Recombinant deinsectization streptomycete, construction method thereof and application of recombinant deinsectization streptomycete in preparation of convermectin B

Abstract

The invention relates to recombinant streptomyces avermitilis, a construction method of the recombinant streptomyces avermitilis and application of the recombinant streptomyces avermitilis in preparation of combined vermectin B. The recombinant streptomyces avermitilis is streptomyces avermitilis HU510 preserved in China Center for Type Culture Collection (CCTCC), the preservation date is October 9, 2024, and the preservation number of the strain is CCTCC NO: M 20242151. The invention relates to the technical field of synthetic biology, in particular to a method for preparing and producing a novel biological insecticide, and particularly relates to a method for preparing recombinant insect-killing streptomyces of combined vermectin B. The streptomyces sp. Has an aveA3 gene which is inactivated or reduced in activity, and has a functional milA3 gene. According to the invention, efficient production of the combined vermectin B can be realized. According to the invention, a biological synthetic method and technology are utilized to recombine and transform a biosynthetic pathway of abamectin, and the novel insecticidal antibiotic is obtained through screening.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology, and in particular to a method for preparing a recombinant engineered Streptomyces for producing a novel biopesticide, in particular comycin B. Background Art

[0002] Avermectin is a 16-membered macrolide polyketide compound produced by Streptomyces avermitilis. It is an agricultural antibiotic with excellent insecticidal activity. Avermectin and its derivative ivermectin have been commercialized as biological pesticides and veterinary drugs, respectively, and have a huge application market. However, avermectin and its derivatives have been widely used for more than 30 years, and many pests have developed serious resistance to them. Therefore, it is of great significance to screen new avermectin biological insecticides with novel structures, higher activity and wider insecticidal spectrum. Milbemycin is an avermectin analog produced by fermentation of Streptomyces hygroscopicus. Its insecticidal activity against animal parasites is better than that of avermectin and ivermectin, and its toxicity is relatively lower. Summary of the invention

[0003] The purpose of the present invention is to provide a recombinant Streptomyces avermitilis and a construction method thereof and an application thereof in the preparation of comycin B.

[0004] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: a recombinant Streptomyces avermitilis, wherein the recombinant Streptomyces avermitilis is Streptomyces avermitilis HU510, which is deposited in the China Center for Type Culture Collection (CCTCC), the preservation date is October 9, 2024, and the strain preservation number is CCTCC NO: M 20242151.

[0005] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: the use of the recombinant Streptomyces avermitilis in the preparation of comycin B.

[0006] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: an antibiotic prepared by fermentation of the recombinant Streptomyces avermitilis, which conforms to at least one of the following structural formulas:

[0007]

[0008] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: the method for constructing the recombinant Streptomyces avermitilis, characterized in that: through the PCR targeting technology, the aveA3 gene in the genome of the Streptomyces avermitilis expressing ivermectin is replaced with the functional mil A3 gene, so that the aveA3 gene is inactivated or its activity is reduced, and the Streptomyces avermitilis obtains a functional milA3 gene.

[0009] The preferred technical solution is: comprising the following steps:

[0010] Step 1: Extraction of genomic DNA of Streptomyces avermitilis and Streptomyces hygroscopicus;

[0011] Step 2: Construction of plasmid pAmT;

[0012] Step 3: Construction of the recombinant plasmid pAmT-AA3U-milA3-AA3D for replacing the aveA3 gene of Streptomyces avermitilis;

[0013] Step 4: Replacement of the Streptomyces avermitilis aveA3 gene.

[0014] The preferred technical scheme is: in step 1, spores of Streptomyces avermitilis and Streptomyces hygroscopicus are inoculated into the culture medium respectively, and cultured at 25-30°C for 32-48h; the cells are collected by centrifugation, washed twice with 1×TE solution, resuspended with 500μL 1×TE solution, lysozyme is added to make the final concentration to 5mg / mL, 1μL RNase is added, and the mixture is incubated in a water bath at 35-39°C for 30-60min; 60μL SDS with a mass fraction of 10% is added to make the final concentration to 1%, 40μL proteinase K is added to make the final concentration to 1mg / mL, and the mixture is in a water bath at 54-56°C for 30-60min; 200μL 5M NaCl is added to make the final concentration to 1.25M; 800μL of a mixed solution composed of phenol, chloroform and isoamyl alcohol is added and mixed, and the mixture is centrifuged at 20°C and 8000rpm for 20min; 500μL supernatant is taken, 40μL 3M The pH value is 7.5NaAc-HAc buffer solution, after mixing, 1mL of anhydrous ethanol is added, and the mixture is centrifuged at 10000-15000rpm for 5min to precipitate genomic DNA; the precipitate is washed with 70% ethanol by volume, the liquid is discarded by centrifugation, and after drying, it is dissolved in 1×TE solution to obtain a genomic DNA solution; the volume ratio of phenol: chloroform: isoamyl alcohol in the mixed solution is 25:24:1.

[0015] The preferred technical scheme is: in step 2, plasmid pMD19s is digested with Ssp I, dephosphorylated with FastAP, and fragment 1 is recovered by electrophoresis; plasmid PIJ773 is digested with XbaI and BstBI, and fragment 2 containing aac(3)IV gene and oriT is recovered by electrophoresis; fragment 1 and fragment 2 are blunt-ended according to the BKL kit instructions, and connected to obtain the recombinant plasmid pAmT.

