] Rice variety Zhonghua No. 11: Institute of Crop Science, Chinese Academy of Agricultural Sciences. Zhonghua No. 11 was cultivated by the Institute of Crop Science, Chinese Academy of Agricultural Sciences in 1979 using Jingfeng No. 5 / Tetepu / Fujin. Zhonghua No. 11 is recorded in the following document: Ni Pichong. New rice variety cultivated by flower culture—Zhonghua No. 11. Crop Variety Resources, Issue 4, 1989. Zhonghua No. 11 plant is also called wild-type plant, represented by WT. The OsLTP28 gene in the genomic DNA of Zhonghua No. 11 rice is shown in SEQ ID NO: 3, and the protein encoded is shown in SEQ ID NO: 1.

[0144] pCBSG032 vector (elements schematic diagram see Fig.10 ): Weimi Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with a virus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi: 10.1111 / jipb.13381. Epub ahead of print. PMID: 36218268.

[0145] In this embodiment, rice Zhonghua No. 11 plant was used as the starting plant to prepare a CRISPR / Cas-mediated site-directed gene-edited plant (i.e., osltp28 mutant) with OsLTP28 gene as the target gene.

[0146] 1. Construction of gene editing vector

[0147] The preset target is: TGCGGGCCGTTCCTGCTGGG.

[0148] The preset target site is located at positions 136-155 of SEQ ID NO:2.

[0149] 1. Prepare single-stranded DNA molecules F and R, and then anneal them to obtain double-stranded DNA molecules with sticky ends.

[0150] F: ggcaTGCGGGCCGTTCCTGCTGGG;

[0151] R:aaacCCCAGCAGGAACGGCCCGCA.

[0152] 2. Take the pCBSG032 vector, digest it with the restriction endonuclease BsaI, and recover the vector backbone (i.e., a large linear fragment of about 1.6 kb).

[0153] 3. The double-stranded DNA molecule with sticky ends obtained in step 1 is connected to the vector backbone obtained in step 2 to obtain a recombinant plasmid, which is the gene editing vector. The gene editing vector has been sequenced and verified.

[0154] 2. Obtaining gene-edited plants

[0155] 1. Callus induction and subculture

[0156] Take mature seeds of rice Zhonghua No. 11, peel off the husks, disinfect with 75% ethanol solution for 1 min, then rinse with sterile water, then disinfect with 30% sodium hypochlorite solution for 20 min, then wash thoroughly with sterile water, use sterilized filter paper to absorb the moisture on the surface of the seeds, and then transfer the seeds to callus induction medium for culture to obtain callus tissue for Agrobacterium infection (the callus is in good condition, bright yellow color, round and hard texture, and the particle diameter is about 3 mm).

[0157] After the callus tissue grows out, the proembryo can be directly infected with Agrobacterium. The small particles growing next to the proembryo can be picked out and subcultured on the callus subculture medium. When they grow to a suitable size, they can also be infected with Agrobacterium.

[0158] 2. Preparation of Agrobacterium suspension

[0159] The gene editing vector prepared in step 1 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was cultured and the cells were collected and suspended with AAM infection solution to obtain OD 600nm The value is 0.3-0.5 for Agrobacterium suspension.

[0160] 3. Agrobacterium infection

[0161] Take the callus obtained in step 1, immerse it in the Agrobacterium suspension prepared in step 2, and infect it at room temperature for 20 minutes (shake it from time to time during the period), then take out the callus, absorb the excess bacterial solution with sterile filter paper, and then transfer it to the co-cultivation medium covered with a layer of sterile filter paper, and culture it in the dark at 26°C for 3 days.

[0162] 4. Screening and cultivation

[0163] After completing step 3, take the callus tissue, rinse it twice with sterile water, then rinse it once with carbenicillin solution, remove excess water with a pipette, transfer it to sterile filter paper, air-dry the surface moisture on a clean bench, and then transfer it to a screening medium containing hygromycin. Culture it in the dark at 28-30℃ for 3-4 weeks. At this time, positive calli with bright yellow color and 1-2 mm diameter can be observed.