[0016] The preferred technical scheme is: in step 3, primers AA3UF and AA3UR are used to amplify the upstream fragment AA3U of the aveA3 gene of Streptomyces avermitilis; AA3DF and AA3DR are used to amplify the downstream fragment 2AA3D of the aveA3 gene of Streptomyces avermitilis; plasmid pAmT is digested with XbaⅠ and dephosphorylated with FastAp to obtain fragment 3; fragment 1 is digested with XbaⅠ, recovered by electrophoresis, and connected with fragment 3 to obtain vector pAmT-AA3U; fragment 2 is digested with XbaⅠ, recovered by electrophoresis, and connected with vector pAmT-AA3U to obtain plasmid pAmT-AA3U-AA3D, which is then digested with XbaⅠ to obtain fragment 4; library plasmid cosmid Transformation of milA3 into E. coli BW25113 / pIJ790: A single colony of E. coli BW25113 / pIJ790 was inoculated into 10 mL of LB medium containing 25 μg / mL chloramphenicol and cultured overnight at 30°C and 250 rpm. 100 μL of the overnight bacterial culture was transferred to 10 mL of SOB medium containing 25 μg / mL chloramphenicol and cultured at 30°C and 250 rpm for 3-4 h until the OD 6000.3-0.5; at 4°C, centrifuge at 4000rpm for 5min to collect the bacteria, wash twice with 10mL of ice-cold 10% glycerol, and suspend the precipitate with 100μL of ice-cold 10% glycerol to obtain the electroporation competent state; add 50-150ng library plasmid cosmid milA3 to 50μL competent cells, and perform electroporation in a 0.2cm ice-cold electroporation cup; the electroporation parameters are: 200Ω, 25μF, 2.5kV; the duration of the electroporation is 4.5-4.9ms; after the electroporation, add 1mL of pre-cooled LB medium and shake and culture at 30°C for 1h; take 50μL of the transformation solution and spread it on an LB plate containing 50μg / mL kanamycin and 25μg / mL chloramphenicol, culture overnight at 30°C, and grow a single colony; PCR targeting of the library plasmid: randomly pick a plasmid containing the library plasmid cosmid A single colony of Escherichia coli BW25113 / pIJ790 with milA3 was inoculated into 10 mL of LB medium containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured overnight at 30°C and 250 rpm; 100 μL of the overnight bacterial solution was transferred to 10 mL of SOB medium containing 50 μg / mL kanamycin, 25 μg / mL chloramphenicol and 10 mM L-arabinose, and cultured at 30°C and 250 rpm to prepare an electroporation competent state; 50 to 150 ng of fragment 4 was added to 50 μL of competent cells, and electroporation was performed in a 0.2 cm ice-precooled electroporation cup; the electroporation parameters were: 200 Ω, 25 μF, 2.5 kV; the duration of the electroporation was between 4.5 and 4.9 ms; 1 mL of cold precooled LB medium was added, and cultured at 37°C and shaken for 1 h; after centrifugation, part of the supernatant was removed, and the precipitate was suspended with the remaining supernatant. , and spread the entire amount on an LB plate containing 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture at 37°C overnight; pick a single colony in 3 mL LB medium containing 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture at 37°C, 250 rpm for about 6 hours, extract the plasmid with a plasmid extraction kit according to the instructions, and perform enzyme digestion test with restriction endonucleases to screen out the correct plasmid and obtain the recombinant plasmid pAmT-AA3U-milA3-AA3D.

[0017] The preferred technical solution is: in step 4, the recombinant plasmid pAmT-AA3U-milA3-AA3D is transformed into the starting strain Streptomyces avermitilis: Escherichia coli ET12567 by the conjugation transfer method to prepare the electroporation competent state, 1 to 2 μL of the recombinant plasmid pAmT-AA3U-milA3-AA3D is added to 50 μL of competent cells, and the electroporation is carried out in a 0.2 cm ice pre-cooled electroporation cup; the electroporation parameters are: 200Ω, 25 μF, 2.5 kV ; After the electric shock, add 1 mL of ice-cold LB medium and shake culture at 37°C for 1 hour; take 50 μL of the transformation solution and spread it on the LB plate containing 50 μg / mL apramycin, 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and culture it at 37°C overnight; pick a transformant and inoculate it in 10 mL of LB medium containing 25 μg / mL chloramphenicol, 50 μg / mL kanamycin and 50 μg / mL apramycin, and shake culture it at 37°C, 250 rpm overnight. Transfer 100 μL of the overnight bacterial solution to 10 mL of fresh LB medium containing 25 μg / mL chloramphenicol, 50 μg / mL kanamycin and 50 μg / mL apramycin, and shake culture it at 37°C, 250 rpm until OD 600 At 0.3-0.5; wash twice with 10 mL LB medium and suspend in 1 mL LB medium; take 500 μL of bacterial solution and mix with about 10 suspended in 500 μL 2×YT medium and heat-shocked at 50°C for 10 min. 8 The cells of the starting strain Streptomyces avermitilis were mixed with 100 cells of spores and centrifuged briefly. Part of the supernatant was discarded and the cells were suspended with the remaining supernatant and spread on a plate containing 10 mM MgCl. 2 MS plates were cultured at 30°C for 16-20 h; sterile water containing 0.5 mg nalidixic acid and 1.25 mg apramycin was covered on the plates and cultured at 30°C for more than 5 days to grow transformants; screening of aveA3 successfully replaced mutants: the transformants were subcultured once on YMS plates containing 20 μg / mL nalidixic acid and 25 μg / mL apramycin, and then subcultured twice on YMS plates without antibiotics to isolate single colonies. Single colonies were cultured on YMS medium containing 25 μg / mL apramycin and without antibiotics, respectively, to screen out apramycin-sensitive strains; genomic DNA was extracted from the screened apramycin-sensitive strains, and PCR tests were performed using primers MilA3DCF, MilA3DCR; MilA3UCF, MilA3UCR; AveA3F, AveA3R; and rTaq DNA polymerase according to the instructions; the first two pairs of primers can amplify bands of 1342 bp and 1893 bp respectively, while the third pair of primers cannot amplify the target band, which is the target strain.

[0018] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0019] 1. Establish a new method for obtaining new avermectin insecticides by modifying the biosynthetic pathway of macrolide antibiotics.

[0020] 2. Use synthetic biology technology to combine the functional modules of the genomes of Streptomyces avermitilis and Streptomyces hygroscopicus to create a new strain of Streptomyces avermitilis. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Flowchart for plasmid construction.

[0022] Figure 2 This is the plasmid map pAmT.

[0023] Figure 3 This is the plasmid map pAmT-AA3U-milA3-AA3D.

[0024] Figure 4 Schematic diagram of the genome changes of the engineered strain HU510.

[0025] Figure 5 This is the HPLC profile of the fermentation sample of the engineered strain HU510 (Henvermectin B abbreviation: HVM B).

[0026] Figure 6 This is the mass spectrum of comycin B.

[0027] Figure 7 For comycin B dissolved in CDCl 3 In 1 H-NMR spectrum.

[0028] Figure 8 For comycin B dissolved in CDCl 3 In 13 C-NMR spectrum. DETAILED DESCRIPTION

[0029] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0030] See also Figure 1-8. It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings in this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions for the implementation of the present invention, so they have no substantial technical significance. Any modification of the structure, change in the proportional relationship, or adjustment of the size should still fall within the scope of the technical content disclosed by the present invention without affecting the effects and purposes that can be achieved by the present invention. At the same time, the terms such as "upper", "lower", "left", "right", "middle" and "one" quoted in this specification are only for the convenience of description, and are not used to limit the scope of the implementation of the present invention. Changes or adjustments in their relative relationships should also be regarded as the scope of the implementation of the present invention without substantially changing the technical content.

[0031] Deposit of biological material:

[0032] Streptomyces avermitilis HU510 was deposited in China Center for Type Culture Collection (CCTCC) on October 9, 2024, and the strain deposit number is CCTCC NO: M 20242151. The deposit address is: China Center for Type Culture Collection, Wuhan University, Wuhan, China.

[0033] Unless otherwise specified, the reagents or materials described in the following examples are commercially available.

[0034] Example 1: 16S rDNA sequence analysis and bacterial species identification

[0035] Fresh cells of the strain Streptomyces avermitilis HU510 to be tested were collected, and total DNA was extracted as a template. Universal primers (27F, 1492R) were used to amplify the 16S rDNA gene, and the PCR products were detected and purified for sequence determination. The sequencing was completed by General Biotechnology (Anhui) Co., Ltd. The measured 16S rDNA gene sequence was proofread and then compared with the sequences of related species and genera in the GenBank database on the NCBI website for homologous sequence BLAST to determine the classification of the strain.

[0036] The 16s rDNA sequence of Streptomyces avermitilis HU510 was compared with the relevant sequences in GenBank by BLAST. The results are shown in the table:

[0037]

[0038] The 16s rDNA gene sequencing of Streptomyces avermitilis HU510 (sequence as follows) revealed that the strain had 100% homology with Streptomyces avermitilis, so HU510 was identified as Streptomyces avermitilis.

[0039]

[0040]

[0041] Example 2: Construction of recombinant Streptomyces avermitilis HU510

[0042] 1. Extraction of genomic DNA from Streptomyces avermitilis and Streptomyces hygroscopicus

[0043] a. Inoculate spores of Streptomyces avermitilis and Streptomyces hygroscopicus preserved in the laboratory into 50 mL of TSB medium and culture at 28°C and 250 rpm for 32 to 48 h.

[0044] b. Collect an appropriate amount of cells by centrifugation, wash twice with 1×TE solution, resuspend the cells with 500μL 1×TE solution, add lysozyme to a final concentration of 5mg / mL, then add 1μL RNase and incubate in a 37℃ water bath for 30-60min.

[0045] c. Add 60 μL 10% SDS to make the final concentration of 1%, add 40 μL proteinase K to make the final concentration of 1 mg / mL, and incubate in a 55°C water bath for 30-60 min.

[0046] d. Add 200 μL 5M NaCl to a final concentration of 1.25M.

[0047] e. Add 800 μL of phenol:chloroform:isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 8000 rpm at 20°C for 20 min.

[0048] f. Take 500 μL of supernatant, add 40 μL of 3M pH=7.5 NaAc-HAc buffer solution, mix well, add 1 mL of anhydrous ethanol, and centrifuge at 12000 rpm for 5 min to precipitate genomic DNA.

[0049] g. Wash the precipitate twice with 70% ethanol, centrifuge and discard the liquid, and after drying, dissolve it in 1×TE solution to obtain a genomic DNA solution.

[0050] 2. Construction of plasmid pAmT

[0051] a. To obtain T-Vector pMD TM The 19 (Simple) self-ligating vector was ligated according to the instructions of T4 ligase (Thermo), and then transformed into DH5α competent cells. Blue spots (not white spots) were selected on LB plates containing IPTG, X-Gal, and ampicillin, and the plasmid pMD19s was cultured and extracted.