[0164] 5. Differentiation and regeneration

[0165] Take the positive callus obtained in step 4, transfer it to the differentiation medium, and culture it under alternating light and dark conditions (16h light / 8h dark) at 28-30°C. After about 10 days of culture, green spots can be observed on the callus, and seedlings will differentiate after another 10 days of culture. Culture until the differentiated seedlings are 2-3 cm tall.

[0166] 6. Rooting

[0167] Take the seedlings obtained in step 5, transfer them to rooting medium, and culture them at 28-30° C. with alternating light and dark conditions (16 h light / 8 h dark). The rooted seedlings are T0 generation plants.

[0168] 3. Identification of Mutation Forms

[0169] The T0 generation plants obtained in step 2 are self-pollinated and seeds are harvested, and the seeds are cultivated into plants, namely the T1 generation plants.

[0170] The leaves of T1 plants were taken to extract genomic DNA, and PCR amplification was performed using a primer pair consisting of CAS9-OsLTP28-F and CAS9-OsLTP28-R, and then the amplified products were recovered and sequenced. Mutants were screened based on the sequencing results.

[0171] CAS9-OsLTP28-F:TTCAATCGATCGGCCGTCAC;

[0172] CAS9-OsLTP28-R: ATGCGCCATGAGACCAATCT.

[0173] Two homozygous mutant strains were screened from the T1 generation plants and named as osltp28-1 mutant and osltp28-2 mutant.

[0174] Compared with the genomic DNA of the wild-type plant, a nucleotide T was inserted into the OsLTP28 gene in the genomic DNA of the osltp28-1 mutant, resulting in a frameshift (i.e., the following mutation occurred in both homologous chromosomes: from "TGCGGGCCGTTCCTGCTGGGCGGCGCG" to "TGCGGGCCGTTCCTGCTTGGGCGGCGCG"), and normal protein could not be translated. Sequencing results are shown in Fig.11 .

[0175] Compared with the genomic DNA of the wild-type plant, the OsLTP28 gene in the genomic DNA of the osltp28-2 mutant had a 4-nucleotide deletion, resulting in a frameshift (i.e., the following mutation occurred in both homologous chromosomes: from "TGCGGGCCGTTCCTGCTGGGCGGCGCG" to "TGCGGGCCGTT---G-TGGGCGGCGCG"), and normal protein could not be translated. Sequencing results are shown in Fig.11 .

[0176] Example 5, property identification

[0177] Test seeds: seeds obtained by self-pollination of the osltp28-1 mutant obtained in Example 4, seeds obtained by self-pollination of the osltp28-2 mutant obtained in Example 4, and Zhonghua No. 11 seeds.

[0178] The test seeds were sown and cultured until they emerged, and then transferred to the fields in the suburbs of Beijing for normal cultivation and management.

[0179] 1. Observe the plant height phenotype

[0180] See the photos of the plants at heading stage. Fig.12 Left picture (wild type refers to Zhonghua No. 11, and gene-edited mutants refer to offspring plants of the osltp28-1 mutant). Compared with Zhonghua No. 11, the plant height of the self-pollinated offspring of the osltp28-1 mutant was significantly reduced. There was no significant difference in the plant height of the self-pollinated offspring of the osltp28-2 mutant and the self-pollinated offspring of the osltp28-1 mutant.

[0181] The plant height was observed and measured at maturity, and the statistical results are shown in Fig.12The right picture (average value of 10 plants) (the wild type refers to Zhonghua No. 11, and the gene-edited mutant refers to the offspring plants of the osltp28-1 mutant). The plant height of the self-pollinated offspring of the wild-type plant is about 115 cm, and the plant height of the self-pollinated offspring of the osltp28-1 mutant is about 84 cm. Compared with the self-pollinated offspring of the wild-type plant, the plant height of the self-pollinated offspring of the osltp28-1 mutant is significantly reduced. There is no significant difference in the plant height of the self-pollinated offspring of the osltp28-2 mutant and the self-pollinated offspring of the osltp28-1 mutant.