[0052] b. Plasmid pMD19s was digested with Ssp I (TaKaRa), dephosphorylated with FastAP (Thermo), and the approximately 2.7 kb fragment 1 was recovered by electrophoresis.

[0053] c. Plasmid PIJ773 was digested with XbaI and BstBI (Thermo), and the approximately 1.4 kb fragment 2 containing the aac(3)IV gene and oriT was recovered by electrophoresis.

[0054] d. Fragment 1 and fragment 2 were blunt-ended according to the instructions of BKL kit (TaKaRa) and ligated to obtain the recombinant plasmid pAmT.

[0055] 3. Construction of the recombinant plasmid pAmT-AA3U-milA3-AA3D used to replace the aveA3 gene of Streptomyces avermitilis.

[0056] a. Cosmid MilA3 used for cloning milA3 [Steps reference: Xia Haiyang, Huang Jun, Hu Minjie, et al. Construction of a Coss library of ordered Streptomyces avermitilis genomes for genetic modification of industrial production strains. Chinese Journal of Antibiotics, 2009, 34(7): 403-405], this cosmid contains the complete milA3 gene from Streptomyces hygroscopicus or Streptomyces icebergii.

[0057] b. Design primers: Primers AA3UF and AA3UR are used to amplify the approximately 2.5 kb fragment AA3U upstream of the aveA3 gene of Streptomyces avermitilis; AA3DF and AA3DR are used to amplify the approximately 2.5 kb fragment 2AA3D downstream of the aveA3 gene of Streptomyces avermitilis.

[0058] c. Plasmid pAmT was digested with XbaⅠ and dephosphorylated with FastAp to obtain fragment 3.

[0059] d. Fragment 1 was digested with XbaⅠ, recovered by electrophoresis, and ligated with fragment 3 to obtain the vector pAmT-AA3U.

[0060] e. Fragment 2 was digested with XbaⅠ, recovered by electrophoresis, and connected to the vector pAmT-AA3U. Primers were used to verify that the sequences of fragments 1 and 2 were consistent. Plasmid pAmT-AA3U-AA3D was obtained, and fragment 4 was recovered by digestion with XbaⅠ.

[0061] f. Transformation of library plasmid cosmid milA3 into E. coli BW25113 / pIJ790: A single colony of E. coli BW25113 / pIJ790 was inoculated into 10 mL of LB medium (tryptone 1.0%, yeast powder 0.5%, NaCl 0.5%, glucose 0.1%) containing 25 μg / mL chloramphenicol, and cultured overnight at 30°C, 250 rpm with shaking (14-18 h, the same below). 100 μL of the overnight bacterial solution was transferred to 10 mL of SOB medium (tryptone 2.0%, yeast powder 0.5%, NaCl 0.05%, 10 mL of 250 mM KCl solution per liter, and 5 mL of sterilized 2M MgCl per liter before use) containing 25 μg / mL chloramphenicol. 2 ) and cultured at 30°C, 250 rpm for 3-4 h until OD 600 About 0.4. At 4°C, centrifuge at 4000rpm for 5min to collect the bacteria, wash twice with 10mL of ice-cold 10% glycerol, and suspend the precipitate with 100μL of ice-cold 10% glycerol to obtain the electroporation competent state. Add about 100ng (2-3μL) of library plasmid cosmid milA3 to 50μL of competent cells, and perform electroporation in a 0.2cm ice-cold electroporation cup. The electroporation parameters are: 200Ω, 25μF, 2.5kV. The duration of the electroporation is between 4.5 and 4.9ms. After the electroporation, immediately add 1mL of pre-cooled LB medium and culture at 30°C for 1h. Take 50μL of the transformation solution and spread it on an LB plate containing 50μg / mL kanamycin and 25μg / mL chloramphenicol (LB medium containing 1.5% agar powder), culture at 30°C overnight, and grow a single colony.

[0062] g. PCR targeting of library plasmid: Randomly pick a single colony of Escherichia coli BW25113 / pIJ790 containing the library plasmid cosmid milA3 and inoculate it into 10mL LB medium containing 50μg / mL kanamycin and 25μg / mL chloramphenicol, and culture it at 30°C and 250rpm overnight. Take 100μL of overnight bacterial solution and transfer it to 10mL SOB medium containing 50μg / mL kanamycin, 25μg / mL chloramphenicol and 10mM L-arabinose, and culture it at 30°C and 250rpm. Prepare the electroporation competent state according to the method in step f. Add about 100ng (2-3μL) of fragment 4 obtained in step e to 50μL competent cells, and perform electric shock in a 0.2cm ice pre-cooled electric shock cup. The electric shock parameters are: 200Ω, 25μF, 2.5kV. The duration of the electric shock is between 4.5 and 4.9ms. Immediately add 1 mL of pre-cooled LB medium and shake culture at 37°C for 1 hour. After simple centrifugation, remove most of the supernatant, suspend the precipitate with the remaining supernatant, and spread the entire amount on an LB plate containing 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture at 37°C overnight. Pick a single colony in 3 mL of LB medium containing 50 μg / mL kanamycin and 50 μg / mL apramycin, shake culture at 37°C, 250 rpm for about 6 hours, extract the plasmid with a plasmid extraction kit according to the instructions, and perform enzyme digestion test with restriction endonucleases to screen out the correct plasmid and obtain the recombinant plasmid pAmT-AA3U-milA3-AA3D.

[0063] 4. Gene replacement of Streptomyces avermitilis aveA3

[0064] a. Use the conjugation transfer method to transform the recombinant plasmid pAmT-AA3U-milA3-AA3D into the starting strain Streptomyces avermitilis: Escherichia coli ET12567 (pUZ8002). Prepare the electroporation competent cells according to the method described in step 3-f (the culture temperature is 37°C, and the final concentration of antibiotics in the culture medium is: chloramphenicol 25μg / mL, kanamycin 25μg / mL). Add about 100ng (1-2μL) of the recombinant plasmid pAmT-AA3U-milA3-AA3D to 50μL of competent cells, and perform electroporation in a 0.2cm ice-precooled electroporation cup. The electroporation parameters are: 200Ω, 25μF, 2.5kV. After the electroporation, immediately add 1mL of ice-precooled LB culture medium and culture at 37°C with shaking for 1h. Take 50 μL of the transformation solution and spread it on an LB plate containing 50 μg / mL apramycin, 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and culture it at 37°C overnight. Randomly pick a transformant and inoculate it into 10 mL of LB medium containing 25 μg / mL chloramphenicol, 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture it at 37°C, 250 rpm, shaking overnight. Transfer 100 μL of the overnight bacterial solution to 10 mL of fresh LB medium containing 25 μg / mL chloramphenicol, 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture it at 37°C, 250 rpm, shaking, until OD 600 At about 0.4. Wash twice with 10 mL LB medium and suspend in 1 mL LB medium. Take 500 μL of bacterial solution and mix with about 10 μL of 2×YT medium (tryptone 1.6%, yeast powder 1.0%, NaCl 0.5%) and heat-shocked at 50°C for 10 min. 8 The cells were mixed with 100 mM MgCl2 and 10 mM spores of Streptomyces avermitilis. After a brief centrifugation, most of the supernatant was discarded. The cells were suspended with the remaining supernatant and spread on a plate containing 10 mM MgCl2. 2 MS plates (soybean cake powder 2%, mannitol 2%, agar powder 2%) were cultured at 30°C for 16-20 hours. Sterile water containing 0.5 mg nalidixic acid and 1.25 mg apramycin was covered on the plates and cultured at 30°C for more than 5 days to grow transformants.

[0065] b. Screening of aveA3 successfully replaced mutants: The transformants were subcultured once on a YMS (0.4% yeast extract, 0.4% soluble starch, 1.0% malt extract, 1.8% agar powder) plate containing 20 μg / mL nalidixic acid and 25 μg / mL apramycin, and then subcultured twice on a YMS plate without antibiotics to isolate single colonies. Single colonies were cultured on YMS medium containing 25 μg / mL apramycin and YMS medium without antibiotics to screen apramycin-sensitive strains. The genomic DNA of the screened apramycin-sensitive strains was extracted according to the method of step 1 of this embodiment, and PCR tests were performed using primers MilA3DCF, MilA3DCR; MilA3UCF, MilA3UCR; AveA3F, AveA3R; and rTaq DNA polymerase (TaKaRa) according to the instructions. The first two pairs of primers can amplify bands of 1342bp and 1893bp respectively, while the third pair of primers cannot amplify the target band. The selected strain numbered HU510 is used as the target strain for further genetic modification. Figure 4 Shown is the process of gene replacement in the starting strain Streptomyces avermitilis.

[0066] MilA3DCF: CGCCTCCCGGATCGTTGCGCTCGTACGGC;

[0067] MilA3DCR: CGCCGAGGGCGCCCTGACCTTCGT;

[0068] MilA3UCF:CGTCCCGCTCCGCATGGCCA;

[0069] MilA3UCR:CGGAATCGGCGCGGTGACCCC;

[0070] AveA3F: ACGCAACGCCTGCGCCGCCCAATG;

[0071] AveA3R: CCGTGCGCGCGTGCCTGTCG.

[0072] c. Fermentation verification of genetically engineered bacteria HU510. A single colony of HU510 was inoculated into a seed culture medium (corn starch 2.5%, soybean meal 0.8%, peanut meal 1%, yeast powder 0.95%, CoCl 2 6H 2 O 0.003%, pH 7.2-7.4), 28°C, 250rpm for 40h. The inoculum of 6% was transferred to the fermentation medium (corn starch 14%, amylase 0.003%, soybean cake powder 2.0%, yeast powder 1%, zeolite powder 0.2%, MnSO 40.0024%,Na 2 MoO 4 0.0024%, CoCl 2 6H 2 O0.002%, pH7.2~7.4), 28℃, 250rpm for 8 days. Take 1mL of fermentation broth, add 4mL of anhydrous methanol to soak, and filter after ultrasonication for 1h. The filtrate is used for HPLC analysis. The conditions of HPLC analysis are: chromatographic column: Ultimate XB-C18 4.6×250×5 (Welch); mobile phase: acetonitrile: water = 80:20; flow rate: 1mL / min; absorption wavelength: 240nm. The results are as follows Figure 5 : A is the HPLC spectrum of the fermentation liquid of the starting strain, and B is the HPLC spectrum of the fermentation liquid of the genetically engineered strain HU510. After identification, the peak with a retention time of 39.857 min is comycin B.

[0073] Example 3: Fermentation of a fermentation broth containing comycin B

[0074] Bacterial species: Streptomyces avermitilis HU510.

[0075] Slant culture: ISP2 medium (0.4% yeast extract, 0.4% glucose, 1.0% malt extract, 2.0% agar powder, pH 7.0-7.2) was sterilized at 121°C for 20 min and cultured at 28°C for 6-8 days after inoculation.