[0182] 2. Pollen phenotype and pollen fertility analysis

[0183] During the flowering period of the plant, small flowers in the pollen stage were taken and anthers were obtained by dissection under a stereoscope. I 2 -KI solution, quickly crush the anthers to release the pollen, observe the pollen under a microscope and take pictures.

[0184] The statistical results of the fertile pollen ratio and the sterile pollen ratio are shown in Fig.13 (Average value of 10 plants) (The wild type refers to Zhonghua No. 11, and the gene-edited mutant refers to the offspring of the osltp28-1 mutant.) Compared with the self-pollinated offspring of the wild-type plant, the pollen fertility of the self-pollinated offspring of the osltp28-1 mutant was significantly reduced. There was no significant difference in the pollen fertility of the self-pollinated offspring of the osltp28-2 mutant and the self-pollinated offspring of the osltp28-1 mutant.

[0185] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein which is (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of (a1); (a3) a protein having the same function as (a1) obtained by substitution and / or deletion and / or addition of one or more amino acid residues; (a4) A protein derived from rice and having 98% or more identity with (a1).

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, Features: The nucleic acid molecule is as follows (c1) or (c2) or (c3) or (c4): (c1) a DNA molecule whose coding region is shown in SEQ ID NO: 2; (c2) the DNA molecule shown in SEQ ID NO: 3; (c3) a DNA molecule having 75% or more identity with (c1) or (c2) and encoding the protein of claim 1; (c4) A DNA molecule that hybridizes with (c1) or (c2) under stringent conditions and encodes the protein of claim 1.

4. An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1 or the nucleic acid molecule according to claim 2 or 3, which is at least one of the following (d1) to (d9): (d1) regulating plant fertility; (d2) regulating plant fruiting rate; (d3) Regulate plant pollen development; (d4) regulating plant grain development; (d5) regulating plant height; (d6) cultivating transgenic plants with reduced fertility or sterility; (d7) cultivating transgenic plants with improved fertility; (d8) cultivating transgenic plants with reduced plant height; (d9) Cultivate transgenic plants with increased plant height.

6. Use of a substance for inhibiting the expression of a nucleic acid molecule according to claim 2 or 3 in plant breeding; the goal of the plant breeding is (f1) and / or (f2): (f1) cultivating plants with reduced fertility or cultivating sterile plants; (f2) Growing plants with reduced plant height.

7. Use of the substance for reducing the protein content of claim 1 in plant breeding; the goals of the plant breeding are (f1) and / or (f2): (f1) cultivating plants with reduced fertility or cultivating sterile plants; (f2) Growing plants with reduced plant height.

8. Use of the protein according to claim 1 or the nucleic acid molecule according to claim 2 or 3 as an inhibition target in plant breeding; the goal of the plant breeding is (f1) and / or (f2): (f1) cultivating plants with reduced fertility or cultivating sterile plants; (f2) Growing plants with reduced plant height.

9. A method for cultivating plants with reduced plant height and / or reduced fertility, which is method A or method B; The method A comprises the following steps: inhibiting the expression of the nucleic acid molecule of claim 2 or 3 in a starting plant to obtain a target plant; The method B comprises the following steps: reducing the content of the protein according to claim 1 in the starting plant to obtain the target plant; The fertility of the target plant is lower than that of the starting plant and / or the plant height of the target plant is lower than that of the starting plant.

10. A method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: mutating the segment "TGCGGGCCGTTCCTGCTGGGCGGCGCG" in the OsLTP28 gene in the plant genomic DNA into "TGCGGGCCGTTCCTGCTTGGGCGGCGCG" or "TGCGGGCCGTTGTGGGCGGCGCG" in a homozygous mutation manner.

Images