[0076] Seed culture: corn starch 3.0%, soybean cake powder 1.0%, corn steep powder 1.0%, yeast powder 0.5%, K 2 HPO 3 0.03%, pH 7.2-7.4. Use 500mL Erlenmeyer flasks to dispense 100mL of the solution into each bottle, then use 20mL of sterile water to wash off the Streptomyces spores on the slant and prepare a spore suspension. Inoculate 2-5mL of the spore suspension into each bottle, place on a shaker, rotate at 250rpm, and culture at 28℃ for 48h.

[0077] Fermentation culture: glucose 8.0%, corn starch 2.0%, soybean meal 1.0%, peanut meal 2.0%, NaCl 0.3%, CaCO 3 0.3%,MgSO4·7H 2 O 0.2%, K 2 HPO 3 0.05%, pH 7.0-7.2. Use 500mL triangular flasks to dispense 100mL of the solution into each bottle, inoculate the seed solution into a fermentation shake flask at a 5%-10% inoculation rate, and culture at 250rpm and 28℃ for 8-10 days.

[0078] Example 4: Extraction and identification of comycin B

[0079] The fermentation broth was filtered to obtain mycelium, and extracted twice with methanol to obtain a methanol extract. The methanol extract was vacuum concentrated to dryness to obtain an extract containing comycin B. After the extract was mixed with silica gel, it was placed on a silica gel column and eluted with a gradient of petroleum ether / acetone in a ratio of 90:10, 80:20, 70:30, and 60:40. The eluted fractions were collected in sections and detected by TLC to obtain an eluate containing the target component, which was then vacuum concentrated to dryness. The above components were separated by reverse chromatography under the following conditions:

[0080] Liquid phase system: Agilent 1260 semi-preparative high pressure liquid chromatograph

[0081] Preparative chromatographic column: Zorbax SB-C18 (250 mm × 9.4 mm)

[0082] Eluent: methanol / acetonitrile / water = 65:28:7

[0083] Flow rate: 1.5mL / min

[0084] Detection wavelength: λ = 240nm

[0085] The peak with a retention time of 22.5 min was collected to obtain comycin B.

[0086] The mass spectrometry analysis and NMR analysis of comycin B are shown in the attached Figure 6-8 The results showed that the molecular weight of comycin B was 557. Structural analysis showed that it was the structure of comycin B mentioned above.

[0087] The Streptomyces avermitilis producing ivermectin B1b was screened and obtained in this embodiment. Through recombination and transformation, an engineered strain of Streptomyces avermitilis HU510 (deposited in China Center for Type Culture Collection, deposit number: CCTCCNO: M20242151) was obtained. A new type of biological insecticide Henvermectin B (Henvermectin B), also known as Milbemycin D, was isolated from the fermentation product of the strain. It has the same skeleton structure as avermectin, ivermectin, and milbemycin A3 / A4, and only differs in C-13, C-22-23, and C-25. Unlike the C-25 substituent (methyl, ethyl) of Milbemycin A3 / A4, the C-25 position of Henvermectin B is isopropyl. Henvermectin B has higher safety than avermectin and ivermectin, and higher insecticidal activity than Milbemycin A3 and A4. The following is the structural diagram of ivermectin B, milbemycin A3 / A4, avermectin, and ivermectin.

[0088]

[0089] Studies have shown that among avermectin compounds, the structural differences of C-25, C-22-23 and C-13 have a significant effect on activity. For example, the structural difference between avermectin and ivermectin is at C-22-23. Avermectin is an unsaturated double bond while ivermectin is a saturated single bond. The toxicity of ivermectin is lower than that of avermectin, so C-22-23 is a single bond and safer. The biggest difference between ivermectin and milbemycin is at C-13. Ivermectin is a dioleanose group, while milbemycin has no substituents. In addition, their C-25 substituents are also different. The difference in activity between ivermectin and milbemycin shows that the C-13 and C-25 substituent structures have a significant effect on activity.

[0090] Example 5: Insecticidal activity of comycin B against Tetranychus cinnabarinus and Pine Wood Nematode

[0091] 1. Activity of comycin B against Tetranychus cinnabarinus: The insecticidal activity of comycin B was determined using Tetranychus cinnabarinus as the test insect.

[0092] Test agent: A certain mass of comycin B (prepared according to the method of Example 4 of the present invention) was weighed on an analytical balance, dissolved in DMF to prepare a 1% mother solution, and diluted with distilled water containing 0.1% Tween 80 to prepare 6 series of concentrations of 0.1, 0.08, 0.05, 0.025, 0.0125, and 0.00625 mg / L for testing.

[0093] Experimental plan: leaf disc spray method was used. The broad bean leaves were beaten into leaf discs, moisturized with cotton, and placed in a plastic culture dish. Adult cinnabarinus mites that were raised indoors and in the same physiological state were selected, and 20 to 40 mites were inoculated on each leaf disc. After the test insects were stable on the leaves, the leaf discs were placed under the Potter spray tower for quantitative (2.5mL) spray treatment. After drying naturally, they were placed in an observation room at 24 to 26℃ for cultivation. The results were investigated after 48 hours. The experiment was repeated 4 times, and a blank control was set.

[0094] Death judgment criteria: When the insect body is touched with tweezers, if there is no reaction, it is considered dead.

[0095] Table 1 Biological activity of comycin B against Tetranychus cinnabarinus

[0096]

[0097] 2. Determination of the activity of comycin B against pine wood nematodes: The insecticidal activity of comycin B was determined using pine wood nematodes (Bursaphelenchus xylophilus) as test insects.

[0098] Test reagent: Weigh a certain mass of comycin B using an analytical balance, dissolve it in DMSO to prepare a 1% stock solution, and dilute it with distilled water containing 0.1% Tween 80 to prepare 6 series of concentrations of 400, 200, 100, 50, 25, and 12.5 mg / L for testing.

[0099] Experimental plan: The immersion method was used. 10 μL of a certain concentration of the test drug solution and 90 μL of nematode suspension (about 3000 nematodes / mL) were added to a 96-well plate at the same time. After mixing, the mixture was placed in a mold incubator at 23±1°C for dark culture. After 48 hours, 10 μL of the bottom liquid in each well was aspirated onto a glass slide. The survival of all nematodes in 10 μL was checked under a microscope (eyepiece 10×, objective lens 10×). Those that could not bend and move were considered dead. The mortality rate of nematodes was counted, and the plate was repeated 3 times. A solvent control was also set up.

[0100] Death determination criteria: Inability to bend and move is considered death.

[0101] Table 2 Biological activity of comycin B against pine wood nematodes

[0102]

[0103] The insecticidal activity test showed that comycin B had good biological activity against both pests and could be used as a new type of biological insecticide.

[0104] The above description is only used to explain the preferred embodiments of the present invention, and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.

Claims

1. A recombinant Streptomyces avermitilis, characterized in that: The recombinant Streptomyces avermitilis HU510 (Streptomyces avermitilis HU510) is deposited in the China Center for Type Culture Collection (CCTCC), the preservation date is October 9, 2024, and the strain preservation number is CCTCC NO: M 20242151.

2. Use of the recombinant Streptomyces avermitilis according to claim 1 in the preparation of comycin B.

3. An antibiotic prepared by fermentation of the recombinant Streptomyces avermitilis according to claim 1, characterized in that: Conforms to at least one of the following structural formulas.

4. The method for constructing a recombinant Streptomyces avermitilis according to claim 1, characterized in that: The aveA3 gene in the genome of the avermectin-expressing Streptomyces avermitilis is replaced with a functional milA3 gene by PCR targeting technology, so that the aveA3 gene is inactivated or its activity is reduced, and the avermectin Streptomyces avermitilis obtains a functional milA3 gene.

5. The method for constructing a recombinant Streptomyces avermitilis according to claim 4, characterized in that: The following steps are involved: Step 1: Extraction of genomic DNA of Streptomyces avermitilis and Streptomyces hygroscopicus; Step 2: Construction of plasmid pAmT; Step 3: Construction of the recombinant plasmid pAmT-AA3U-milA3-AA3D for replacing the aveA3 gene of Streptomyces avermitilis; Step 4: Replacement of the Streptomyces avermitilis aveA3 gene.

6. The method for constructing a recombinant Streptomyces avermitilis according to claim 5, characterized in that: In step 1, spores of Streptomyces avermitilis and Streptomyces hygroscopicus are inoculated into the culture medium respectively, and cultured at 25-30° C. for 32-48 hours; the cells are collected by centrifugation, washed twice with 1×TE solution, resuspended with 500 μL 1×TE solution, lysozyme is added to make the final concentration of 5 mg / mL, and then 1 μL RNase is added, and the culture is incubated in a water bath at 35-39° C. for 30-60 minutes; 60 μL SDS with a mass fraction of 10% is added to make the final concentration of 1%, and 40 μL proteinase K is added to make the final concentration of 1 mg / mL, and the culture is in a water bath at 54-56° C. for 30-60 minutes; 200 μL 5M NaCl is added to make the final concentration of 1.25M; 800 μL of a mixed solution consisting of phenol, chloroform and isoamyl alcohol is added and mixed, and the culture is centrifuged at 20° C. and 8000 rpm for 20 minutes; 500 μL of supernatant is taken, 40 μL 3M The pH value is 7.5NaAc-HAc buffer solution, after mixing, 1mL of anhydrous ethanol is added, and the mixture is centrifuged at 10000-15000rpm for 5min to precipitate genomic DNA; the precipitate is washed with 70% ethanol by volume, the liquid is discarded by centrifugation, and after drying, it is dissolved in 1×TE solution to obtain a genomic DNA solution; the volume ratio of phenol: chloroform: isoamyl alcohol in the mixed solution is 25:24:

1.

7. The method for constructing a recombinant Streptomyces avermitilis according to claim 5, characterized in that: In step 2, plasmid pMD19s was digested with Ssp I, dephosphorylated with FastAP, and fragment 1 was recovered by electrophoresis; plasmid PIJ773 was digested with XbaI and BstBI, and fragment 2 containing aac(3)IV gene and oriT was recovered by electrophoresis; fragments 1 and 2 were blunt-ended according to the instructions of the BKL kit and ligated to obtain the recombinant plasmid pAmT.

8. The method for constructing a recombinant Streptomyces avermitilis according to claim 5, characterized in that: In step 3, primers AA3UF and AA3UR are used to amplify the upstream fragment AA3U of the aveA3 gene of Streptomyces avermitilis; AA3DF and AA3DR are used to amplify the downstream fragment 2AA3D of the aveA3 gene of Streptomyces avermitilis; plasmid pAmT is digested with XbaⅠ and dephosphorylated with FastAp to obtain fragment 3; fragment 1 is digested with XbaⅠ, recovered by electrophoresis, and connected with fragment 3 to obtain vector pAmT-AA3U; fragment 2 is digested with XbaⅠ, recovered by electrophoresis, and connected with vector pAmT-AA3U to obtain plasmid pAmT-AA3U-AA3D, which is then digested with XbaⅠ to obtain fragment 4; library plasmid cosmid Transformation of milA3 into E. coli BW25113 / pIJ790: A single colony of E. coli BW25113 / pIJ790 was inoculated into 10 mL of LB medium containing 25 μg / mL chloramphenicol and cultured overnight at 30°C and 250 rpm. 100 μL of the overnight bacterial culture was transferred to 10 mL of SOB medium containing 25 μg / mL chloramphenicol and cultured at 30°C and 250 rpm for 3-4 h until the OD 600 The cell mass was collected by centrifugation at 4000 rpm for 5 min at 4°C, washed twice with 10 mL of ice-cold 10% glycerol, and the precipitate was suspended in 100 μL of ice-cold 10% glycerol to obtain electroporation competent cells; 50 to 150 ng of library plasmid cosmidmilA3 was added to 50 μL of competent cells, and electroporation was performed in a 0.2 cm ice-cold electroporation cup; the electroporation parameters were: 200 Ω, 25 μF, 2.5 kV; the duration of the electroporation was 4.5 to 4.9 ms; after the electroporation, 1 mL of pre-cooled LB medium was added, and the cells were shaken and cultured at 30°C for 1 h; 50 μL of the transformation solution was spread on an LB plate containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured overnight at 30°C to grow a single colony; PCR targeting of the library plasmid: randomly pick a plasmid containing the library plasmid cosmid A single colony of Escherichia coli BW25113 / pIJ790 with milA3 was inoculated into 10 mL of LB medium containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured overnight at 30°C and 250 rpm; 100 μL of the overnight bacterial solution was transferred to 10 mL of SOB medium containing 50 μg / mL kanamycin, 25 μg / mL chloramphenicol and 10 mM L-arabinose, and cultured at 30°C and 250 rpm to prepare an electroporation competent state; 50-150 ng of fragment 4 was added to 50 μL of competent cells, and electroporation was performed in a 0.2 cm ice-precooled electroporation cup; the electroporation parameters were: 200 Ω, 25 μF, 2.5 kV; the duration of the electroporation was between 4.5 and 4.9 ms; 1 mL of cold precooled LB medium was added, and cultured at 37°C and shaken for 1 h; after centrifugation, part of the supernatant was removed, and the precipitate was suspended with the remaining supernatant. , and spread the entire amount on an LB plate containing 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture at 37°C overnight; pick a single colony in 3 mL LB medium containing 50 μg / mL kanamycin and 50 μg / mL apramycin, and culture at 37°C, 250 rpm for about 6 hours, extract the plasmid with a plasmid extraction kit according to the instructions, and perform enzyme digestion test with restriction endonucleases to screen out the correct plasmid and obtain the recombinant plasmid pAmT-AA3U-milA3-AA3D.

9. The method for constructing a recombinant Streptomyces avermitilis according to claim 5, characterized in that: In step 4, the recombinant plasmid pAmT-AA3U-milA3-AA3D was transformed into the starting strain Streptomyces avermitilis: Escherichia coli ET12567 by conjugation transfer to prepare the electroporation competent state, 1-2 μL of the recombinant plasmid pAmT-AA3U-milA3-AA3D was added to 50 μL of competent cells, and electroporation was performed in a 0.2 cm ice pre-cooled electroporation cup; the electroporation parameters were: 200Ω, 25 μF, 2.5 kV; the electroporation result was: After the reaction is completed, add 1 mL of ice-cold LB medium and shake culture at 37°C for 1 hour; take 50 μL of the transformation solution and spread it on an LB plate containing 50 μg / mL apramycin, 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and culture it at 37°C overnight; pick a transformant and inoculate it in 10 mL of LB medium containing 25 μg / mL chloramphenicol, 50 μg / mL kanamycin and 50 μg / mL apramycin, and shake culture it at 37°C, 250 rpm overnight. Transfer 100 μL of the overnight bacterial solution to 10 mL of fresh LB medium containing 25 μg / mL chloramphenicol, 50 μg / mL kanamycin and 50 μg / mL apramycin, and shake culture it at 37°C, 250 rpm until OD 600 At 0.3-0.5; wash twice with 10 mL LB medium and suspend in 1 mL LB medium; take 500 μL of bacterial solution and mix with about 10 μL of suspended in 500 μL 2×YT medium and heat-shocked at 50°C for 10 min. 8 The starting strain Streptomyces avermitilis spores were mixed with 100 cells, and after simple centrifugation, part of the supernatant was discarded. The cells were suspended with the remaining supernatant and spread on MS plates containing 10 mM MgCl2, and cultured at 30°C for 16-20 h; sterile water containing 0.5 mg nalidixic acid and 1.25 mg apramycin was covered on the plates, and cultured at 30°C for more than 5 days to grow transformants; screening of aveA3 successful replacement mutants: the transformants were subcultured once on YMS plates containing 20 μg / mL nalidixic acid and 25 μg / mL apramycin, and then subcultured twice on YMS plates without antibiotics to isolate single colonies. Single colonies were cultured on YMS medium containing 25 μg / mL apramycin and without antibiotics, respectively, to screen out apramycin-sensitive strains; genomic DNA was extracted from the screened apramycin-sensitive strains, and PCR tests were performed using primers MilA3DCF, MilA3DCR; MilA3UCF, MilA3UCR; AveA3F, AveA3R; and rTaq DNA polymerase according to the instructions; the first two pairs of primers can amplify bands of 1342 bp and 1893 bp respectively, while the third pair of primers cannot amplify the target band, which is the target strain.

Images